Download EOC Review Packet

EOC Review Packet
Name:
I.
Scientific Investigation
A. Steps to the Scientific Method
1. State the Problem – using observations
2. Form a Hypothesis – research using many different sources for current findings
a. Scientific Journals are the best place to locate current findings on the newest technologies
b. Encyclopedias are a good place to find information on extinct species or historical theories
c. State/Local agencies can help research the effects of pesticides on the squirrel population
3. Experiment – testing the hypothesis
a. Independent Variable – graphed on the X-axis – “What I change”
b. Dependent Variable – graphed on the Y axis – “What I measure”
c. Constant – things kept the same across all groups
d. Control – baseline measurement or standard to which other groups are compared
4. Collect / Measure Data
a. Quantitative Data – generally numbers, talking about quantity
b. Qualitative Data – generally words – descriptions of quality of things
5. Interpret Data – using tables and graphs, bar graphs compare qualitative information
6. Draw Conclusions – including improvements for future experiments
II.
Characteristics of Living Things
A. The Characteristics of Life – all living things are made of cells
1. Synthesis – the ability to make complex substances from simple subunits
2. Transport – moving materials around inside the cell or body
3. Excretion – removal of waste from the body
4. Respiration – turning food into usable energy
5. Nutrition – getting food – autotrophs make their own, heterotrophs eat other things
6. Growth – increase in size and number of cells
7. Regulation – respond to environmental changes with ability to maintain constant internal environment in its
optimal range
8. Reproduction – either sexual or asexual
B. Levels of Organization – place the following biological terms in order from smallest to largest
(Biosphere, cell, community, ecosystem, organ, organism, organ system, populations, species, tissue)
(cell, tissue, organ, organ system, organism, species, population, community, ecosystem, biosphere)
C. Carbon Cycle
1. Autotrophs use organelles called chloroplasts in
their leaves to collect solar energy
2. Photosynthesis occurs so plants can make glucose
to use for energy
3. Photosynthesis converts solar energy into chemical
energy
4. Photosynthesis uses CO2 H2O and solar energy to
form glucose and O2
5. Animals can not make their own food and must eat
from other trophic levels and are called
heterotrophs or consumers
6. Animals use organelles called mitochondria to
perform a process called Cellular Respiration which
breaks down food molecules to produce ATP for
energy. So do plants!
7. Respiration uses O2 and glucose (C6H12O6 ) to
produce CO2 and H2O
8. The gas made by respiration is CO2 ; the gas taken
in by photosynthesis is CO2
9. The gas taken in by respiration is O2; the gas
produced by photosynthesis is O2
10. Equation for Photosynthesis CO2 + H2O + Sunlight  C6H12O6 + O2
11. Equation for Respiration - C6H12O6 + O2  CO2 + H2O + ATP
D. Nitrogen Cycle (not currently tested, but just in case)
1. Nitrogen is the most abundant element in our planet’s
atmosphere.
2. Approximately 78% of the atmosphere is comprised of
this important element.
3. Nitrogen is used by life forms to carry out many of the
functions of life.
4. This element is especially important to plant life.
5. Yet nitrogen in its gaseous form is almost entirely
unusable to life forms.
6. It must first be converted or ‘fixed’ into a more usable
form. The process of converting nitrogen is called fixation.
7. There are specialized bacteria whose function it is to fix
nitrogen, converting it, so that it can be used by plants.
There are still other bacteria who do the reverse. That is,
they return nitrogen to is gaseous form.
8. After nitrogen is fixed, it can be absorbed, and used by plants, and subsequently by animals.
9. The process of nitrogen being fixed, used by plants and animals, and later returned to the atmosphere is
referred to as the nitrogen cycle.
10. Any question about a cycle that asks about lightning, volcanoes or bacteria is asking about the nitrogen cycle
E. Water Cycle
1. Water falls to the ground in the form of Precipitation
2. It percolates through the soil to make ground water
3. Water that doesn’t go into the ground is called run off
4. Water is taken into plants through the roots by
capillary action
5. Transpiration is the process of releasing water vapor
into the atmosphere from plant leaves
6. Evaporation puts water from oceans and lakes into
the atmosphere
7. Water in the atmosphere forms droplets in clouds by
condensation
8. In hot places there is probably more evaporation than
condensation
9. Places with much ground water probably have much
precipitation
III.
Life at the Molecular Level
A. Inorganic Compounds ( no C-H)
1. Water (words to know: hydrogen bonds, acids, bases, pH, capillary action,
water, polar, cohesion, adhesion, solvent, bases, resistant to temperature
change, surface tension)
2. pH Scale – indicates amount of Acid(H+)/ Base (OH-)
B. Organic Compounds or Macromolecules: there are 4 macromolecules
Organic molecules have C-H bonds
1. Carbohydrates (terms: starch, cellulose, monosaccharides, dehydration synthesis,
glucose, disaccharide, hydrolysis, polysaccharide, lactose, maltose, fructose)
a. Carbohydrates are built to store energy in plants and are broken down to be
used as cellular energy to accomplish the characteristics of life.
