Download fall break, take home exam

NAME:
Midterm take home exam 446/546, Fall 2016 Due 13.00h, Friday 21st October.
Open book, 15 questions, 100 points. Do your own work, you can use all resources including your notes,
books (consider bookshelf at the NCBI website), information and software available though class or from
the internet (google, youtube) to answer the questions below. Unless indicated otherwise, answer within
the space provided. Provide only the answer that you think is correct. In case of a correct and a wrong
answer for the same question, points will be deducted for the wrong answer.
Print the exam from this word file and write your answers (legibly) on the printout. Alternatively,
type in your answers. Turn in the hardcopy printout.
Question 1 (5 x 1 point)
Show your (brief) calculations:
a) How many moles is 9.306 grams of EDTA (C10H14O8N2Na2.2H2O, MW = 372.24)?
b) How many grams of NaCl does it take to make 1 liter of a 250 micromolar NaCl
solution?
c) How many grams of SDS does it take to make 1 liter of a 10% w/v SDS solution?
d) What volumes of stock solution and of water must be combined to prepare 1250 ml of
1X TAE from a 50X TAE stock solution?
e) What is the concentration in moles/liter of a 4N HCl solution?
1
Question 2 (2 x 5 point)
Consider the following information that describes properties and specifications of two
primers that were purchased. ALSO note that a) and b) ask for DIFFERENT
CONCENTRATIONS!
a) What volume of water do you add to the tube containing dry primer to prepare a stock
solution of 50 micromolar with all of primer LCO1490?
b) What volume of water do you add to the tube containing dry primer to prepare a stock
solution of 10 micromolar with all of primer HCO2198?
2
Question 3 (5 points)
a) According to the Winnepennickx et al, 1993 paper (Extraction of high molecular
weight DNA from mollusks, TIG 9:407), the CTAB-based method for DNA
extraction was effective to recover DNA from several species belonging to six
different molluscan classes. It also proved suitable for extracting for high
molecular weight DNA from specimens belonging to a number of other
invertebrate phyla.
List all these 7 phyla (1 point):
1
2
3
4
5
6
7
Describe the function of the following components of a DNA extraction buffer:
b) CTAB (cetyltrimethylammonium bromide; 1 point)
c) EDTA (ethylene diamino tetra acetic acid; 1 point)
d) Beta mercapto-ethanol (1 point)
After the addition of chloroform to the extraction reaction (described by Winnepennickx
et al.) followed by centrifugation, is the genomic DNA in the aqueous phase or in the
organic phase? (1 point)
e) the ____________________ phase
Question 4 (5 points)
a) You have completed horizontal agarose gel electrophoresis to analyze your genomic
DNA extraction samples, but after placing the gel on a UV transilluminator you do not
observe any DNA bands. Provide two different possible explanations (you may consider
technical reasons and/or errors), for why this may occur.
Explanation 1 (2 point)
Explanation 2 (2 point)
b) On another agarose gel you observe a PCR amplicon that runs right alongside the
sixth band from the top of the marker lane of the 1kb marker from New England
Biolabs. What is the size (in basepairs) of your PCR amplicon? (1 point)
3
Question 5 (5 points)
Write below the Beer-Lambert law, define the parameters and explain how this law
informs on measuring/estimating concentration of DNA
The Beer-Lambert Law and definition of parameters (2.5 point):
Explanation (2.5 point): this law informs on measuring/estimating concentration of DNA
because
Question 6 (5 points)
a) List complete the list of components/ingredients of a TaqGold PCR reaction (4x .25
point)
1
2
3
4
5 F+R primers
6 water
b) The temperature profile of a PCR reaction contains 25 cycles that each consist of
30 sec 94C, 30 sec 54C, 1 min 72C. Name the process that occurs at each of these
temperatures:
94C: (0.4 point)
54C: (0.3 point)
72C: (0.3 point)
c) Draw a graph showing “% primer annealing to template” versus “temperature” for a
primer with a Tm of 65C, and label the axes (1 point).
4
d) According to David M. Hillis and Michael T. Dixon (1991) Ribosomal DNA: Molecular
Evolution and Phylogenetic Inference The Quarterly Review of Biology, Vol. 66, No. 4, pp.
