Download Expressing the multifunctional nucleoside kinase of : Drosophila melanogaster Shuba Krishnan

Department of Physics, Chemistry and Biology
Final Thesis
Expressing the multifunctional nucleoside kinase of
Drosophila melanogaster in a mouse model :
a strategy to reverse the depletion of mtDNA
caused by nucleoside kinase deficiency
Shuba Krishnan
LiTH-IFM-A-EX--11/2432—SE
Supervisors: Professor Anna Karlsson & Xiaoshan Zhou, Ph D
Karolinska Institute
Examiner: Jordi Altimiras, Linköping university
Department of Physics, Chemistry and Biology
Linköpings universitet
SE-581 83 Linköping, Sweden
Datum
Avdelning, Institution
Division, Department
Date
Avdelningen för biologi
Instutitionen för fysik och mätteknik
Språk
Language
Svenska/Swedish
X Engelska/English
Rapporttyp
Report category
Licentiatavhandling
X Examensarbete
C-uppsats
X D-uppsats
Övrig rapport
ISBN
LITH-IFM-A-EX--—11/2432—SE
__________________________________________________
ISRN
__________________________________________________
Serietitel och serienummer
Title of series, numbering
________________
2011-06-14
ISSN
_______________
URL för elektronisk version
Handledare
Supervisor: Jordi Altimiras
Ort
Location: Linköping
Titel
Title
Expressing the multifunctional nucleoside kinase of Drosophila melanogaster in a mouse model :
a strategy to reverse the depletion of mtDNA caused by nucleoside kinase deficiency.
Författare
Author : Shuba Krishnan
Sammanfattning
Abstract
This study was initiated to investigate a possible strategy to alter an enzyme deficiency in a
mouse model. The enzyme investigated is a multifunctional nucleoside kinase from Drosophila
melanogaster (Dm-dNK). This enzyme has special features in that it has higher enzymatic activity
than any other known nucleoside kinases and still has similar substrate specificity as the human
nucleoside kinases. The deficiency where the Dm-dNK transgenic mice model will be used is a
TK2 deficient model with severe phenotype caused by mitochondrial DNA depletion. The
Dm-dNK transgenic mice model will be used as a way to rescue the TK2 deficient mice. The
results from the present study show that Dm-dNK expression in mice results in a substantial
increase of thymidine phosphorylation in several investigated tissues. The mice were otherwise
normal as judged by life span, weight and behavior. The mitochondrial DNA was also detected at
normal levels. In conclusion, the Dm-dNK mouse model is promising as a way to rescue the
severe phenotype of the TK2 deficient mice.
Nyckelord
Keyword
Dm-dNK, mitochondria, thymidine kinase, phosphorylation
Table of Contents
1. Abstract .................................................................................................................................. 2
2. List of abbreviations ............................................................................................................... 2
3. Introduction ............................................................................................................................ 3
4. Materials and methods ........................................................................................................... 4
4.1 Construction of the Dm-dNK mice ................................................................................... 4
4.2 Analysis of protein expression ......................................................................................... 5
4.3 Dm-dNK enzyme activity ................................................................................................. 5
4.4 Quantification of mtDNA by Real-time PCR................................................................... 5
4.5 Other studies ..................................................................................................................... 6
5. Results .................................................................................................................................... 6
5.1 Purification of Dm-dNK transgene ................................................................................... 6
5.2 Genotyping of Dm-dNK expressing mice ........................................................................ 7
5.3 Analysis of Dm-dNK Protein Expression......................................................................... 7
5.5 Quantification of mtDNA by Real-time PCR (RT-PCR) ................................................. 9
6. Discussion ............................................................................................................................ 10
7. Conclusion ............................................................................................................................ 12
8. Acknowledgements .............................................................................................................. 12
9. References ............................................................................................................................ 12
1
1. Abstract
This study was initiated to investigate a possible strategy to alter an enzyme deficiency in a
mouse model. The enzyme investigated is a multifunctional nucleoside kinase from
Drosophila melanogaster (Dm-dNK). This enzyme has special features in that it has higher
enzymatic activity than any other known nucleoside kinases and still has similar substrate
specificity as the human nucleoside kinases. The deficiency where the Dm-dNK transgenic
mice model will be used is a TK2 deficient model with severe phenotype caused by
mitochondrial DNA depletion. The Dm-dNK transgenic mice model will be used as a way to
rescue the TK2 deficient mice. The results from the present study show that Dm-dNK
expression in mice results in a substantial increase of thymidine phosphorylation in several
investigated tissues. The mice were otherwise normal as judged by life span, weight and
behavior. The mitochondrial DNA was also detected at normal levels. In conclusion, the
Dm-dNK mouse model is promising as a way to rescue the severe phenotype of the TK2
deficient mice.