b. Monosaccharides – monomers (building blocks) of carbohydrate,
an example of a simple sugar is glucose
glucose
c. 2 simple sugars make a disaccharide, examples are sucrose and lactose
d. a polysaccharide is a carbohydrate made of many sugars
e. a polysaccharide found in plant cell walls is cellulose
f. a polysaccharide used to store energy in plants is starch
g. a polysaccharide used to store energy in animals is glycogen
h. sugars are put together using a process called dehydration synthesis
2. Lipids
a. Lipids are macromolecules that are insoluble in water, including fats, oils
and wax
b. A monomer of a lipid is a triglyceride which is made of three fatty acids
and one glycerol
c. Lipids are used to store energy in animals
d. Plants have a waxy coating on their leaves called a cuticle which keeps
from losing too much moisture or from becoming waterlogged
3. Proteins
a. Proteins are made up of amino acids joined together by peptide bonds
b. Two amino acids joined is called a dipeptide
c. Three or more amino acids joined is called a polypeptide
d. Another name for a protein is a polypeptide
e. Enzymes are a special group of proteins that speed up reactions
4. Nucleic Acids
a. The two types of nucleic acids are DNA and RNA
b. The monomer of a nucleic acid is a nucleotide which is made of a sugar, a phosphate and a base
c. DNA is common to all living things and it stores genetic information
d. In DNA adenine bonds with thymine and cytosine bonds with guanine
e. Purines = adenine and guanine
f. Pyrimidines = thymine and cytosine
g. The shape of a DNA is molecule is a double helix, discovered by Watson and
Crick
h. Replication is a process that makes and exact copy of DNA
i. The sugar in DNA is deoxyribose. The sugar in RNA is ribose.
j. In DNA adenine bonds with thymine, but in RNA it bonds with uracil
k. RNA is single stranded and DNA is double stranded
l. DNA is copied by RNA which becomes the recipe for making proteins
m. Genetic engineering is inserting foreign DNA into host DNA to make recombinant
DNA to make insulin, interferon and human growth hormone.
IV.
Life at the Cellular Level
A. Cell Theory
1. All living things are made of cells
2. Cells are the basic unit of structure and function of living things
3. All cells come from pre-existing cells
B. Development of Cell Theory
1. Leewenhoek – first to observe bacteria and protists under a microscope
2. Hooke – observed cork and named the cell
3. Schleiden – all plants are made of cells
4. Schwann – all animals are made of cells
5. Spontaneous generation – the idea that living things come from non-living matter
6. Redi – meat/maggot experiment to disprove spontaneous generation
7. Pasteur – meat broth experiment to disprove spontaneous generation
8. Virchow – all cells come from pre-existing cells
C. Types of Cells
1. Eukaryotes – have a nucleus and membrane-bound organelles
2. Prokaryotes – only include bacteria (Kingdom Monera)
Prokaryote –
no nucleus
3. Prokaryotes – do not have organized structures within the cell except ribosome’s
4. Eukaryotes – includes organisms in the kingdoms protista, fungi, plant and animal
5. Both – have DNA (hint: all kingdoms of organisms have this in common)
6. Eukaryotes – go through mitosis
7. Prokaryotes – go through binary fission
8. Both have ribosome’s to synthesize proteins
D. Cellular Organelles
Eukaryotic cell – has nucleus
1. Nucleus – command center of the cell; DNA in the form of chromatin/
chromosomes here
2. Nucleolus – small organelle in the nucleus that makes ribosomes
3. Ribosomes – small spheres made of rRNA in the cytoplasm that make
proteins
4. Endoplasmic reticulum – transport system of the cell
5. Golgi body / golgi apparatus – collects, packages and distributes
proteins
6. Lysosomes – contain digestive enzymes to break down old cell parts
7. Vacuole – storage tank of the cell
8. Mitochondria – organelle that conducts cellular respiration (glucose 
ATP)
9. Chloroplast – organelle that conducts photosynthesis
10. Centriole – assists in cell division in animal cells only
11. Cytoplasm - the jelly like substance in which organelles float inside a
cell
12. Cell wall – made of cellulose (plants), chitin (fungi) or peptidoglycan (bacteria) – outer boundary of some cells
provides support and structure
13. Cell membrane – the outer layer or boundary of animal cells – phospholipid bilayer
14. Mitochondria – muscle cells would have a lot of these because they need lots of ATP
15. ribosomes – cells that make a lot of protein would need these
E. Differences between Animal and Plant Cells
Differences
Plants
shape b/c of cell wall
Square, rectangle, regular
Organelles present
Chloroplasts, cell wall
Nucleus location b/c of vacuole
Against the cell wall
Animals
Round, irregular
centrioles
Middle or anywhere
F. The Fluid Mosaic Model and Movement through the Cell Membrane
1.
2.
3.
4.
The cell membrane is composed of phospholipids, proteins and carbohydrates
The Fluid Mosaic Model describes the Cell Membrane.
Passive transport is also called diffusion and it does not require energy
Passive transport moves molecules from areas of High concentration to low concentration
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
V.
Facilitated Diffusion – diffusion where carrier proteins help molecules across the cell membrane
Osmosis is a type of diffusion involving the movement of water across a semi-permeable membrane
A nonspecific type of movement that requires energy is called Active transport.
The movement that requires energy moves molecules from low to high concentrations
Membrane folding is a type of active transport that requires energy.
