* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download More Than An EyeWitness
Sociocultural evolution wikipedia , lookup
Objections to evolution wikipedia , lookup
Unilineal evolution wikipedia , lookup
Punctuated equilibrium wikipedia , lookup
Creation and evolution in public education wikipedia , lookup
Molecular paleontology wikipedia , lookup
Acceptance of evolution by religious groups wikipedia , lookup
Genetics and the Origin of Species wikipedia , lookup
Hologenome theory of evolution wikipedia , lookup
Evolving digital ecological networks wikipedia , lookup
Catholic Church and evolution wikipedia , lookup
The eclipse of Darwinism wikipedia , lookup
Transitional fossil wikipedia , lookup
Evidence of common descent wikipedia , lookup
Theistic evolution wikipedia , lookup
More Than An EyeWitness Evidence for Evolution 1 Sources of Evidence From studies of embryology Biochemistry From observation From the fossil record From studies of From studies of DNA anatomy 2 From Geographic Distribution Fossil Structure 3 3 Archeopteryx • Archeopteryx shows evidence of the evolution of birds from reptiles….there is evidence of feathers, a characteristic of birds, and claws, a characteristic of reptiles. 4 5 5 is called…. D C E A B F G 6 6 Homologous Structures • These organisms have body parts with anatomical similarities but functional differences which suggests their evolution from a common ancestor but the organisms have adapted to different environments. These homologous parts – similar in structure but not necessarily function - are evidence of evolution from a common ancestor; this can be seen in the fossil record. 7 Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings 7 Anatomical studies show... • What are other organisms that have the ability to fly but have wings very different than those of the bird? • Structures like the wings of birds and insects are called….. 8 Analogous structures • Butterflies or insects have wings but they are very different from the birds. These organisms do not have a recent common ancestor but have evolved to have similar adaptations for a similar environment. They show analogous structures: parts similar in function but not anatomical structure. So again evolution explains the similarities. 9 Copyright © The McGraw Hill Companies. Permission required for reproduction or display 9 Do these organisms, a bird, mammals and a fish, show analogous structures or homologous structures? • Convergent evolution as seen in the penguin, sea lion, shark and whale, results in analogous structures. If you were to look at the bone structure of the front fin/wing, you would find very different bone structures. These organisms have adapted to similar environments. 10 Do these organisms show analogous or homologous structures? Many different species evolving from a recent common ancestor would be an example of divergent evolution/adaptive radiation, with the organisms showing homologous structures. Over 70 lemur species evolved from a species that colonized Madagascar less than 60 million years ago. 11 Why would this “bird” have wings if it doesn’t fly? • Structures that are so reduced in size that they are vestiges or traces of homologous organs in other species are called vestigial structures. 12 Anatomical studies show • Vestigial parts – why does a whale have a pelvis and femur bones if it has no hind limbs? • Vestigial parts – why does a rubber boa have a remnant hind limb (spur)? 13 Vestigial structures • Why does this salamander have eyes if it never sees the light of day? Mexican Tetra fish (Astyanax mexicanus) 14 Vestigial structures Human vestigial structures Ear muscles Wisdom teeth Appendix 15 15 Why do these structures occur? • These structures may be homologous to ones that had a function in the ancestors of these organisms thus suggesting their evolution from this common ancestor. 16 Embryology Studies • Even though it may not be apparent during the first stage of development, these five organisms are very different at later stages of embryonic development and at birth. (1) Why do they look so similar during early development? (2) What do you think each organism is? A B C D Copyright © The McGraw Hill Companies. Permission required for reproduction or display E 17 Embryology Studies • The organisms are: – – – – – Fish Salamander Chicken Rabbit Human 18 Organisms having more similarities during later stages of development are thought to have a more recent common ancestor. Once again this demonstrates evidence that evolution has occurred. 19 Studies of Biochemistry Species Sequence of amino acids in the same part of the hemoglobin protein for four different species Human V-H-T-A-T-A-A-S-D-L-A-T-D-K-R-C-H-E-Y-A Chimp V-H-T-A-T-A-A-S-D-L-A-T-D-K-R-C-H-E-Y-A Gorilla V-H-T-A-T-A-A-S-D-L-A-T-D-K-K-C-H-E-Y-A Horse V-Q-S-A-L-A-S-G-E-V-H-A-D-K-R-V-R-D-Y-A 20 Conclusion? Humans and chimpanzees have no differences in this amino acid sequence suggesting their close evolutionary relationship; they have a more recent common ancestor than any other two species shown. 21 Which organisms appear to be more closely related to each other? Species Percent of Amino Acids That Are Identical to the Amino Acids in a Human Hemoglobin Polypeptide 100% Human Rhesus monkey 95% Mouse 87% Chicken 69% Frog Lamprey 54% 14% 22 DNA • The sequence of the nucleotides making up the DNA (DNA makes up genes) would also be similar because DNA determines the sequence of amino acids in proteins. 23 Species DNA sequence from a gene in the immune system that recognizes diseases invading the body Human TTTCTTGGAGTACTCTACGTCTGAGTGTCATTTCTTC Chimp TTTCTTGGAGCAGGCTAAGTCTGAGTGTCATTTCTTC Goat TTTCCTGAGGTATTGTAAGAGAGAGTGTCATTTCTCC Deer TTTCTTGGAGTATCATAAGAGCGAGTGTCATTTCTTC Duck CTTCCATGAGATGCTGGCGTTTGAGTGTCACTACCTC Chicken CTTCCAGTGGACTTTTAAAGCAGAGTGCCACTACCTG The underlined parts are those that are identical to the human sequence. 24 DNA sequences are used to make “family trees” so that we can see how closely related different species are. Goat Deer Human Chimpanzee Duck Chicken 25 What’s this diagram showing you? What could be a possible explanation for this? 26 Penicillin Patch Penicillin patches were placed in a bacteria culture that had only Streptococcus pneumoniae (Bacteria strain that causes Pneumonia). One patch showed growth of bacterial colonies while another one did not. What happened? Bacteria Colony Grows 27 27 Present EVIDENCE FROM GEOGRAPHIC DISTRIBUTION How could marsupials have gotten from their place of origin to locations half a world away? (The distribution of living things on the globe provides information about the past histories of both living things and the surface of the Earth ) Past 28 Summary of Evidence for Evolution From studies of embryology Biochemistry From observation From the fossil record From studies of From studies of DNA anatomy 29 From Geographic Distribution Has and Does Evolution Occur? • Scientists do not dispute that evolution does occur. Evolution is a FACT. • How evolution occurs is not completely understood. • Charles Darwin explained how evolution occurred through natural selection. Natural selection is a well documented THEORY uniting all of biology. • Modern evolutionary theory uses ideas of genetics, particularly mutations, to help explain how evolution may occur. (Darwin didn’t know about mutations.) 30 30