Keywords:
Dm-dNK, mitochondria, thymidine kinase, phosphorylation
2. List of abbreviations
ATP – adenosine triphosphates
cdN – cytosolic deoxyribonucleosides
M - Months
dAdo – deoxyadenosine
dCK – deoxycytidine kinase
dUrd - deoxyuridine
MDS – mitochondrial DNA Depletion Syndrome
dCyd – deoxycytidine
mtDNA – mitochondrial DNA
dGuo – deoxyguanosine
dN - deoxyribonucleosides
p53R2 - p53 inducible ribonucleotide reductase
small subunit
Pol γ - catalytic subunit of mitochondrial DNA
polymerase
SUCLA2 - succinyl-CoA ligase β subunit
dNK – deoxynucleoside kinase
SUCLG1 - succinyl-CoA ligase α subunit
dNTP – deoxyribonucleoside triphosphate
TK1 – thymidine kinase 1
dThd – deoxythymidine
TK2 – thymidine kinase 2
dGK – deoxyguanosine kinase
2
3. Introduction
Mitochondria are present in all eukaryotic cells and have the function of generating ATP for
the survival of the cells. They contain their own DNA and have their own machinery for
transcription and translation processes. Human mitochondrial DNA (mtDNA) is a circular
double stranded molecule encoding 13 protein subunits of the respiratory chain and tRNA’s
and rRNA’s required for protein synthesis (Dimmock et al., 2010). The synthesis of mtDNA
is not cell cycle regulated and requires a constant supply of deoxyribonucleoside
triphosphates (dNTPs) for maintenance of the mitochondrial integrity. There is no de novo
nucleotide synthesis in the mitochondria and the mitochondrial inner membrane is
impermeable to charged molecules. Hence the mitochondrial dNTP pool is maintained by
salvaging deoxynucleosides within the mitochondria or by importing cytosolic dNTPs
through specific transporters. However, in non replicating cells, there is no dNTP synthesis in
the cytosol; so the import of dNTPs from the cytosol is not possible. Hence, in non-replicating
cells, the mtDNA synthesis depends on the salvage pathway enzymes – the
deoxyribonucleoside kinases (dNKs).
The deoxyribonucleoside kinases (dNK) catalyze the phosphorylation of the
deoxyribonucleosides into deoxyribonucleoside monophosphates, which are precursors of the
dNTPs (Knecht et al., 2007). In mammals, there are four dNKs with overlapping specificities.
Thymidine kinase 1 (TK1) is a cytoplasmic enzyme highly specific for deoxythymidine
(dThd) and deoxyuridine (dUrd). Thymidine kinase 2 (TK2) (a mitochondrial enzyme)
phosphorylates dThd dUrd and deoxycytidine (dCyd). The deoxyguanosine kinase (dGK) (a
mitochondrial enzyme) phosphorylates deoxyadenosine (dAdo) and deoxyguanosine (dGuo),
while the deoxycytidine kinase (a cytoplasmic enzyme) (dCK) phosphorylates dAdo, dGuo
and dCyd (Knecht et al., 2002; Knecht et al., 2007) (Figure 1).
Figure 1: Salvage Pathway
3
Mitochondrial DNA depletion syndrome (MDS) is a heterogeneous group of mitochondrial
disorders characterized by reduced levels of mtDNA but with no mutations or deletions of the
mtDNA. Mutations in the nuclear encoded dNKs; mitochondrial deoxyguanosine kinase
(DGUOK) and thymidine kinase 2 (TK2), have been associated with a hepatocerebral and
myopathic forms of MDS, respectively (Mandel et al., 2001; Saada et al., 2001). Other
mutations known to cause MDS are mutations in the p53 inducible ribonucleotide reductase
small subunit (p53R2), succinyl-CoA ligase β subunit (SUCLA2), succinyl-CoA ligase α
subunit (SUCLG1), catalytic subunit of mitochondrial DNA polymerase (polγ), Twinkle gene
(mitochondrial DNA helicase), and MPV17 protein (Wang 2010).