Membrane folding that involves taking in solid particles is called phagocytosis or endocytosis.
Membrane folding that engulf small amounts of liquids is called pinocytosis.
Membrane folding that removes particles from the cell is called exocytosis.
Our cells are made of 95% water therefore 95% of our body is made of water.
Molecules are transported across the cell membrane by carrier proteins.
Cell Division
A. Mitosis
1. A chromosome is made of two identical parts called sister chromatids
2. The parts of a chromosome are held together by a centromere
3. Each Chromosome has a short arm
4. Each chromosome has a long arm
5. Only animal cells have centrioles to help with chromosome movement
6. During anaphase sister chromatids are separated at the centromere and are pulled to opposite ends of the
cell.
7. DNA is replicated during Interphase so each cell will have the
same information
8. Chromosomes line up along the equator of the cell in
Metaphase
9. Loose or uncoiled chromosomes are actually DNA in the form
of Chromatin.
10. During Anaphase spindle fibers shorten which pulls the
chromosomes to the poles
11. After the nucleus divides, cytokinesis occurs which is division of
the cytoplasm
12. In plant cells only, a cell plate forms during telophase.
13. In animal cells only, a cleavage furrow forms during telophase.
14. Spindle Fibers are attached to chromosomes at the
centromere.
15. Prophase – Chromatin condenses and becomes visible
chromosomes,
16. Telophase – Nuclear membrane begins to form around each
set of chromosomes
17. Prophase - nuclear membrane begins to disappear
18. Telophase – two daughter cells are formed
B. Other Types of Division and Asexual Reproduction in Organisms
1. Vegetative Propagation – growing new roots for a plant from plant
clippings
2. Regeneration – repairing severed appendage (starfish or lizard tail)
3. Binary Fission – only occurs in prokaryotes
1
2
3
4. Sporulation – new mold growing where spores have fallen, also occurs in
certain plants like ferns
5. Budding – occurs in yeast and hydra when a tiny bud sprouts from a parent and eventually breaks off to form
a new independent organism
6. Mitosis – occurs in single celled eukaryotes like paramecium, splitting the nucleus
C. Meiosis
1. Meiosis is a type of cell division that make sex gells or gametes
2. The two types of sex cells are eggs and sperm.
3. Mitosis consists of 1 division while meiosis consists of 2 divisions
4. Binary Fission – only occurs in prokaryotes
5. Budding – occurs in yeast and hydra when a tiny bud sprouts from a parent
6. For every chromosome your mother gave you there is a matching chromosome your
father gave you with information regarding the same trait. We call these homologous
chromosomes
4
7. When a cell has a full complement of homologs, or homologous chromosomes, from each parent the cell is
said to be Diploid.
8. Sex Cells have only ONE set of chromosomes, they are called Haploid.
9. Homologous chromosomes exchange information during crossing over in
prophase I of meiosis I which adds to genetic diversity.
D. Cell growth
1. After a new cell is formed it must get bigger or grow.
2. The three things that affect a cell’s size are diffusion, DNA and Surface
Area to volume ratio.
3. Cells get bigger by making organic compounds like proteins.
4. The process of protein synthesis has two steps – transcription and
translation.
5. During Transcription the genetic code for building a protein is copied from
DNA to mRNA.
6. Because DNA can’t leave the nucleus the message is carried out of the
nucleus by mRNA.
7. Once the message from DNA is copied, the mRNA leaves the nucleus and
travels to the ribosome in the cytoplasm.
8. A sequence of 3 bases on mRNA is called a codon, but 3 bases on tRNA is called an anti-codon.
9. Each codon is matched to an anticodon to allow the tRNA to add its protein to the growing chain of amino
acids that is becoming the protein.
10. Each amino acid is linked together by peptide bonds to form proteins.
11. Another name for protein synthesis is translation.
12. The sequence of nortogenous bases on DNA carry the genetic code.
E. Transcription and Translation – use a codon chart to transcribe the following DNA sequence:
1. For the DNA sequence TACGGCCATTTCGATTTGAGCATC
2. The mRNA sequence:
3. AUG | CCG | GUA | AAG | CUA | AAC | UCG | UAG
4. Amino acids (from chart)
5. Met – Pro – Val – Lys – Leu – Asp – Ser – STOP
6. This protein is made of 6 amino acids
F. DNA Technology
1. DNA fingerprinting is used to identify crime suspects (such as
murder and rape)
2. Using electrophoresis, scientists can determine an individuals
DNA fingerprint. No two people have the same DNA fingerprint
except for identical twins.
3. Human Genome Project is considered a collaborative effort because 13 countries worked on it
4. The objective of the Human Genome project was to sequence all the DNA of a person
5. Scientists wanted to have the sequence so they can use it to determine the sequence of bases to find the
genes responsible for certain diseases.
VI.
Genetics
A. Vocabulary
1. Heredity – the passing of characteristics from parents to offspring
2. Genetics – the study of heredity
3. Mendel – Gregor Mendel is the Father of modern genetics. He studied pea
plants.
