Download 2.01 Compare and contrast the structure and functions of organic

Goal Two: The learner will develop an understanding of the physical,
chemical, and cellular basis of life. Total Weight: 30%
2.01 Compare and contrast the structure and functions of organic molecules
1. What is an organic compound?
2. Complete the table regarding the four types of organic molecules:
Organic
Molecule
Atoms present
Building
Blocks
(Monomers)
Function:
Carbohydrates
(Examples)
Lipids:
(Examples)
Proteins:
(Examples)
Nucleic Acids:
(Examples)
3. Match the test with the organic molecule it is used for:
Lipids (Fats/Oils)
Carbohydrates (Starches)
Carbohydrates (Sugars)
Proteins
Iodine
Benedicts Solution
Biuret Reagent
Brown paper bag test
2.02 Investigate and describe the structure and function of cells
4. List the function and describe the structure of the following organelles:
a. Nucleus
b. Plasma membrane
c. cell wall
d. mitochondria
e. vacuoles
f. chloroplasts
g. ribosomes
5. Explain how a compound light microscope works.
6. Draw the way a lowercase letter “e” would look under a microscope.
7. How do you determine total magnification?
8. Explain how cells can influence each other. Give an example.
9. How are cells organized?
10. Compare and contrast plant and animal cells.
2.03 Investigate and analyze the cell as a living system.
11. What is homeostasis?
12. What is salinity?
13. How do cells maintain homeostasis, pH, temperature, and salinity?
14. Define:
a. active transport
b. passive transport
c. diffusion
d. osmosis
e. semipermeable membrane
15. Draw arrows to show which way water will move in and out of each of the
following situations:
16. What is the function of ATP?
17. Describe how cells store and use energy with ATP and ADP molecules.
2.04 Investigate and describe the structure and function of enzymes and explain
their importance in biological systems.
18. Define enzymes
19. How do temperature and pH affect enzymes?
20.Explain the induced fit theory
21. What is the reason for someone to have PKU?
2.05 Investigate and analyze the bioenergetic reactions:
22. Define:
a. aerobic respiration
b. anaerobic respiration
23. Write the formula for aerobic respiration.
24. What are the reactants and what are the products of aerobic respiration?
Reactants:
Products:
25. Write the formula for anaerobic respiration.
26. What are the reactants and what are the products of anaerobic respiration?
Reactants:
Products:
27. Compare and contrast alcoholic and lactic acid fermentation.
28. What factors affect the rate of cellular respiration.
29. Write the formula for photosynthesis
30. What are the reactants and what are the products of photosynthesis?
Reactants:
Products:
31. What factors affect the rate of photosynthesis?
32. What type of organisms undergo photosynthesis? Cellular respiration?
33. In what organelles do photosynthesis and cellular respiration occur?
Goal 3: Learner will develop an understanding of the continuity of life and the changes
of organisms over time. Total weight= 35%
3.01 Analyze the molecular basis of heredity
34. Describe the structure of the DNA molecule
35. Name the nitrogen bases found in DNA and what they bond to.
36. What type of bond forms between the nitrogen bases in DNA?
37. What is a mutation?
38. Describe the process of replication.
39. List 3 differences between DNA and RNA.
1.
2.
3.
40. Describe the process of transcription and where it happens.
41. Describe the process of translation and where it happens.
42. What is a codon?
43. List some advantages and disadvantages of overproduction, underproduction,
or production of proteins at the incorrect time.
44. What is cell differentiation?
45. Describe how cells respond to their environment.
46. What does DNA code for?
47. Amino acids linked by _____________ ____________ form polypeptides
which are folded into _______________.
48. Find the amino acid sequence for the following mRNA sequences.
a. AUGCCCCCGAGAAACAAGUUUUAG
b. AUGGUGGGUAGAGUCUAG
c. AUGUUUCCGACUAAUUAG
d. AUGUAACAACACAUCCAGCCACAUUAG
e. AUGCCCCCGGCAGCCGCGUAG
3.02 Compare and contrast the characteristics of asexual and sexual reproduction
49. Compare and contrast Mitosis and meiosis
50. Put the pictures of cells in various stages of mitosis in order and describe what
is occurring during each stage.