Deoxyribonucleoside kinase from Drosophila melanogaster (Dm-dNK) is a multisubstrate
kinase (cytosolic) that has unique properties to recognize all four natural nucleosides (Solaroli
et al., 2007b; Knecht et al., 2002; Munch-Petersen et al., 2000). The Dm-dNK can catalyze
both purine and pyrimidine deoxyribonucleosides. However, the catalytic activity for
pyrimidines is higher than for purines. It has broad substrate specificity and high catalytic
rates (Solaroli et al., 2007a). It can be expressed at high levels with high enzyme activity in
mammalian cells (Solaroli et al., 2007a) and can be used as a suicide gene in cancer cells
(Zheng et al., 2001; Zheng et al., 2000).
The aim of this study is to investigate the Dm-dNK expression in mice. The enzymatic
activities of the Dm-dNK and the wild-type thymidine kinase enzymes were analyzed and
different features of the mice such as growth rate, organ weight, mortality and mtDNA were
compared.
4. Materials and Methods
4.1 Construction of the Dm-dNK mice
In order to study the expression of Dm-dNK, a mouse strain expressing Dm-dNK was
constructed. CMV promoter/enhancer was used for the Dm-dNK transgene which was
amplified using PCR and cloned into pCDNA3 vector. The transgene was cut from the vector
using Bgl II and Dra III restriction enzymes and purified (Fig 1). The purified Dm-dNK
transgene was then injected into the female mice using the pronuclear injection technique.
Genotyping was performed by isolating DNA from tail tissues for PCR analysis of the
presence of the Dm-dNK gene. The expression of the protein in various tissues was also
analysed and the enzymatic activity in both the wild-type mouse (WT C57BL/6) and the
Dm-dNK positive mice were determined and compared. Tail samples collected from mice that
were approximately 14 days old were cut approximately 0.25 inches from the tip using sterile
scissors and the mice were ear marked. DNA was isolated from the tail samples using the
DNeasy Blood and Tissue Kit (QIAGEN) and the DNA screened for Dm-dNK gene by PCR
using specific primers for the Dm-dNK gene (given below).
Fw : 5’-TAAAGCTTATGGCGGAGGCAGCATCCTGTGC-3’
Rv : 5’TAGGATCCTTAGTGATGATGATGATGATGTCTGGCGACCCTCTGGCGCTTGCT-3’
4
4.2 Analysis of protein expression
Total protein was extracted from various tissues including brain, liver, skeletal muscle and
heart of Dm-dNK positive and wild-type mice. The protein was extracted using RIPA Buffer
(50 mM Tris HCl pH 7.6, 150 mM NaCl, 1% N-P40, 10% sodium deoxycholate, 0.1%
sodium dodecyl sulphate (SDS) and protease inhibitors). Western blot was performed using
4-12% precast Bis Tris gel (NuPAGE) and Amersham Hyband-P membrane (Invitrogen). The
presence of Dm-dNK protein was detected using anti-histidine antibody targeted against
His-tag of the protein (1:3000) (CalBiochem) and anti mouse IgG linked to horse radish
peroxidase (HRP) (1:3000) (GE Health Care). ECL (GE Health Care) was used as a substrate
for the HRP.
4.3 Dm-dNK enzyme activity
The enzyme assays were carried out as described (Solaroli et al., 2007b). Briefly, the tissues
were homogenized and suspended in extraction buffer (50 mM Tris-HCl pH 7.6, 2 mM
dithiothreitol (DTT), 5 mM benxamidine, 0.5 mM phenylmethylsulfonyl fluoride (PMSF),
20% glycerol and 0.5% Nonidet P40). The suspension was centrifuged at 13,000 rpm for 20
minutes and the supernatant collected and stored at -80°C. The protein concentrations were
determined using Bradford Protein Assay reagent (Bio-Rad) and bovine serum albumin
(BSA) as a standard. The enzymatic assays were performed in 50mM Tris-HCl (pH 7.6), 5
mM MgCl2, 5 mM ATP, 2 mM DTT, 15 mM NaF, 0.5mg/ml BSA, 40-50µg protein, 3 µM
[methyl-3H]thymidine (Moravek) and 7 µM unlabelled thymidine. 10µL of the reaction
mixture was spotted on Whatman DE-81 filter discs after incubation at 37°C at different time
points (0, 10, 20 and 30 minutes). The filters were washed three times in 5 mM ammonium
formate and the filter bound product was eluted from the filter with 0.1 M KCl and 0.1 M
HCl. The radioactivity was quantified by scintillation counting using 3ml scintillation buffer.