4. Genome – all of the genes of a particular organism
5. Trait – an inherited physical characteristic
6. Gene – a section of DNA that codes for a trait – located on chromosomes
7. Allele – versions of a gene (ex: tall/short, green/yellow)
8. Genotype – the type of genes or alleles present in an organisms genome
9. Phenotype – an organism’s physical appearance
10. Homozygous – two alleles of the same form make up the genotype, Pure-bred
(TT or tt)
11. Heterozygous – two different alleles, hybrid (Tt)
12. Dominant – form of gene that always shows, even if the other copy is recessive
13. Recessive – form of a gene ONLY expresses in a homozygous state (must have 2/2 (both) alleles to see it)
B. Mendelian Genetics
1. Punnett square – table used to diagram the probability of certain genotypes in
offspring
2. A monohybrid cross only examines ONE trait
3. A dihybrid cross looks at TWO traits at a time
4. The first generation of the cross is the P or Parental Generation.
5. The offspring of the P generation is the F1 (first Filial or first kid) generation
6. The offspring of the F1 generation is the F2 generation (second filial)
7. The Law of Independent Assortment states that each gene is inherited deparately
from others if they are on different chromosomes.
8. The Law of Segregation states that the 2 alleles for each gene deparate as gametes form
9. Incomplete Dominance is blending of traits, ex: red flowers + white flowers = pink flowers
10. Codominance – both alleles show equally, as in blood type (AB)
11. Sex-Linked Traits – controlled by genes on sex chromosomes, ex: colorblindness, hemophilia
12. A dihybrid cross of two heterozygotes produces offspring with a 9:3:3:1 phenotype ratio
13. A monohybrid cross of two heterozygotes produces offspring with a phenotypic ratio of 3:1 but a genotypic
ratio of 1:2:1
C. Mutations
1. Gene Mutations
a. A gene mutation is a change in one or more of the nucleotide bases of DNA
b. Mutations are caused by mutagens like UV light or chemicals
c. A point mutation is when 1 nucleotide base in DNA is changed.
d. A frameshift mutation occurs if 1 or more nucleotides in DNA are added or deleted; this causes the
codon sequence to be shifted
~ If the original DNA is ATA ACG CCT ATT
~ The number of complete codons is 4
~ then the mRNA sequence is UAU UGC GGA UAA
~ The amino acid sequence would be Tyr, Cys, Gly, STOP
~If the original DNA were replicated and the “G” was deleted
~Then the DNA sequence would be ATAACGCCTATT
~The number of complete codons would be 3
~The mRNA sequence is UAU UGG GAU AA
~ The amino acid sequence would be Tyr, Try, Asp
~if the original DNA sequence is replicated and a C was added at the beginning
~Then the DNA sequence would be CATAACGCCTATT
~The number of codons would be 4
~ The mRNA sequence would be GUA UUG CGG AUA A
~ The amino acid sequence would be Val, Leu, Arg, Iso
2. Chromosomal Mutations
a. A chromosomal mutation occurs if there is a change in the number or structure of a single
chromosome or whole sets of chromosomes
b. Nondisjunction – occurs when chromosomes don’t separate during meiosis
c. Translocation – chromosome pieces are moved onto another chromosome
d. Inversion – a segment of chromosome is inserted in reverse order
e. Duplication – a segment of a chromosome is repeated
f. Polyploidy – whole extra sets of chromosomes in the same cell
g. In plants and animals sex cells are haploid which means they have half
the number of chromosomes a body cell had
h. Diploid – a cell with 2 sets of chromosomes (one from mom and one
from dad)
i. Haploid – a cell with 1 set of chromosomes (one from mom or one
from dad)
D. Genetic Disorders
1. Only a karyotype detects a chromosomal mutation caused by nondisjunction
2. Down syndrome is trisomy on the 21st chromosome pair caused by
nondisjunction
Karyotype of Kleinfelter
3. Trisomy occurs when there is an extra copy of a chromosome in a diploid cell
Syndrome – Trisomy
4. Turner syndrome is monosomy on the 23rd pair caused by nondisjunction
XXY
(22 pairs and XO instead of XX)
VII.
Taxonomy – the naming and organization of organisms developed by Carolus Linnaeus based on structural
similarities
A. Classification
Fungi
Classification Level
Kingdom
Phylum
Class
Order
Family
Genus
Species
Catch Phrase to remember
King
Philip
Came
Over
For
Good
Spaghetti
B. Naming Organisms
1. Binomial Nomenclature, or “2 name naming system” was developed by Linnaeus
2. AN organism’s scientific name is made of its Genus and then its species
3. If 2 organisms are in the same genus, they must be in the same family.
4. The class of mammals includes such organisms such as rabbits and elephants which are in the same
Phylum but different species.
