Download Introduction to Genetics

Introduction to Genetics
Basics of Genetics
GlaxoSmithKline's genetic research efforts will help change the way
medicines are discovered, developed, and prescribed and the way many
diseases are diagnosed and treated.
GSK is an industry leader in the field of genetics, focusing on
the examination of the genetic basis of common diseases and
patients' responses to medicines — learning about the
identity and function of genes associated with diseases and
understanding why some medicines work better for certain
people than others and who is most likely to experience a
serious side effect.
DNA
How do cells know what to do in your body? How can DNA determine what
you will look like?
Instructions that provide almost all of the
information necessary for a living organism to grow
and function are in the nucleus of every cell. These
instructions tell the cell what role it will play in your
body. The instructions are in the form of a molecule
called deoxyribonucleic acid, or DNA.
DNA is the chemical responsible for preserving,
copying and transmitting information within cells
and from generation to generation.
In humans, the DNA molecule consists of two
ribbon-like strands that wrap around each other,
resembling a twisted ladder. This is often described
as a double helix. DNA is contained in tightly coiled
packets called chromosomes, found in the nucleus
of every cell. Chromosomes consist of the double
helix of DNA wrapped around proteins.
The twisted ladder is made up of repeating units
called nucleotides, each of which is a single
building block of DNA. Nucleotides are composed of
one sugar-phosphate molecule (the linear strands
or outer rails of the ladder) and one base. DNA
consists of two nucleotide strands joined by weak
chemical bonds between the two bases, forming base pairs. A base pair is a
rung or step on the ladder of the DNA. The bases are called A (for adenine),
C (for cytosine), T (for thymine) and G for guanine.
These bases always pair up in the following way:
· A+T
· C+G
A single strand of DNA is made of letters:
ATGCTCGAATAAATGTGAATTTGA
The letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA
The words make sentences:
<ATG CTC GAA TAA> <ATG TGA ATT TGA>
These "sentences" are called genes. Genes tell the cell to make other
molecules called proteins. Proteins are required for the structure, function,
and regulation of the body's cells, tissues, and organs.
We have approximately three billion base pairs (6
billion bases total) of DNA in most of our cells.
This complete set of genes is called a genome.
With the exception of identical twins, the
sequence of the bases is different for everyone,
which makes each of us unique.
The Human Genome
see a larger view
DNA and Human Diversity
Although we all look quite different from one another, we are surprisingly
alike at the DNA level. The DNA of most people is 99.9 percent the same.
Only about 3 million base pairs are responsible for the differences among us
— which is only one tenth of 1% of our DNA. Yet these DNA base sequence
variations influence most of our physical differences and many of our other
characteristics, as well.
Sequence variations occur in our genes, and the resulting different forms of
the same gene are called alleles. People can have two identical or two
different alleles for a particular gene.
Mutations
A mutation or polymorphism is a change in the
DNA "letters" of a gene or an alteration in the
chromosomes.
Polymorphisms are common differences in the
sequence of DNA, occurring in at least 1% of the
population. Mutations are less common
differences, occurring in less than 1% of the
population.
What is a mutation in one place may be a
polymorphism in another. For example, the base
change that causes sickle cell anemia is defined
as a mutation in Caucasian populations because it
occurs in less than 1% of people. In parts of
Africa where it is found in 25% of the population,
it is defined as a polymorphism.
Most DNA variation is neutral (not beneficial or
harmful), but harmful sequence changes
sometimes do occur. Changes within genes can
result in proteins that don't work normally or
don't work at all. Some of these changes can
contribute to disease or affect how someone
responds to a medicine.
SNP means:
Single Nucleotide
Polymorphisms
Mutations may be passed down from parent to
child (in the sperm or egg cells), may occur
around the time of conception or may be acquired
during a person's lifetime.
Mutations can arise spontaneously during normal
cell functions, such as when a cell divides, or in response to environmental
factors such as toxins, radiation, hormones, and even diet.
Nature provides us with a system of finely tuned repair enzymes that find
and fix most DNA errors. But as our bodies change in response to age, illness
and other factors, our repair systems may become less efficient. Uncorrected
mutations can accumulate, resulting in diseases such as cancer.
Genes
Genes are the basic units of heredity in living cells. They consist of a length
of DNA that contains instructions ("codes") for making a specific protein.
Through these proteins, our genes influence almost everything about us,
including how tall we will be, how we process foods, and how we respond to
infections and medicines.
Although most of our cells have the same genes, not all genes are active in
every cell. Heart cells synthesize proteins required for that organ's structure
and function; liver cells make liver proteins, and so on. In other words, not
all the genes are "switched on" and expressed as proteins within every cell.
Within an individual cell, the same genes may be switched on at some times
and switched off at other times.