Two mice from each group (Dm-dNK positive and wild-type) and for each time point (1
month, 3.5 months and 5 months old) were analyzed. All experiments were performed in
triplicates. The data were analyzed statistically (student’s t-test using Prism 5.0 software).
4.4 Quantification of mtDNA by Real-time PCR.
The number of mtDNA copies per diploid nucleus in mouse tissues was determined using
real-time PCR absolute quantification, using an ABI 7500 Fast system (Applied Biosystems).
Total genomic DNA was purified from mouse tissues using the DNeasy Blood and tissue kit
(QIAGEN). 5 to 10 ng of genomic DNA were used in each reaction. Primers and probe for
mouse mt-ND1 gene (mitochondrially encoded NADH dehydrogenase 1) and for single-copy
mouse RPPH1 gene (nuclear encoded ribonuclease P RNA component H1) were designed for
this purpose (given below). For each DNA sample, the mitochondrial gene mt-ND1 and the
nuclear gene RPPH1 were quantified separately. Standard curves have been done using
known copies of a plasmid containing one copy of each of those two mouse genes referred
above. According to the standard curve, the number of copies from each gene was calculated
for each sample and the number of mtDNA copies per diploid nucleus was calculated
according to the formula:
mtDNA copies per diploid nucleus = 2 x (mt-ND1 gene copies/RPPH1 gene copies)
5
PRIMERS
RPPH1
Fw : 5’-GGAGAGTAGTCTGAATTGGGTTATGAG
Rv : 5’-CAGCAGTGCGAGTTCAATGG
mt-ND1
Fw : 5’-TCGACCTGACAGAAGGAGAATCA
Rv: 5’-GGGCCGGCTGCGTATT
PROBES
RPPH1 :FAM-CCGGGAGGTGCCTC-TAMRA
mt-ND1 :FAM-AATTAGTATCAGGGTTTAACG-TAMRA
4.5 Other studies
The mice were studied for growth rate, mitochondrial DNA, organ weights, mortality and
signs of neurological defects.
5. Results
5.1 Purification of Dm-dNK transgene
The Dm-dNK transgene, amplified and cloned in pcDNA3 vector, was cut from the vector
using Bgl II and Dra III restriction enzymes and purified in an agarose gel (Figure 2).
Figure 2: Restriction digestion of Dm-dNK using BghII and DraIII enzymes. Lane 1 – Fast
Ruler DNA Ladder Middle Range (Fermentas) (M), Lane 2 – pCDNA3-DmdNK restriction
digested using Bgl II + Dra III enzymes (1). Lane 3 – Purified Dm-dNK transgene (2).
6
5.2 Genotyping of Dm-dNK expressing mice
Dm-dNK expressing mice were created by crossing a Dm-dNK mouse
(Dm-dNK+/-) with a wild-type mouse and the pups (approx. 14 days) were screened for the
presence of the Dm-dNK gene by PCR (Figure 3). Clear bands were observed for the samples
of mice 1, 2, 3 and 5, which confirmed the presence of the Dm-dNK gene.
Figure 3. Genotyping of Dm-dNK mice. Lane 1 – Fast Ruler DNA Ladder Middle Range
(Fermentas) (M); Lanes 2-8 – DNA samples from #46-1 to #46-7; Lane 9 – Positive Control
(P). The samples 1, 2, 3, & 5 (lanes 2, 3, 4 and 6 respectively) show clear band at
approximately 850 bp. No band observed in samples 4, 6 and 7 (lanes 5, 7 and 8
respectively).
5.3 Analysis of Dm-dNK Protein Expression
A Western blot analysis for the samples of mouse 3 (Figure 3) showed expression of
Dm-dNK in the skeletal muscle. No visible expression could be detected in liver, heart or
brain of this mouse. The control samples of a liter mate wild-type mouse (mouse 4, Figure 3)
also showed no expression in any tissue (Figure 4).
Approx. 28 kD
Figure 4: Western Blotting. Comparison of expression of Dm-dNK protein between wild-type
and Dm-dNK positive mice. Expression of Dm-dNK protein in the skeletal muscle (arrow) is
observed (28kD).
