Download Supplementary Information (doc 43K)

Tomasini et al.
SUPPORTING INFORMATION
Supporting Materials and Methods
Real-time PCR primers. Primers for real-time PCR reactions were as follows.
Cxcl11-forward:
GGCTTCCTTATGTTCAAACAGGG,
GCCGTTACTCGGGTAAATTACA;
GCAGGATTTCCACCTGGCTA;
GGCAGTGTAACTCTTCTGCAT;
Id3-forward:
IFN-forward:
reverse:
GTCACAGCACATGACGGAGG,
GCCGTTCAAGTGCTTCACTC,
TAp73-forward:
GCACTGCTGAGCAAATTGAAC;
Np73-reverse:
CGACCGAGGAGCCTCTTAG,
CAGCTCCAAGAAAGGACGAAC,
Cald1-forward:
TGTCAATCTTGGAGACTACTGCT;
Cxcl-11-reverse:
Id3-reverse
IFN-reverse:
Cald1-reverse:
GCACCTACTTTGACCTCCCC,
Np73-forward:
TAp73-
CCCACCACTTCGAGGTCAC,
GGCATGTCTTAGCAATCTGACAG;
p53-forward:
p53-reverse: TCTTCCAGATGCTCGGGATAC.
Apoptosis. Plated cells were stimulated for 24 or 48hrs
with TGF (20ng/ml,
Peprotech), Staurosporine (200nM, Sigma-Aldrich), Etoposide (50µM, SigmaAldrich), LPS (100ng/ml, Sigma-Aldrich), IFN (5ng/ml, eBiosciences) or LPS/IFN
(100ng/ml, 5ng/ml). Apoptosis was evaluated by flow cytometry or caspase-3
cleavage. For the former, stimulated cells were incubated with 500µg/ml propidium
iodide (PI, Fluo Probes, Interchim) and stained with AnnexinV-APC (BD
Biosciences) following the manufacturer’s protocol. Stained cells were analyzed
using a FACSCalibur (Becton Dickinson Biosciences) and data were analyzed with
CellQuestTM Pro (BD Biosciences) and FlowJo 7.2.2 Data Analysis Software. For
measurements of the activities of caspases 3 and 7, the Caspase-Glo®3/7 Assay
(Promega, Mannheim, Germany) was carried out according to the manufacturer’s
instructions. This kit is based on the cleavage of the DEVD sequence of a
luminogenic substrate by the caspases 3 and 7 resulting in a luminescent signal.
1
Tomasini et al.
Cytokines. IL-6 and TNFα levels data from Figure 1D and E were determined in
triplicate using commercial ELISA kits according to the manufacturer’s (BD
Biosciences) protocol. IL-12p70, MIP2, TNFα, IL-6 and IFNγ levels in culture
supernatants or serum samples were determined in triplicate using Searchlight®
Protein Array Analysis Services from Pierce Biotechnology.
cDNA microarray analysis of gene expression. Elicited peritoneal macrophages
were treated in vitro (or not; control) with 10 µg/ml LPS. After 0, 4 or 12 hrs, total
RNA was extracted using Trizol Reagent (Invitrogen) according to the manufacturer’s
protocol. RNA hybridization to a mouse gene expression array (MOE 430 2.1) was
performed by the Microarray Platform at the CHUL Research Center of the Quebec
Genomics Center (http://genome.ulaval.ca/chip).
Tissue damage scoring
Pancreas and Liver tissues were examined histopathologically for tissue damage
scoring. The pathologist blinded as to which group an animal belonged. Tissue edema
formation, infiltration of the inflammatory cells and necrosis area were scored
between 0 and 3. According to this scoring system: 0) Normal tissue; 1) small
perivascular edema formation/few neutrophil leukocyte infiltration/small necrosis
area; 2) milder perivascular edema formation/moderate neutrophil leukocyte
infiltration/milder necrosis area; 3) Important perivascular edema/dens neutrophil
leukocyte infiltration/important necrosis area;
Immunoprecipitation
2
Tomasini et al.
Elicited peritoneal macrophages from TAp73+/+ mice were treated for increasing
period of time from 10 to 120 minutes with LPS (10µg/ml). Then cells were lysed in
ice-cold 1% Triton X-100 buffer (pH 7.5) containing protease inhibitors. The lysates
were
cleared
by
centrifugation
at
13
000
r.p.m
for
15min
at
4°C.
Immunoprecipitations using the cleared cell lysates were performed at 4°C for 2 h
with TAp73 antibody (H79, Santa Cruz Biotechnology, Inc). Immune-complexes
were precipitated with protein A (Zymed Laboratories,San Francisco, CA, USA) for
an additional 1 h and washed three times with lysis buffer. They were then
resuspended in Laemmli sample buffer and boiled for 5min. The proteins were then
resolved on sodium
dodecyl
sulfate–polyacrylamidegel
electrophoresis
and
transferred to nirocellulose filters. Classical procedure was then used for western blot
process using either TAp73 antibodies (H79) or mouse phospho-tyrosine (Cell
Signaling Technology, 9411) as primary antibodies. Development was done using
ECL kit from Amersham Biosciences (Saclay, France). The bands obtained from
three independent experiments were quantified using ImageJ software and normalized
with respect to the control bands.
Chromatin Immunoprecipitation
The chromatin immunprecipitation assays were done following a protocol provided
by Millipore Inc. using the premade assay kit “EZ-ChIPTM” (Millipore Inc, 17-371).