5. Only organisms that can interbreed and produce fertile offspring are in the same species.
C. Kingdoms
Kingdom
Archaebacteria
Eubacteria (Monera –
Cell type
Prokaryote
Cell outer
boundary
Wall
(peptidoglycan)
Number of
cells
Unicellular
Type of
reproduction
Binary fission
original kingdom when both kinds
of bacteria were grouped together)
Protista
Eukaryote
Membrane
Both,
usually uni
Mitosis
Fungi
Eukaryote
Wall made of
chitin
Multicellular
(yeast = uni)
Plantae
Eukaryote
Multi
Animalia
Eukaryote
Cell wall made
of cellulose
Membrane
Sporulation
(yeast=
budding)
Sexual &
asexual
Sexual &
asexual
Multicellular
Getting
energy
Autotroph
Chemotroph
heterotroph
Autotroph
Heterotroph
Heterotroph
autotroph
Heterotroph
2 examples
E. Coli
M.tuberculosis
Amoeba
Paramecium,
Algae
Mold, mildew,
mushrooms,
yeast
Fern, moss,
dogwood
Sponge,
jellyfish, squid,
rabbit, human
D. Kingdom Specimens
1. The first and least complex kingdom which includes thousands of types
of bacteria is Archaebacteria and Eubacteria (formerly Monera)
2. The kingdoms of bacteria consist of unicellular organisms that don’t
have nuclei.
3. The next kingdom to evolve was protista which consists of mostly single
celled organisms
4. Most Protists are unicellular except for plant-like varieties like seaweed.
5. Fungi are heterotrophic, multicellular and are mostly decomposers who
get their nutrients from dead or decaying organisms
6. Fungi are different than plants because fungi have cell walls of chitin
7. The plant kingdom includes multicellular autotrophs with cell walls of
cellulose.
8. Kingdom Animalia consists of multicellular heterotrophs with no cell walls.
9. Insects in the animal kingdom are in the Phylum Arthropoda, and called
arthropods (jointed appendages) because their legs are segmented
10. Fleas are multicellular heterotrophs with segmented legs, thus they are in the
Kingdom Animalia, Phylum Arthropoda.
11. The highest level of organization for Porifera is tissue. It’s in the animal kingdom
Porifera
E. Viruses – agents of disease
1. Viruses are considered non-living because they can not perform the
characteristics of life without a host cell
2. Viruses are made of only 2 organic compounds – Nucleic Acid (DNA or RNA)
and a Capsid made of protein
3. The lysogenic cycle is a process by which a virus infects a cell which eventually bursts
releasing newly assembled viruses.
4. A virus infects a cell by injecting its DNA or RNA into a cell.
5. The cold and flu are caused by viruses.
6. Antibiotics are typically used to fight bacterial infections. The word antibiotic literally
means “against life.” Because viruses are considered non-living antibiotics don’t work
against viruses.
7. Vaccines are used to help organisms make antibodies against pathogens like viruses.
8. Vaccines are made from killed or weakened virus.
9. Vaccines stimulate Active Immunity (B cells to plasma cells to make antibodies)
F. Sexual Reproduction in Plants
Alternation of Generations –
plants have a life cycle that
alternates between diploid and
haploid.
VIII.
Evolution and Natural Selection
A. Evolution
1. gradual change in characteristics over time
2. responsible for diversity among organisms that exist.
B. Types of evolution
1. Divergent- related organisms become more distant
2. Convergent-distantly related organisms develop similar
characteristics
C. Lamarck's theory disproved for lack of evidence
1. use and disuse of organs- if you don't use it, you lose it
2. inheritance of acquired traits- attained traits passed on
ex. blacksmith passing on muscles to offspring
3. ultimately, Lamarck’s theories not accepted due to
lack of supporting data
ex. giraffes developed long necks because grass
became scarce, their necks had to stretch to reach
leaves in upper canopies of trees
D. Darwin's theory
1. sailed on Beagle as the ship's naturalist; visited the Galapagos
Island
2. "The Origin of Species"- book that supported evidence that
living things evolved from other living things
3. his theories, though modified, still form the basis of modern
evolutionary theory
a. variation exists within a species
b. all organisms compete for limited space
c. organisms produce more offspring than can survive
d. natural selection- organisms best suited to environment
survive
E. Rate of Evolution
1. gradualism- organisms evolve as a result of small adaptive changes
2. punctuated equilibrium- short periods of rapid change in a species are separated by long periods of
little or no change.
II. Evidence of Evolution
A. Fossils Record- shows organisms get increasingly complex over
time
1. Types of fossils fossil= trace of once living organism
a. preserved tissue- amber, ice, tar- keeps it from
deteriorating
b. preserved trace- imprint, mold, cast(mold filled w/
minerals)
2. Determining fossil age: relative dating (a,b) & radiometric
dating (c)
a. earliest(oldest)- lower layers of rock
Homologous structures =
b. most recent(newest)- upper layers of rock
c. absolute dating uses half-life- amount of time it takes
common ancestor
for 1/2 of radioactive element to decay (carbon-14,
chlorine 36, uranium 235)
3. Geologic Time Scale- record of Earth's history based on fossils
a. Earth formed 4.6 billion years ago, 1st life 3.5 billion years ago
b. Precambrian, Paleozoic, Mesozoic, Cenozoic (us)
B. Evidence from Living Organisms (Do similar functions reflect
Analogous structures = no
similar structures?no)
1. Anatomy- study of external and internal structures of
common ancestor
organisms
a. homologous structures- body parts of different
Common environment!
organisms that have the same basic structure. ex.
human arm, bird wing, whale fin, bat wing have the
same number and arrangement of bones
b. analogous structures- body parts of different
organisms that have same function, but different
structure ex. bird's wing and butterfly's wing
c. vestigial structures- body parts with no apparent
function ex. human appendix, tiny hip bones in some
snakes
2. Embryology- study of early growth stages and
development of embryos
a. embryos of different organisms look very
similar=similar genes @ work
b. DNA sequences which control early development
remain unchanged because of little or no mutations.