5.4 Dm-dNK Enzyme Activity
The total thymidine phosphorylating activity was determined in the brain, skeletal muscle,
heart, liver, kidney and spleen of 1 month, 3.5 months and 5 months old mice using [methyl3
H] thymidine. The result shows that, in 1 month old mice, there is an increase in dThd
phosphorylating activity in the Dm-dNK+/- positive mouse samples as compared to the dThd
phosphorylating activity (that is a result from TK1 and/or TK2 activity) in the wild-type
mouse samples (Figure 5). It was observed that the enzymatic activity was higher in the
skeletal muscle, brain and kidney when compared to the heart and liver samples. A high dThd
phosphorylating activity was observed in skeletal muscle and kidney in samples from 3.5
months old Dm-dNK+/- positive mice. There was no difference in enzyme activities between
the Dm-dNK positive mice and the wild-type mice in 3.5 months old mice brain samples or
any analyzed tissues from 5 month old mice (Figure 6).
7
Figure 5: Enzyme activity determined as [3H]Thd phosphorylation (pmol dTMP/mg/min) in
extracts of brain, heart liver, skeletal muscle, spleen and kidney of wild-type and Dm-dNK+/mice that were 1 month old . The enzyme activity was measured over a time period of 30
minutes. The enzyme activity was higher in the Dm-dNK+/- mice when compared to the
wild- type mice in all the tissues studied and this increase was statistically significant for all
the tissues.
8
Figure 6: Estimated activity of Dm-dNK determined as [3H] thymidine phosphorylation
(pmol dTMP/mg/min) in extracts of brain, skeletal muscle and kidney samples of 1 month
(1M), 3.5 months (3.5M) and 5 months (5M) old wild-type and Dm-dNK+/- mice. Data
represent average of all three time points at which activity was measured (10, 20 and 30 min).
Enzyme is active in skeletal muscle and kidney till 3.5M of age in the Dm-dNK+/- mice
(p<0.001). No significant difference in enzymatic activity was observed between wild-type
and Dm-dNK+/- samples in 5M mice and in the brain sample of 3.5M mice samples (p>0.05).
5.5 Quantification of mtDNA by Real-time PCR (RT-PCR)
The mitochondrial DNA (mtDNA) was quantified by RT-PCR in skeletal muscle of the 3.5
month old mice (Figure 7). The results indicate that, there is no significant difference in the
mtDNA copy number in the wild-type and the Dm-dNK+/- positive mice.
Figure 7: mtDNA copies per diploid nucleus in skeletal muscle of 3.5 month old wild-type
and Dm-dNK positive mice.
9
6. Discussion
The present work was initiated to express the multisubstrate deoxyribonucleoside kinase from
Drosophila melanogaster in mice. The enzyme has previously been expressed in mammalian
cells and characterized for its different substrate specificities. Dm-dNK expressing mice have
been developed and the presence of the gene and the expression of the protein in the mouse
have been studied.
The presence of the Dm-dNK gene in mice was detected by PCR using specific primers for
the gene. Pups (approx. 14 days old) from different mouse strains were screened for the
Dm-dNK gene. 4 out of 7 pups were Dm-dNK positive. The expression of the gene was
studied in various tissues of one of these mice (mouse 3) by Western blot. The Dm-dNK
protein was expressed in the skeletal muscle of the mouse and was approximately 28 kDa
(Munch - Petersen et al., 2000). The Dm-dNK protein could not be detected in the brain, heart
or liver samples of the mice. This could be due to the site of integration that could affect the
expression of the Dm-dNK gene in different tissues. The Dm-dNK gene could be expressed in
very low amounts that could not be detected using a Western blot.
The catalytic rate of deoxyribonucleoside phosphorylation by Dm-dNK has been found to be
10- to 100-fold higher than for the mammalian enzymes depending on the substrate used
(Johansson et al., 1999). The phosphorylation of [3H]-methyl thymidine was studied in brain,
heart, liver, skeletal muscle, spleen and kidney of 1 month old mice. The results showed that
the Dm-dNK activity in the Dm-dNK positive mice was higher than the combined TK1 and
TK2 activity in the wild-type mice (Solaroli et al., 2007a). The activity was very high in
skeletal muscle, brain, spleen and kidney of the Dm-dNK positive mice as compared to the
liver and heart. The skeletal muscle and kidney showed a 70 fold increase in thymidine
phosphorylation in the Dm-dNK positive mice, while the brain showed around 40 fold higher
thymidine phosphorylation when compared to the wild-type mice. Heart and liver show
around 20 and 1.5 times increase in thymidine phosphorylation in the Dm-dNK positive mice
respectively.