411-453, what are the names of the primers that are needed to amplify the a 5-6 kb PCR
amplicon that includes sections 5-14, as you can determine from figure 1 AND 2 (2
point).
Forward primer name:
Reverse primer name:
Question 7 (10 points)
Consider the use of cloning such as we have done in class using the pCR2.1 TOPO TA
system, Why would you clone PCR amplicons? Provide two reasons.
-Reason 1) (1 point)
-Reason 2 (1 point)
You have completed the cloning reactions and plated the transformed bacteria on
selective culture plates with X-gal.
-Explain why only bacteria that contain a plasmid can grow on the selective medium? (4
point)
-Explain, why are the transformed bacteria blue or white in color? (4 point)
5
Question 8 (10 points)
In your own words, explain in general terms, the principle of the Qiagen-method for
purification of nucleic acids. Use all of the following words: silica, DEAE, positive
charge, pH, salt concentration, negative charge, bind, rinse, elute (9 points).
Consider the instructions of the QIAquick® Spin kit. Why is it preferred to use EB over
milliQ water for the final elution step ? (1 point)
EB is preferred because
Question 9 (15 points)
a) In your own words explain how DNA Sanger sequencing works, such as we have
performed with BigDye in class. Use all of the following terms in your explanation;
primer, ddNTP, dNTP, ratio, fluorescent label, polymerase, template, extension products,
size, terminal residue, separation, record (13 point).
b) explain why you should not include two different primers in a single sequencing
reaction (2 point).
6
Question 10 (5 points)
a) The following sequence chromatogram yielded high quality sequence.
Provide an explanation for the sudden change in signal (arrow) (2.5 point).
b) This chromatogram was difficult to edit and the resulting sequence did not match
any sequence in Genbank
What is the problem and what causes this phenomenon? (2.5 point).
Question 11 (10 points)
a) A PCR with conserved primers has yielded the following sequence from a DNA sample
from an unknown source.
>unknown
GAGCCGAACTGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACACGTTATCGTCACAGCCCATGCATTTGTATAATCTTCTTCATAGTAATACCCATCATAATCGGGG
GCTTGGCAACTGACTAGTTCCCTAATAATCGTGCCCCCGATATGGCGTTTCCCCGCATAAACAATATAAGTTCTGACTCTTACCTCCCTCTCTCCTACTCTGCTCGCATCTGCT
ATAGTGGAAGCCGGCGCAGGAACAGTTGAACAGTCTACCCTCCCTTAGCAGGGACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTCTCCTTACACCTAGCAGGTGTC
TCCTCTACTTAGGGGCCATCAATTTCATCACAACAATTATTAATATAAACCCCCTGCCATAACCCAATACCAAACCCCCTTTTCGTCTGATCCGTCCTAATCACAGCAGTCCTA
TTCTCCTATCTCTCCCAGTCCTAGCTGCTGCATCACTATACTACTAACAGACCGCAACCTCAACACCACTTCTTCGACCCCGCCGGAGGAGGAGACCCATTCTATACCAACACC
TATTCTGATTTTTCGGCCACCCGAAGTTTATATTCTCATCCTACCAGGCTTGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAGAACCATTTGGATACATAGGTA
TGGTCGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTAGCACACCATATATTTACAGTAGGAATAGCGTAGACACACGAGCATATTTCACCTCCGCTACCATAATAT
CGCTATCCCCACCGGCGTCAAAGTATTAGCTGACTCGCCACACTCCACGGAAGCAATATGAAATGACTGCTGCAGTGCTCTGAGCCCTAGGATTCTCTTTCTTTTCACCGTAGG
TGGCCTGACTGGCATTGTATAGCAAACTCATCACTAGACATCGTACTACCGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTTCAATAGGAGCTGTATTTGCCATCAT
AGGGGCTTCATTCACTGATTTCCCCTATTCTCCGGCTACACCTAGACCAAACTTACGCCAAAATCCATTTCCTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACACAC
TTTCTCGGCCTATCCGGAATGCCCCACGTTACTCGGACTACCCC
Perform a BLASTN with this sequence against GenBank for an initial likely identification of
the genome (mitochondrial or nuclear), and the organism. Perform A BLASTX with the
correct genetic code to identify the name of the gene represented by this sequence:
Genome (1 point):
Organism (1 point):
Gene (3 point):
7
b) You have obtained an amplicon using snail DNA in a PCR reaction that included primers
16SAr (CGCCTGTTTATCAAAAACAT) and 16SBr (CCGGTCTGAACT
CAGATCACGT) as published by Palumbi (1996). You sequenced the fragment on both
strands to obtain the complete, full-length sequence of the PCR product. The resulting
sequence does not match any known sequences when you BLAST
Amplicon sequence (5’ ->3’, 183 nucleotides)
CGCCTGTTTATCAAAAACATATCGGTGATTGGACCATGAGGTGACCCCATATTGACAGGCA
TTGATGATGGTAGAGCCCAGATGACGTTTGAGTGCTAGTGCGATGTGTTGTGAGCGCCGAA
TTCTGCTGATTGAGTCGAGTGGTGATTGCGCTGCTAAATGCGATGTTTTTGATAAACAGCG
Analyze the resulting sequence and provide TWO reasons for why this complete amplicon
sequence is NOT the result of a specific PCR reaction aimed at amplification of a 16S
sequence fragment with two conserved primers .