51. List sources of genetic variation.
3.03 Interpret and predict patterns of inheritance
52. Mr Jones has blood type A and Mrs. Jones has blood AB. What is the
probability that they will have a child with blood type A if both of Mr. Jone’s
parents were AB?
53. Colorblindness is a sex-linked recessive trait. A mother with normal color
vision and a color blind father have a color blind daughter. Which of the
following statements is correct?
a. all of their daughters will be colorblind
b. the mother is a carrier of the colorblindness gene.
c. all of their sons will have normal color vision
d. all of their sons will be color blind
54. What is a polygenic trait? Give an example.
55. Describe Gregor Mendel’s pea plant experiments.
56. Describe how phenotype can be the result of both genotype and the
environment. Give an example.
57. Define the following terms:
a. dominant
b. recessive
c. incomplete dominance
d. co-dominance
e. sex-linked traits
f. independent assortment
g. test cross
58. Give the characteristics of the following disorder and how they are inherited.
a. Sickle cell anemia
b. Cystic Fibrosis
c. Huntington’s disease
59. Who is more likely to express a sex-linked trait? Why?
3.04 Assess the impacts of genomics on individuals and society
60. How can DNA technology allow us to:
a. identify an individual?
b. identify a person’s parents?
c. investigate a crime scene?
61. What is gene therapy?
62. How can genetic technology allow us to create human insulin using bacteria?
63. What is the Human Genome Project? What are its benefits?
64. What is a transgenic organism and give an example?
65. What is cloning?
66. What are some ethical implications and dangers of biotechnology?
67. Ricketts is a condition in which the bones are abnormally soft which leads to
the rickets development of deformed bones. A lack of vitamin D, calcium,
and phosphorus in the diet usually causes this condition. One form, however,
called vitamin D-resistant rickets, is caused by a dominant allele on the X
chromosome. The pedigree below traces this condition in three generations
of a family.
Use the pedigree below to answer the following questions:
a. What is the genotype of individual I-1?
b. What is the probability that individual I-1 will pass the rickets gene to
her offspring?
c. What is the probability that individual I-2 will pass on the rickets gene?
d. Individual II-6 has rickets; however, none of his three sons have this
condition. How can genetics explain this situation?
e. What is the genotype of individual II-2?
f. Why is individual III-2 free of the disease even though his brother and
sister have rickets?
68. You are a police investigator trying to solve a murder case in your town. You
collect three blood samples from different locations at the crime scene.
Analysis of the three samples reveals that all are the same blood type.
However, you suspect that at least one of the blood samples belongs to the
murderer. You can use the technique of DNA fingerprinting, which involves
gel electrophoresis, to identify the criminal from the very small amount of
DNA found in the blood.
Based on your knowledge of genetics and your excellent detective’s
intuition, draw, your predication for how the suspect’s DNA will appear
after gel electrophoresis. Draw the alleged suspect’s DNA bands on the
electrophoresis diagram above. Explain your reasoning.
3.05 Examine the development of the theory of evolution by natural selection.
69. Contrast abiogenesis and biogenesis.
70. What did Louis Pasteur contribute to our understanding of the origins of life?
71. Explain the Heterotroph Hypothesis (Miller and Urey’s experiment).
72. What can we infer from the fossil record? Where do you find the
oldest/youngest fossils?
73. Define natural selection.
74. How are variation and natural selection related?
75. What is geographic isolation?
76. What is reproductive isolation?
77. What is reproductive isolation?
78. What are biochemical similarities between species? Give an example.
79. Describe Charles Darwin’s theory of natural selection.
80. Define the following and explain how they are related to natural selection:
a. pesticide resistance
b. antibiotic resistance
Goal 4: Learner will develop an understanding of the unity and diversity of life. Total
weight= 30%
4.01 Analyze the classification of organisms according to their evolutionary
relationships.
81. How does our modern classification system show the evolutionary
relationship among organisms?
82. How has a knowledge of evolutionary relationships affected our
understanding of:
a. DNA analysis
b. Biochemical analysis
c. Embryological development
83. Describe the history of the classification system and the currently accepted
classification system.