This protocol was used on WT EPMs after 12 hrs of LPS treatment (10µg/ml). TAp73
antibody (H79, Santa Cruz Biotechnology, Inc) was used for the immunoprecipitation
step and incubated with protein G agarose beads included in the assay kit. DNAs were
purified using a PCR purification kit (Promega) and then analyzed by regular PCR
3
Tomasini et al.
using the mouse Mgat5, Frp1, Fosl2, p57/Kip2, G-CSF (CSF3) and IL4i1 promoterspecific primers.
4
Tomasini et al.
Supporting Figure Legends
Fig. S1. Accelerated tissue damage in LPS-treated TAp73-deficient mice. WT and
TAp73-/- mice were i.p. injected with a lethal dose of LPS (25mg/kg). At 6 hrs postLPS, inflammation in the pancreas and liver were histopathologically scored as
described in Supplemental Methods. Ed, Edema; Infil, Immune cell infiltration; Nec,
Necrosis area. Data are the mean ± SD of data pooled from two experiments
involving 3 mice/group/experiments. *, P<0.05 (Student t-test).
Fig. S2. Loss of Np73 isoforms does not confer hypersensitivity to LPS-induced
septic shock. A lethal dose of LPS (25mg/kg body weight; Sigma) was i.p. injected
into WT and Np73-deficient male mice (10-14 weeks old). Survival was monitored
for 100 hrs. P=0.592 (log-rank test).
Fig. S3. Induction of TAp73 after LPS treatment. (A) WT or TAp73-/- EPMs were
treated for increasing period of time from 1 to 9 hrs with LPS (10 μg/ml) and levels of
TAp73, Np73 and p53 mRNAs were determined by Real-time PCR. Data shown are
the mean fold change ± SD in mRNA expression after LPS treatment. Results are one
trial representative of 3 independent experiments. ND means not determined. (B) WT
EPMs were treated for increasing period of time from 10 to 120 min with LPS (10
μg/ml) and cell lysates were prepared for immunoprecipitation using TAp73 antibody
then western blot with phospho-tyrosine antibody. Results are one trial representative
of 3 independent experiments. Data shown in the diagram are the mean fold change ±
SD in tyrosine phosphorylated TAp73 after LPS treatment. *, P<0.05; **, P<0.01
(Student t-test).
5
Tomasini et al.
Fig. S4. F4/80+ macrophages content in total cells from peritoneal washes. (A)
Representative flow cytometric histogram. Ctr, control (F4/80 negative staining). (B
to D) Percentage of total cells expressing, or not, F4/80 (macrophages) are shown
regarding Figure 2B (for B), Figures 2C (for C) and 2D ( forD), respectively.
Figure S5. Expression of key genes involved in apoptosis/survival regulation.
Data generated from cDNA microarray analysis. Fold change represents the ratio of
the hybridization intensity of a given gene in TAp73-/- EPMs compared to WT EPMs.
Data are shown for the “no treatment” condition (0), and for LPS treatment for 4 hrs
(4h-LPS) or 12 hrs (12h-LPS). Column 5 to 7 are showing raw value data from
microarray analysis. Only genes for which a statistical difference of P<0.01 was
obtained are shown. A fold change filter of 1.5 (or -1.5) was used. The p53RE column
contains results obtained from the p53 Family Target Genes Database, where the
presence of a p53-responsive element was observed in an intron (I), the promoter
region (P), or in the 3’UTR (U).
Figure S6. Expression of key genes involved in macrophage metabolism and
immune response. Data generated from cDNA microarray analysis. Fold-change
represents the ratio of the hybridization intensity of a given gene in TAp73-/- EPMs
compared to WT EPMs. Data are shown for the “no treatment” condition (0), and for
LPS treatment for 4 hrs (4h-LPS) or 12 hrs (12h-LPS). Column 5 to 7 are showing
raw value data from microarray analysis. Only genes for which a statistical difference
of P<0.01 was obtained are shown. A fold-change filter of 1.5 (or -1.5) was used. The
p53RE column contains results obtained from the p53 Family Target Genes Database,
6
Tomasini et al.
where the presence of a p53-responsive element was observed in an intron (I), the
promoter region (P), or in the 3’UTR (U).
Fig. S7. Modulation of other gene expression profiles as determined by cDNA
microarray analysis. (A) WT or TAp73-/- EPMs were treated for increasing period of
time from 1 to 9 hrs with LPS (10 μg/ml) and levels of 1) Id3 mRNA was determined
by Real-time PCR. Data shown are the mean fold change ± SD in mRNA expression
after LPS treatment. Results are one trial representative of 3 independent experiments.
(B) Liver tissue. WT and TAp73-/- mice were treated with LPS (25mg/kg) for 1.5 or 6
hrs. Liver tissues were recovered and levels of 1) Cald1 and 2) Id3 mRNAs were
determined as in (A). Data are the mean fold change ± SD in mRNA level (n=3
mice/group). Results are representative of 2 independent experiments. For A and B, *,
P<0.05; **, P<0.01 (Student t-test).
Fig. S8. Loss of TAp73 protects EPMs from some apoptotic stimuli. (A) LPSinduced apoptosis. WT and TAp73-/- EPMs were treated in vitro for 12 hrs with the
indicated doses of LPS. PI/AnnexinV positivity was determined as described in
Methods. (B) Other apoptotic stimuli. WT and TAp73-/- EPMs were treated with the
indicated apoptotic stimuli (see Methods) for 24 hrs, and caspase-3 activity was
determined as for Figure 4A. Stauro, staurosporine; Etop, etoposide. For A and B,
data are the mean ± SD of pooled results from 2 experiments, each involving EPMs
from 2 mice/genotype. *P<0.05, **P<0.01 (Student t-test).
7