3. Biochemistry- study of molecules that make up an
organism
a. all organisms use DNA or RNA to carry
information
b. the more similar the chemical, the more closely related ex. cytochrome C used in respiration
and is found in all organisms carrying on aerobic respiration, also hemoglobin
III. Evolution and Genetics
A. Population- group of organisms that live in same
area and interbreed.
B. Gene Pool- all the genes in a population, collection of
all genes for all traits
C. Evolution can only occur when there is a change in
the kinds or % of genes in the gene pool of a population.
D. Genetic Equilibrium- frequency of alleles in a
population doesn't change from generation to
generation. NOT EVOLVING= cheetah, horseshoe crab
E. Natural Selection- only organisms well adapted to the environment survive and reproduce; "survival of the
fittest"
F. Mutation- caused by a change in structure of genes or chromosomes
1. may be lethal, beneficial, or neutral
2. adds new genes to the pool
3. may remain in population for years w/o being expressed (recessive)
G. Migration- movement of individuals of a species in or out of a population
H. Genetic drift- chance events alter the allelic frequency, small populations.
ex. having more offspring than other members of its species, disaster
I. Isolation- geographic (mountains, oceans), reproductive (organisms. of same species cannot mate anymore
due to development of different mating times).
IV. Human Change Over Time- Primates- lemur, monkey, ape, human
A. variety of shapes & sizes, share common traits (opposable
thumb, flexible elbow, vision dominant sense, brain size related
to reorganization of cerebrum*thinking, memory, interpretation)
B. humans are unique- bipedal, largest brains of primates,
speech
C. order of ancestry-Australopithecus afarensis (Lucy), Homo
habilis (tool user), Homo erectus (upright man, probably our
ancestor), Homo sapiens (include Neanderthal, Cro-Magnon)
IX.
Ecology
A. the study of organisms and their interactions with the
environment
1. An organism is anything living.
2. Examples would be humans, animals, plants, bacteria
B. The biosphere
1. The biosphere is the living world
2. Includes any organism found in the air, land and water
C. The ecosystem
1. The ecosystem is a self supporting area composed of
living and nonliving things such as
the rain forest or desert
2. An ecosystem produces energy, transfers energy, decomposes and recycles
3. An ecosystem is made of two types of factors
a. abiotic factors- nonliving parts on the environment such as water, rocks, sun and
temperature
b. biotic factors- the living parts of the environment such as plants, bacteria and
animals
D. Community
1. A community is composed of all of the populations of different organisms living together
in a given area such as your lawn that contains grass, insects and worms
a. a population is a group of organism that belong to the same species that live in a
given area
b. such as a herd of cattle or a gaggle of
geese
E. Nutrition
1. Autotrophs
a. A group of organisms, known as
autotrophs , can use the energy in
sunlight and convert water and carbon
dioxide into glucose, or food.
b. Another term for autotrophs is
producers because they produce all of the
food that heterotrophs use. Without
autotrophs, there would be no life on this
planet.
c. Example of autotrophs are plants and
algae
2. Chemotrophs
a. Not all autotrophs receive their energy from the sun. Some autotrophs, deep done in the
oceans, NEVER see the sun, and use inorganic substances, such as salt, to get energy. These
autotrophs which do not need the sun are known as chemotrophs.
b. Example of chemotrophs are bacteria and deep sea worms
3. Heterotrophs
a. Organisms that do not make their own food are called heterotrophs.
b. Another term for heterotrophs is consumers because they consume other organisms to live.
c. Examples of heterotrophs are rabbits, deer or mushrooms- anything that doesn’t make their
food but has to eat or absorb it.
d. Consumers can be broken down into 5 main groups
1. scavengers- feed on the tissue of dead organisms
a. Examples of scavengers are vultures, crows, shrimp
2. herbivores- eat ONLY plants
a. Examples of herbivores are rabbits, deer
3. carnivores - eat ONLY meat
a. Examples of carnivores are lions, tigers, sharks
4. omnivores - eat both plants and animals
a. Examples of omnivores are bears, humans
5. decomposers- absorb any dead material and break it down into simple nutrients;
fertilizer
a. Examples of decomposers are bacteria , mushrooms
F. Transfer of Energy
1. When a zebra eats the grass, it does not obtain all of the energy the grass has- much of it is not
eaten. Likewise, when a lion eats a zebra, it does not get all of the energy from the zebra. Much of the
energy is lost as heat.
a. These two examples of energy transfer show that no organism EVER receives all of the
energy from the organism they just ate.
G. Trophic Levels
1. Energy moves from one organism to another when it is eaten.
2. Each step in the transfer of energy is known as a trophic level.
a. The main trophic levels are producer, consumer and decomposer
3. Food Chain
a. The energy flow from one trophic level to the other is known as a food chain. A food chain is
simple and direct. It involves only one organism at each
trophic level.
4. Food Web
a. Most organisms eat more than JUST one organism.
When more organisms are involved, it is known as a food
web. Food Webs are complex and involve LOTS of
organisms.
b. Notice the direction the arrow points- the arrow points
in the direction of the energy, NOT what ate what.