The spleen has a high TK1 activity when compared to the other tissues (Wang and Eriksson,
2010). Hence, the high phosphorylation of dThd in the spleen of Dm-dNK positive mice is
due to the combined activity of the Dm-dNK, TK1 and TK2 enzymes. TK1 is only present in
dividing cells and TK2 is present both in non-dividing and dividing cells but at much lower
levels (Kristensen, 1996). Hence, in skeletal muscle, brain, heart, liver and kidney cells of the
wild type mice, the low enzymatic activity observed is probably mainly due to the activity of
the TK2 enzyme and enzyme activities observed in the Dm-dNK positive mice tissues (except
spleen) is due to the combined activity of the low amount of TK2 enzyme and the Dm-dNK
enzyme. The variation in enzyme activity within the spleen samples could be due to the
gender differences between the mice. The integration of a transgene is random; neither the site
of integration nor the copy number can be controlled (Babinet, 2000). Hence, the variation in
gene expression between different tissue samples of Dm-dNK positive mice could be due to
the random integration of the Dm-dNK gene in a site with low expression in certain tissues.
The variation in enzyme activity measurements could also be due to technical problems, such
as non-uniform homogenization of different tissues causing the cells to stay intact. Further
studies need to be performed to study the variation in the enzyme expression between the
male and female mice. The Dm-dNK enzymatic activity was studied in the skeletal muscle,
brain and kidney of 3.5 months and 5 months old mice. The enzyme was found to be active
10
until 3.5 months of age in the skeletal muscle and kidney, and no expression in the brain.
There was no enzyme activity in any of these tissues in the 5 months old mice.
mtDNA copy number is tightly regulated, and the genes involved in this regulation are
beginning to be discovered. Quantification of the mtDNA was performed using real-time PCR
to determine the number of mtDNA copies per diploid nucleus in skeletal muscle of 3.5
months old mice. This tissue was used for quantification because dThd phosphorylating
activity was the highest in skeletal muscle (Figure 5) and the Dm-dNK gene was expressed till
3.5 months of age (Figure 6). Dm-dNK expressing mice deliver more substrates than wildtype mice for DNA synthesis. Hence, there should be increase in dNTP pools in the cell.
Imbalance in dNTP pools could affect the mtDNA copy number. However, no change in
mtDNA copy number was observed in the skeletal muscle of Dm-dNK expressing mice
(Figure 7). The small difference in mtDNA copy number between the wild-type and
Dm-dNK+/- samples could be due to variations in technical procedures.
The Dm-dNK enzyme has been shown to be closely related to mammalian TK2 enzyme
(Johansson et al., 1999). Hence, with dThd as the substrate, the Dm-dNK enzyme should
deliver more dTTPs to the mitochondria. dTTP pools should be measured using enzymatic
assays or High-performance liquid chromatography (HPLC) to see if there is an imbalance in
dNTP pool in the Dm-dNK expressing mice. dNTP pool imbalances are known to affect the
fidelity of DNA synthesis in the cell. In the nuclear genome, mutagenic dNTP pools are
known to activate DNA damage checkpoint pathways (Zegerman and Diffley, 2009), but this
may only occur if the level of at least one dNTP is limiting for DNA replication (Kumar et al.,
2010). That is, most of the dNTP pool imbalances are detected by the cell, only when the
concentration of one of the four dNTPs is high and another dNTP concentration is very low.
However, when Dm-dNK is expressed in mice, the Dm-dNK could phosphorylate all the four
deoxyribonucleosides causing just an imbalance in the dNTP pool where none of the dNTPs
is limiting for DNA replication. Since there is no significant difference in the mtDNA copy
number in the Dm-dNK expressing mice, a small increase in levels of DNA precursors might
not affect the fidelity of DNA synthesis. Again, measurement of the dNTP pools will give a
better understanding of this mechanism.