84. What does “membrane organelles” mean?
85. Explain the differences in size, chromosome structure, and organelles between
prokaryotes and eukaryotes.
86. Fill in the following chart.
Cellular
Structures
Unicellular vs.
Multicellular
Methods of
making/getting
food and
breaking down
food to get
energy
Reproduction
Protists
Fungi
Plants
Animals
87. Describe the importance of the essential life functions listed below:
a. Transport
b. Excretion
c. Regulatory (Nervous and Endocrine)
d. Respiration
e. Nutrition
f. Synthesis
g. Reproduction
h. Growth and development
4.03 Assess, describe, and explain adaptations affecting survival and reproductive
success.
88. Give an example of an organism’s feeding adaptation and how it has helped
that organism survive.
89.
What adaptations are necessary for:
a. life on land:
b. ensure successful reproduction
90. Describe the structure of a virus.
91. Describe the difference between a viral disease (such as influenza) and a
bacterial disease (such as strep throat) and how they are treated and
prevented.
92. Please complete the following chart.
Nonvascular Plants
Gymnosperms
Angiosperms
Transport
Reproduction
Seed type
Examples
4.04 Analyze and explain the interactive role of internal and external factors in
health and disease.
93. Describe how genetics and environment affect:
a. diabetes
b. sickle anemia and malaria
c. lung/mouth cancer
d. skin cancer
e. PKU
94. Describe the:
a. function of T cells
b. function of B cells
c. function of antibodies/antigens
d. difference between passive and active immunity
e. vaccines
95. Describe what causes:
a. malnutrition
b. lead poisoning
c. mercury poisoning
96. Define the following
a. chemotaxis (positive/negative)
b. phototaxis (positive/negative)
c. reflexes
d. imprinting
e. instincts
f. habituation
g. imprinting
h. classical conditioning
i. trial and error
j. estivation
k. migration
l. hibernation
97. Explain how certain animal behaviors such as courtship and other behaviors
may have evolved.
98. Describe the following social behaviors are accomplished and give an
example:
a. communication using pheromones
b. courtship behaviors
c. territorial defense
Goal 5: Learner will develop an understanding of the ecological relationships
among organisms.
5.01 Investigate and analyze the interrelationships among organisms, populations,
communities and ecoystems.
99. What abiotic factors determine what biome will be present in a region?
100. How do the biotic factors and abiotic factors in an ecosystem affect each
other?
101. What is a niche?
102. Define these types of relationships (symbiosis)
a. mutualism
b. commensalisms
c. parasitism
d. predator/prey
103. What is a carrying capacity?
104. Describe a way a limiting factor can influence a population’s carrying
capacity
5.02 Analyze the flow of energy and the cycling of matter in the ecosystem
105. Describe the carbon cycle.
106. How can humans influence the carbon cycle with:
a. deforestation-
b. fertilizers
c. factories
107. How does photosynthesis relate to energy getting into ecosystems
108. What role do decomposers play in the environment?
109. What is a trophic level?
110. What is a food chain? Draw a food chain including the following organisms
(heron, minnow, plankton).
111. What happens to energy in an ecosystem? What happens to nutrients?
112. How much energy is passed from one trophic level to the next in an
ecosystem? What happens to the rest?
113.What is a food web?
5.03 Assess human population and its impact on local ecosystems and global
environments.
114. What is the greenhouse effect? How do humans impact atmospheric carbon
dioxide?
115. How do volcanoes and other natural environmental processes influence the
climate?
116. What are some factors that influence birth/death rates in the human
population?
117. What effects would the following have on the environment?
a. human population size
b. human population density
c. resource use
118. What affect can a buildup of pesticides have over the long term in the
environment (bioaccumulation)?
119. What affect can pesticides have on organisms that they weren’t intended to
affect?
120. What is pesticide resistance? What are the long term affects?
121. What are some biological alternatives to chemical pesticides? What are the
pros and cons?
122. What is DDT and what are its effect on the ecosystem?
123. How do changes in the human population affect populations of other
organisms?
124. How have the following impacted local ecosystems?
a. acid rain
b. habitat destruction
c. introduced non-native species
125. Give examples of ways humans can perform sustainable practices and
stewardship in the environment.