5. Biomass
a. The total mass of the organic matter at each trophic
level is called biomass. Biomass is just another term for
potential energy to be eaten and used.
b. The transfer of biomass from one level to the other is
VERY inefficient. ONLY 10% of the energy from one
trophic level is transferred to the next. This is the 10%
law.
6. Ecological Pyramid
a. An ecological pyramid shows the relationships between consumers & producers at different
trophic levels in an ecosystem. The pyramid shows which level has the most energy & most
number or organisms.
H. Population Ecology
1. Limiting Factors
a. A population’s size can depend on a number of factors. These factors that limit the size of a
population are called limiting factors. There are 7 limiting factors:
1. Predation: one organism consumes and eats another organism
ex. an example would be a fox hunting a rabbit
2. Parasitism: one organism lives off the body fluids/flesh of another organism
ex. an example would be a tick sucking the blood of a dog
3.Competition for food: two organisms eat the same food and compete for this food
ex. an example would be hyenas and lions fighting over a dead zebra body
4. Pollution: the environment is unclean and unusable to the organisms that live in it
ex. an example would be an oil spill occurs and sea birds can no longer use the
oily shores to build their nests
5. Availability of water: all organisms need water to survive
ex. an example would be a limited amount of water during a drought
6. Disease: a disease in a population where the individuals live in close proximity of
each other can kill the whole population
ex. An example would be an outbreak of the ebola virus in a small African
village
7. Climate: the weather & climate can limit the size of a population
ex. an example would be a hurricane kills a flock of birds living in a tree
2. Limiting factors can be categorized as two types:
a. density-dependent limiting factors: limit a population only when the population reaches a
certain density.
1. Examples are competition for food and predation
2. density-independent limiting factors: these affect a population in the same way
regardless of density.
ex. An example is: climate
I. Population Growth Curves
1. Exponential Growth
a. Exponential growth occurs when the rate of growth in each new generation is a multiple of
the previous generation.
ex. Bacteria exhibit exponential growth; they double with each
division and have rapid growth.
J. Exponential Growth Curve
K. Growth Rates
1. A population’s size changes over time. This change is known as a growth rate.
2. Growth rate depends on 4 factors:
a. births
b. deaths
c. immigrations: organisms enter a population
d. emigrations: organisms leave a population
L. S shaped curves and carrying capacity
1. The carrying capacity is the number of organisms that can be supported by
the environmental resources in an ecosystem.
2. A carrying capacity graph illustrates that the environment can only produce
so much
food and shelter for a population before the population reaches an equilibriumthe same
number of births each year equal the same number of deaths.
Carrying Capacity Graph
3. Another term for a carrying capacity graph is an S graph.
M. Predation Curve
1. A predation curve shows the relationship between a predator and its prey
and how one
can affect the other
a. An example is the the lynx (cat) and the
rabbit. When the rabbit population
decreases, the lynx population decreases.
N. Boom and Bust Curve
1. A boom and bust curve represents exponential
growth followed by a sudden collapse.
a. A boom and bust curve represents an
insect population’s cycle through the year.
They are abundant in the summer months but are limited in the fall and winter months.
O. Population Interactions
1. Two populations of organism can interact with each other 5 ways:
a. competition: organisms try to make use of the same resources
ex. An example is plants competing for water & sun light
b. Predation: one organism (predator) consumes & eats another organism (prey)
ex. An example would be a fox eating a rabbit or a lion eating a zebra
c. Parasitism: one organism (parasite) feeds on the tissue of another organism (host)
causing pain
ex. An example would be a tapeworm living off of the digested food inside a dog’s gut
d. Symbiosis: each organism fills a need for the other
ex. An example would be a remora fish eating parasites off of a shark’s skin
e. Commentalism: one organism reaps the benefits while the other is unharmed
ex. An example would be a barnacle & a whale- the barnacle attaches itself to the
whale’s skin for a home and the whale is unharmed
P. Succession
1. When an area is wiped out by a fire or is cleared down by humans, it kills all of the plant &
animal life.
a. When the demolished community tries to reestablish itself and begin to grow again, is is
known as primary succession.
1. Primary Succession is the first stage of regrowth- small shrubs and annual plants are
primary succession plants
b. The climax community is when the community has been reestablished- large plants and trees
are climax community plants.
X.
Human Body Systems
A. Digestive
The digestive system is responsible for both mechanical and chemical
digestion that break down food into molecules so that they can move into the cell
and be used for the living process. The mouth, teeth, and tongue begin the
chemical digestion by mechanically breaking down food through the chewing
process and the addition of saliva. The enzyme amylase breaks down
carbohydrates and starts the break down of starches. Food moves from the mouth
to the stomach by way of the esophagus. In the stomach, other digestive enzymes
and hydrochloric acid begin the breakdown of proteins. The stomach mixes and
churns the food.
Food, now in a liquid-like state called chyme, moves from the stomach into
the small intestine, where it is absorbed through the villi (walls of the intestine) into
the bloodstream where it is delivered and taken in by the cells of the body. The
majority of chemical digestion and absorption takes place in the small intestine.
Waste materials and unused food are carried back to the large intestine where they
mix with roughage and water. The undigested materials are excreted from the
body.
