Download emboj200956-sup

Supplementary materials:
Materials & Methods:
Primers for generation of dsRNA
The following primer pair was used for generating dsRNA by in vitro transcription
reaction. Spt6: (F) 5’GAATTAATACGACTCACTATAGGGACCGTAACCCCGGTGCCCGAGG-3’.
and (R) 5’GAATTAATACGACTCACTATAGGGAGGCTCTTGTGCCAGCTGTCGG3’. dHypb: (F) 5’GAATTAATACGACTCACTATAGGGAACGCGCAGGTGAAATGGAAA-3’ and
(R): 5’-GAATTAATACGACTCACTATAGGGATGGGCGTTTGCCAAATCCAT-3’.
RNA isolation and Northern Blot
Total RNA was isolated from cells using Trizol reagent (Invitrogen). The
following primer pairs were used for making the probe templates: Hsp70 F:(5’)ACTTGGACGCCAATGGAATCCTGA -3’ and Hsp70 T7R: (5’)GAATTAATACGACTCACTATAGGGA AAGACGTAGCTCTCCAGGGCATTT
Hsp83 F:(5’)- TGCTGCATTGTCACTTCGCAGTTC-3’, Hsp83 T7R: (5’)GAATTAATACGACTCACTATAGGGAACAGCAGGATGACCAGATCCTTGA-3’,
U6 F:(5’)-TCTTGCTTCGGCAGAACATATAC-3’, U6 T7R:(5’)GAATTAATACGACTCACTATAGGGATGTGGAACGCTTCACGAT-3’.
RNA probes were generated by incorporation of [α-32P] UTP using Maxiscript in vitro
transcription kit (Ambion). For separation of RNA species, 1-2 μg of total RNA was run
on a1% denaturing agarose/formaldehyde gel. RNA species were transferred to Protran
nitrocellulose membranes (Whatman) and baked at 80oC. Membrane prehybridization
and blocking was carried out at 68oC in 20ml of prehybridization buffer [6x SSC, 5x
Denhardt’s reagent, 0.5% SDS; 100μg/ml sheared salmon sperm DNA] for 1-2hr. Probes
were added to the prehybridization buffer and hybridization was carried out at 68oC O/N.
Membrane were then washed and exposed to phosphoimager screens and signals were
analyzed using ImageQuant software (Molecular Dynamics).
Tandem RNAi-ChIP
Three hundred micro grams of dsRNA was added to 15ml of exponentially-growing
Drosophila S2 cells at a density of 2 ×106 cells/ml in 150cm2 tissue culture flasks. After
45min, cells were diluted to1×106 cells/ml with serum-containing M3+BPYE (Sigma)
medium. 84 hr later cells were heat shocked, cross-linked with 1% formaldehyde for
2min and quenched with glycine at a final concentration of 0.125M. Cross-linked
chromatin was resuspended at 1×108cell/ml in sonication buffer and sonicated with
Bioruptor (Diagenode). Immunoprecipitation was carried out with 4μl of G. pig
Spt6(Andrulis et al, 2000),4μl of rabbit Rpb3, 4μl of Paf1, 15μl of Rtf1, 2μl of TFIIS,
Spt5 antibodies (Adelman et al, 2005, Adelman et al, 2006)and 10μl of polyclonal rabbit
H3-K36 trimethylation (Abcam 9050) per Immunoprecipitation. For immunoprecpitation
of histone H3, 2μl of polyclonal rabbit antibody (Abcam 1791) was used with 1/5 of
cross-linked chromatin immunoprecipitation material (5×105 cells). Immunoprecipitated
DNA was quantified using real-time PCR. Buffers and primer pairs for real-time PCR
have been described elsewhere (Adelman et al, 2005, Boehm et al, 2003)
Figure & Table Legend
Table S1:
An RNAi screen was performed on a subset of factors that were either known to
be recruited to the heat shock genes in Drosophila or speculated to potentially play role
in transcription based on published work in flies or orthologs in other systems. In brief,
S2 cells at a density of 3 to 6×106 cells/ml were diluted to 1×106 cells/ml with serum free
M3+BPYE medium and 250μl of the diluted cell suspension was seeded in a 24-well
plate and 2.5 μg of dsRNA was added to the cells. After 45 min 500 μl of M3+BPYE +
20% FBS was added to the cells. Three days after treatment 250μl of fresh serumcontaining medium was added to the cells and on the fourth day the cells were harvested
and instantaneously heat shocked at 36.5oC for 20min. RNA was harvested from cells
using the RNasey (Qiagen) kit. Reverse transcription was performed on 200 ng of total
RNA using oligo dT. Quantitative real-time PCR was performed on the harvested cells
using Hsp70 primer pair centered at +2210 and the values were normalized to the Rp49
levels. Primer sequences are described elsewhere (Adelman et al., 2005, Adelman & Wei
et al., 2006). For about 1/3 of the tested factors the real-time PCR results were confirmed
by Northern Blot. Aberrant transcription initiation or apparent processing defects were
not observed for any of the tested factors by Northern Blot. Primer sequences for
designing the dsRNA targeting the factors are available upon request. We also note that
Spt6 RNAi results in a small decrease in the levels of Rp49 mRNA, therefore
normalization of the Hsp70 mRNA levels to the Pol III-transcribed U6 as shown in the
text more accurately reflect the changes in the levels of heat shock transcripts. IWS1 and
Spt6 values in the screen table are derived from Northern Blot experiments.
Figure S1:
dHypb KD decreases the H3-K36 trimethylation levels at Hsp70.
A) Tandem RNAi ChIP showing the K36 trimethylation level of histone H3 over
the Hsp70 gene 2min after HS induction in LacZ(white) and dHypb(gray) KD
cells. N=2, error bars denote range.(values normalized to the histone H3 levels
at the corresponding regions). Lack of any observable defect in the H3-K36
trimethylation signal in dHypb samples at the +2210 region is probably due to
the fact that only a small fraction of Pol II molecules have reached this region
2min after HS. Not long enough for the possible cotranscriptional
trimethylation of H3-K36 to occur.
B) dHypb does not alter the histone H3 density over the Hsp70 gene. Tandem
RNAi ChIP showing the density of Histone H3 over the Hsp70 gene 2min
after HS induction. The numbers below the gene map denotes the center of
primer pairs that were used in the real-time PCR assay.
Figure S2:
Paf1 knock-down does not reduce the elongation rate of the first wave of Pol II.
Tandem Paf1 RNAi-ChIP was performed on S2 cells. Cells were heat shocked for 2
min and the density and distribution of Rpb3 (A), Paf1 (B) and Spt6 (C) on the Hsp70
gene was checked by ChIP.