Thymidine phosphorylase (TP) is an enzyme that dephosphorylates deoxythymidine to
thymidine. Mutation in TP increases the dThd concentration in the cell. mtDNA may be more
vulnerable to excessive thymidine than the nuclear genome because TK2 is constitutively
expressed, whereas cytosolic TK1 is cell cycle regulated. Knockout mice lacking TP have
been shown to exhibit elevated dTTP pools and late onset mtDNA depletion in brain (Lopez
et al., 2009). Similarly, increase in dNTP pools could affect the mtDNA at a later stage after
3.5 months. Hence, the mtDNA should be quantified at a later stage (say 4 months) to see if
there is any effect in the mtDNA copy number.
Mitochondrial DNA (mtDNA) depletion syndromes constitute a heterogeneous group of
disorders that frequently cause severe symptoms of organ failure due to mitochondrial
dysfunction (Zhou et al., 2010). Mutations in genes that encode proteins involved in
mitochondrial DNA replication and deoxyribonucleotide synthesis have been linked to the
mtDNA depletion, including the genes that encode the mitochondrial deoxyribonucleoside
kinases TK2 and dGK (Mandel et al., 2001; Saada et al., 2001). Together these enzymes
catalyze the intra-mitochondrial phosphorylation of all four deoxyribonucleosides required for
DNA synthesis. The symptoms of patients with TK2 and dGK deficiency differ, where TK2
deficiency predominantly causes severe myopathy and dGK deficiency causes liver failure
and neurological symptoms. TK2 deficient mice have been generated, and construction of a
11
dGK deficient mouse strain is ongoing, to study the molecular mechanisms and treatment
strategies to disease caused by mtDNA deficiency which is of high significance for affected
patients and also for related diseases where mitochondrial dysfunction is contributing. The
Dm-dNK expressing mouse model could be used to study whether this enzyme can
compensate the absence of TK2 or dGK.
7. Conclusion
The Dm-dNK was expressed in vivo in gene and protein level. The Dm-dNK protein could be
detected in the skeletal muscle of 1 month old mice. Enzymatic assays in different tissues of 1
month old mice confirmed higher thymidine phosphorylating activity of the Dm-dNK positive
mice when compared to the wild type mice. The Dm-dNK enzyme was active till 3.5 months
in skeletal muscle and kidney, but decreased in the brain at 3.5 months. The enzyme loses
activity at 5 months of age.
8. Acknowledgements
I would like to thank Professor Anna Karlsson, for providing the opportunity to do my thesis
in her lab, encouraging and guiding me throughout the project, Xiaoshan Zhou for his
valuable help, inspiration and guidance throughout the thesis, my examiner Jordi Altimiras for
his time and effort to go through my thesis and provide valuable suggestions in improving it,
Johan Edqvist for being a great support from the beginning of my work. Many thanks to all
my friends and colleagues for always being there and supporting me during my work.
9. References
1. Babinet, C., (2000) Transgenic Mice: An Irreplaceable Tool for the Study of
Mammalian Development and Biology. Journal of the American Society of
Nephrology, 11, 88-94.
2. Dimmock, D., Tang, L.Y., Schmitt, E.S., Wong, L.J.C. (2010) Quantitative Evaluation
of the Mitochondrial DNA Depletion Syndrome. Clinical Chemistry 56, 1119–1127.
3. Ekstrand, M.I., Falkenberg, M., Rantanen, A., Park, C.B., Gaspari, M., Hultenby, K.,
Rustin, P., Gustafsson, C.M. and Larsson, N.G. (2004) Mitochondrial transcription
factor A regulates mtDNA copy number in mammals. Human Molecular Genetics, 13,
935–944.
4. Johansson, M., Van Rompay, An. R., Degrève, B., Balzarini, J., Karlsson, A. (1999)
Cloning and Characterization of the Multisubstrate Deoxyribonucleoside Kinase
of Drosophila melanogaster. Journal of Biological Chemistry, 274, 23814 – 23819.
5. Knecht, W., Petersen, G.E., Munch-Petersen, B., Piskur, J. (2002)
Deoxyribonucleoside Kinases Belonging to the Thymidine Kinase 2 (TK2)-like Group
Vary Significantly in Substrate Specificity, Kinetics and Feed-back Regulation.
Journal of Molecular Biology, 315, 529-540.
6. Knecht, W., Rozpedowska, E., Le Breton, C., Willer, M., Gojkovic, Z., Sandrini,
M.P.B., Joergensen, T., Hasholt, L., Munch-Petersen, B., Piskur, J. (2007) Drosophila
deoxyribonucleoside kinase mutants with enhanced ability to phosphorylate purine
analogs. Gene Therapy, 14, 1278–1286.