B. Circulatory
The circulatory system is composed of the heart, arteries, veins, red blood
cells, white blood cells, antibodies, thrombin, water, and plasma. A four
chambered heart, controlled by a pacemaker, rhythmically controls the pumping
action by alternating contractions of the atria and ventricles. Blood circulates in the
body in two loops - arteries carrying oxygenated blood from the heart to all parts
of the body, and veins returning deoxygenated blood to the heart and lungs to be
reoxygenated. Blood flows through the arteries due to the pumping pressure of the
heart. In the veins, blood flow back to the heart (against gravity) is helped by
skeletal muscles that squeeze the veins and push blood along and by one-way
valves located in the veins themselves.
An auxiliary portion is the lymphatic system, which drains excess tissue
fluids back into the circulatory system along with white blood cells that destroy
harmful organisms.
C. Skeletal System
The skeleton is the basic framework of the human body and is made of
connective tissue - bones and cartilage. Bone is living tissue with vitamins, collagen,
and minerals to give it strength and hardness. The process by which the bones
harden is called ossification. Bones are joined by cartilage at joints. Joints are
classified as to the amount of movements they allow: stationary (skull), hinge (jaw),
and ball and socket (hip).
D. Muscular System
Three human muscle types are skeletal, smooth, and cardiac. All muscle
tissue exerts force when it contracts; therefore muscles are responsible for all
movement of the body, voluntary and involuntary. Energy for all movement is
derived from an ample supply of mitochondria in the muscle cell. ATP, a high level
energy carrier, is produced by the mitochondria for use by other cells and tissue parts
during movement of exercise. Muscles are paired to accomplish full movement.
Each contracting muscle will be paired with an muscle that works against it and
tendons attach paired muscle groups to bones to complete the movement action.
The skeletal muscles make up this grouping of muscles and are mainly voluntary.
Smooth muscles are found in the linings of the body such as the digestive tract and
blood vessels. They are generally involuntary muscles.
Cardiac muscle is found only in the heart. The heart is the strongest muscle
of the body. It is responsible for keeping the blood flowing through the circulatory
system at a given pressure. The cardiac muscle is
an involuntary muscle.
E. Nervous System
The basic unit of the nervous system is the
neuron (nerve cell). Its structure allows
electrochemical signals to travel across synapses to
activate muscles, glands, or organ tissue. The
nervous system is divided into two parts. The first
part is the central nervous system, which includes
the brain and the spinal cord. The second part is
the peripheral nervous system, which is a large
network of nerves that totally connect all parts of the
body. Receptors located in sense organs (eyes,
ears, etc.) and in the skin send information along
sensory neurons to the spinal cord and then to the brain where the information is
chemically interpreted, causing a motor response.
F. Respiratory
System
Respiration involves actions started by nerves
stimulating muscles and bones to mechanically enlarge
the respiratory cavity of the body. The diaphragm
contracts and moved downward. The breathing rate is
controlled by nerves originating in the brain based on
carbon dioxide content. The human nasal passages are
adapted to clean, moisten, and warm the air before it
enters the lungs by way of the trachea and the bronchi.
The lungs are made up of many tiny air sacs called
alveoli that are found at the end of the bronchiole in
clusters. The exchange of gases between the lungs and
the blood vessels occurs in the alveoli.
G. Excretory System
The excretory system is made up of the kidney, bladder, connecting tubes, and
capillaries joined to the kidney. Urine is collected by structures in the kidney called nephrons.
From the nephrons, the liquid wastes are collected and stored in the bladder. Urine leaves the
body through the urethra.
H. Endocrine System
The endocrine system produces hormones which travel by way of the bloodstream to
specific target cells. Endocrine glands include the thyroid, adrenals, pancreas, parathyroid,
gonads, pituitary, and the hypothalamus. The manner in which the hormone acts on the target
cells depends on whether it is a protein or steroid. Each will cause a feedback, which is one way
to regulate hormones secreted into the body. Homeostasis depends on the actions of
the nervous and endocrine systems. Organs, like the kidney, function based on
endocrine stimulation.
I.
Integumentary System
The integumentary covering of the
body is called the skin. Skin consists of two
layers, the epidermis, and the dermis. Skin
protects the body, rids the body of mineral
salts and wastes, regulates body temperature,
and picks up environmental signals. The skin
is the bonding or holding agent that keeps the
body intact and functioning. Also part of the
integumentary system is the nails and hair.
J.
Reproductive System
The reproductive organs in males and
females are called gonads. Gonads produce sex cells called gametes.
Gametes are haploid - they have half the normal amount of chromosomes. When an egg and sperm unite, the resulting
fertilized egg, or zygote, has a full set of 46 chromosomes. In the male, the gonads produce sperm and male hormones.
In the female, the gonads produce the egg cells. Reproduction starts with the union of a sperm and an egg. Fertilization
occurs in the fallopian tube (the oviduct in human females). The combined cell, called a fertilized egg cell, develops
quickly into a ball of many cells that implants itself on the inner wall of the female uterus. Here it develops into a fetus,
the name given to the beginning stage of a human being. For nine months the fetus grows, it receives nourishment from
the mother’s circulatory system.