Download Chapter 10

Chapter 10
Need to Know Study Guide
Section 10.2 – DNA Structure
1. Be able to write out the primary function of DNA
2. Know who made the first successful model of DNA
3. Know what a nucleotide is, and the 3 parts that make a nucleotide
4. Know what types of bond exist between components in a single nucleotide, and
between adjacent nucleotides in a DNA double helix.
5. Know the 4 nitrogenous bases found in DNA and which are purines and
pyrimidines
6. Know the base pairing rules that exist for DNA’s complementary base pairs.
Section 10.3 – DNA Replication
1. Know what the process of copying DNA is called, as well as when, and why it
happens.
2. Know the process of DNA replication and specifically the function of
helicase, the replication fork, and DNA polymerase in this process.
3. Know what an error in the sequence of DNA nucleotides is referred to as
Section 10.4 – Protein Synthesis
1. Be able to relate the overall job of RNA in protein production
2. Be able to explain the advantages of using RNA (instead of DNA directly) to
carry out the instructions in DNA.
3. Know the 3 types of RNA and the function of these in protein production
4. Know the 4 differences between DNA and RNA.
5. Know what the process of copying DNA to RNA is called.
6. Know where in the cell that transcription occurs.
7. Know well the 3-step process of transcription.
a. What enzyme initiates transcription
b. What marks the beginning of a single gene so RNA Polymerase knows
where to begin transcription
c. what indicates where RNA polymerase should stop transcription
8. Know why proteins are important to the cell
9. Know what proteins are composed of
10. What what the subunits make up a polypeptide and what type of bond holds these
subunits together
11. Know the name for the 3 nucleotide mRNA sequence used to assemble a
nucleotide
12. Know the function and be able to identify start and stop codons.
13. Know what the process of assembling polypeptide chains from the information
encoded in mRNA is know as
14. Know the function of both ribosomes(rRNA) and tRNA in the assembly of
polypeptides during translation
15. Know the location in the cell where translation occurs
16. If given a DNA template strand(see example d), be able to:
a. create an mRNA transcript
b. give the tRNA anticodons that are complementary to the mRNA transcript
c. translate the mRNA transcript into an amino acid chain (table will be
supplied)
d. Example DNA template: AACTACGGTCTCAGCACTCCC
i. Find the answers to a-c for the above strand on the class website:
ii. http://www.quia.com/page/tigerbiology.html