.
First REASON (2 point)
Second REASON (3 point)
Question 12 (5 points).
Draw in graphical form the anatomy of a PCR amplicon derived with TagGold PCR
polymerase, indicate forward and reverse primers, overhangs and experimental
sequence, indicate strand directionalities using 5’ and 3’ (3 point).
b) Why is it essential to remove primer sequences from PCR amplicons when performing
BLAST sequence similarities searches against sequence databases? (2 point).
8
Question 13 (5 point).
a) Write down the 6-base-pair restriction endonuclease recognition sequence for
EcoRI (1 point).
5’
_
_
_
_
_
_ 3’
3’
_
_
_
_
_
_
5’
b) The following represents a hypothetical 6-base-pair, “inverted repeat palindromic
restriction endonuclease recognition sequence”. Fill in the missing bases (2 point).
5’
A
G
T
_
_
_ 3’
3’
_
_
_
_
_
_
5’
c) Answer yes or no, does EcoRI cut in the sequence provided in question 11a (1 point).
d) Answer yes or no, does EcoRI cut in the sequence provided in question 11b (1 point).
Question 14) (5 points)
a) In your own words explain how Illumina next generation sequencing works, such as we
have had it performed at the MBF with snail DNA for class. Use all of the following terms in
your explanation; DNA fragmentation, adapters, indices, sequencing binding site, regions
complementary to flow cell oligos, hybridization to flow cell, bridge amplification, cluster,
clonal amplification, sequencing by synthesis, fluorescent signal, first read, index, index two,
second read.
9
Question 15) (5 points) Login to Galaxy ( http://pluto.alliance.unm.edu)
From SHARED DATA, Select datalibraries, Adema class 2016 fastq reads, test fastq,
select adema_class_S4 R1 001.fastq (sub-sampled) AND adema_class_S4 R2 001.fastq (sub-sampled)
and import these TO HISTORY.
Click on ANALYZE DATA, analyze these data using the methods used in class on Oct 7th.
Execute fastqc for both fastq files
a) Using data from the fastQC analysis complete this table: (4 x0.5 pt):
fastqc total sequences, fastqc %GC
adema_class_S4 R1 001.fastq (sub-sampled)
adema_class_S4 R2 001.fastq(sub-sampled)
Perform trimmomatic using both fastq files, set parameters for ILLUMINACLIP, SLIDINGWINDOW,
MINLEN as instructed in class (Oct 7th)
Execute fastqc ONLY on trimmomatic output files for adema_class_S4 R1 001.fastq (sub-sampled) (R1
paired) and adema_class_S4 R1 001.fastq (sub-sampled) (R2 paired)
b) Using data from this second, post trimmomatic, fastQC analysis complete this table (4 x0.5 pt):
fastqc total sequences, fastqc %GC
adema_class_S4 R1 001.fastq (sub-sampled) (R1 paired)
adema_class_S4 R2 001.fastq (sub-sampled) (R2 paired)
c) YES or NO Did trimmomatic improve quality of your Illumina data (1 point)?
10