12
7. Kristensen, T., Jensen, H.J., Munch-Petersen, B., (1996) Quantification of TK1
mRNA in patients with chronic lymphatic leukemia. Advances in Experimental
Medicine and Biology, 370, 23-26.
8. Kumar, D., Viberg, J., Nilsson, A.K. and Chabes, A. (2010) Highly mutagenic and
severely imbalanced dNTP pools can escape detection by the S-phase checkpoint.
Nucleic Acids Research, 38, 3975-3983.
9. Lopez, L.C., Akman, H.O., Garcia-Cazorla, A., Dorado, B., Marti, R., Nishino, I.,
Tadesse, S., Pizzorno, G., Shungu, D., Bonilla, E., Tanji, K. and Hirano, M., (2009)
Unbalanced deoxynucleotide pools cause mitochondrial DNA instability in thymidine
phosphorylase-deficient mice. Human Molecular Genetics, 18, 714-722.
10. Mandel, H., Szargel, R., Labay, V., Elpeleg, O., Saada, A., Shalata, A., Anbinder, Y.,
Berkowitz, D., Hartman, C., Barak, M., Eriksson, S., Cohen, N. (2001) The
deoxyguanosine kinase gene is mutated in individuals with depleted hepatocerebral
mitochondrial DNA. Nature Genetics 29, 337–341.
11. Munch-Petersen, B., Knecht, W., Lenz, C., Søndergaard, L., Piskur, J. (2000)
Functional Expression of a Multisubstrate Deoxyribonucleoside Kinase from
Drosophila melanogaster and Its C-terminal Deletion Mutants. The Journal Of
Biological Chemistry, 275, 6673–6679.
12. Saada, A., Shaag, A., Mandel, H., Nevo, Y., Eriksson, S., Elpeleg, O. (2001) Mutant
mitochondrial thymidine kinase in mitochondrial DNA depletion myopathy. Nature
Genetics 29, 342–344.
13. Solaroli, N., Bjerke, M., Amiri, M.H., Johansson, M., Karlsson, A. (2003) Active site
mutants of Drosophilla melanogaster multisubstrate deoxyribonucleoside kinase. Eur.
J. Biochem, 270, 2879-2884.
14. Solaroli, N., Johansson, M., Balzarini, J., Karlsson, A., (2007a) Enhanced toxicity of
purine nucleoside analogs in cells expressing Drosophila melanogaster nucleoside
kinase mutants. Gene Therapy, 14, 86–92.
15. Solaroli, N., Zhend, X., Johansson, M., Balzarini, J., Karlsson, A. (2007b)
Mitochondrial Expression of the Drosophila melanogaster Multisubstrate
Deoxyribonucleoside Kinase. Mol Pharmacol, 72, 1593–1598.
16. Wang, L. and Eriksson, S. (2010) Tissue Specific Distribution of Pyrimidine
Deoxynucleoside Salvage Enzymes Shed Light on the Mechanism of Mitochondrial
DNA Depletion. Nucleosides, Nucleotides and Nucleic Acids, 29, 400 – 403.
17. Wang, L., (2010) Deoxynucleoside Salvage Enzymes and Tissue Specific
Mitochondrial DNA Depletion. Nucleosides, Nucleotides and Nucleic Acids, 29, 370381.
18. Zegerman, P. and Diffley, J.F., (2009) DNA replication as a target of the DNA
damage checkpoint. DNA Repair, 8, 1077-1088.
19. Zheng, X., Johansson, M., Karlsson, A., (2000) Retroviral Transduction of Cancer
Cell Lines with the Gene Encoding Drosophila melanogaster Multisubstrate
Deoxyribonucleoside Kinase. The Journal of Biological Chemistry, 275, 39125–
39129.
20. Zheng, X., Johansson, M., Karlsson, A., (2001) Bystander Effects of Cancer Cell
Lines Transduced with the Multisubstrate Deoxyribonucleoside Kinase of Drosophila
melanogaster and Synergistic Enhancement by Hydroxyurea. Molecular
Pharmacology, 60, 262-266.
21. Zhou, X., Johansson, M., Solaroli, N., Rozell, B., Grandien, A., Karlsson, A., (2010)
Hematopoiesis in the thymidine kinase 2 deficient mouse model of mitochondrial
DNA depletion syndrome. Journal of Inherited Metabolic Disorders, 33, 231–236.
13