Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Review for Bio EOC 2013 Study hard Difficult concepts!!!!! Which of the following is NOT an example of a heterotroph? •mushroom •Grass •Leopard •human Look at Figure 8-1. All of the following are parts of an ADP molecule EXCEPT structure A structure C structure B structure D Figure 8-1 Which structures shown in Figure 8-1 make up an ATP molecule? A and B A, B, C, and D Figure 8-1 A, B, and C C and D Energy is released from ATP when • • • • a phosphate group is added ATP is exposed to sunlight. adenine bonds to ribose. a phosphate group is removed. Which of the following is an autotroph? •Mushroom •Dog •Monkey •tree In Figure 8-1, between which parts of the molecule must the bonds be broken to form an ADP molecule? A and B C and D B and C all of the above Figure 8-1 Most plants appear green because chlorophyll • does not absorb green light. • absorbs green light. • reflects violet light. • none of the above The light-collecting units of a chloroplast are the • Electron carriers. • stroma. • photosystems. • high-energy sugars. What are the products of the lightdependent reactions? •oxygen gas •NADPH •ATP •all of the above Which of the following are used in the overall reactions for photosynthesis? •carbon dioxide •Light •Water •all of the above A granum is a(an) • • • • stack of chloroplasts membrane enclosing a thylakoid stack of thylakoids. photosynthetic pigment molecule. Which step is the beginning of photosynthesis? • Pigments in photosystem I absorb light. • Pigments in photosystem II absorb light. • High-energy electrons move through the electron transport chain. • ATP synthase allows H+ ions to pass through the thylakoid membrane. If carbon dioxide is removed from a plant’s environment, what would you expect to happen to its production of high-energy sugars? • More sugars will be produced. • No sugars will be produced. • The same number of sugars will be produced but without carbon dioxide. • Carbon dioxide does not affect the production of high-energy sugars in plants. Organisms that cannot make their own food and must obtain energy from the foods they eat are called • autotrophs. • thylakoids. • heterotrophs. • plants. Organisms, such as plants, that make their own food are called •autotrophs. •thylakoids. •heterotrophs. •pigments. Plants gather the sun’s energy with light-absorbing molecules called •pigments. •chloroplasts. •thylakoids. •glucose. The Calvin cycle is another name for • light-independent reactions. • light-dependent reactions. • photosynthesis. • all of the above Plants take in the sun’s energy by absorbing •high-energy sugars. •Chlorophyll. •chlorophyll a. •sunlight. If you continue to increase the intensity of light that a plant receives, what happens? • The rate of photosynthesis increases with light intensity. • The rate of photosynthesis decreases with light intensity. • The rate of photosynthesis increases and then levels off. • The rate of photosynthesis does not change. Photosynthesis uses sunlight to convert water and carbon dioxide into • oxygen. • ATP and oxygen. • high-energy sugars. • oxygen and high-energy sugars. Which of the following is NOT a stage of cellular respiration? •Calvin cycle •Glycolysis •electron transport •Krebs cycle What is a product of the Calvin cycle? •oxygen gas •high-energy sugars •ATP •carbon dioxide The starting molecule for glycolysis is •ADP. •citric acid. •pyruvic acid. •glucose. Which of the following affects the rate of photosynthesis? •Water •light intensity •Temperature •all of the above All of the following are sources of energy during exercise EXCEPT • stored ATP. • lactic acid fermentation. • alcoholic fermentation. • cellular respiration. What are the reactants in the equation for cellular respiration? • oxygen and lactic acid • glucose and oxygen • carbon dioxide and water • water and glucose Which process is used to produce beer and wine? •lactic acid fermentation •alcoholic fermentation •Glycolysis •the Krebs cycle One cause of muscle soreness is • alcoholic fermentation. • lactic acid fermentation. • glycolysis. • the Krebs cycle. Aerobic cellular respiration uses one molecule of glucose to produce •2 ATP molecules. •36 ATP molecules. •12 ATP molecules. •100 ATP molecules. Photosynthesis is to chloroplasts as cellular respiration is to •chloroplasts. •mitochondria. •cytoplasm. •nucleus. Which process does NOT release energy from glucose? •Glycolysis •Fermentation •Photosynthesis •cellular respiration Plants cannot release energy from glucose using •glycolysis. •the Krebs cycle. •photosynthesis. •cellular respiration. Cellular respiration releases energy by breaking down •food molecules. •carbon dioxide. •ATP. •water. Which of the following is released during cellular respiration? •Oxygen •Energy •Air •lactic acid Lactic acid fermentation occurs in • bread dough. • any environment containing oxygen. • muscle cells. • mitochondria. Which of these is a product of cellular respiration? •Oxygen •Glucose •Water •all of the above The two main types of fermentation are called • alcoholic and aerobic. • alcoholic and lactic acid. • aerobic and anaerobic. • lactic acid and anaerobic. Aerobic cellular respiration is called an aerobic process because it requires •light. •oxygen. •exercise. •glucose. In the presence of oxygen, glycolysis is followed by • Lactic acid fermentation. • photosynthesis. • alcoholic fermentation. • the Krebs cycle. The products of photosynthesis are the • products of cellular respiration. • products of glycolysis. • reactants of cellular respiration. • reactants of fermentation. Unlike photosynthesis, cellular respiration occurs in •animal cells only. •all but plant cells. •plant cells only. •all eukaryotic cells. Pathway A represents which type of cellular respiration? • • • • aerobic cellular respiration alcoholic fermentation lactic acid fermentation Photosynthesis • Pathway A Glucose Pyruvic acidLactic acid + 2 ATP • Pathway B Glucose Pyruvic acid Carbon dioxide + Ethyl alcohol + 2 ATP • Pathway C Glucose Pyruvic acid Carbon dioxide +Water+36 ATP The energy of the electrons passing along the electron transport chain is used to make •lactic acid. •alcohol. •citric acid. •ATP. Pathway B represents which type of cellular respiration? • • • • aerobic cellular respiration alcoholic fermentation lactic acid fermentation Photosynthesis • Pathway A Glucose Pyruvic acidLactic acid + 2 ATP • Pathway B Glucose Pyruvic acid Carbon dioxide + Ethyl alcohol + 2 ATP • Pathway C Glucose Pyruvic acid Carbon dioxide +Water+36 ATP Pathway C represents which type of cellular respiration? • aerobic cellular fermentation • alcoholic fermentation • lactic acid fermentation • Photosynthesis • Pathway A Glucose Pyruvic acidLactic acid + 2 ATP • Pathway B Glucose Pyruvic acid Carbon dioxide + Ethyl alcohol + 2 ATP • Pathway C Glucose Pyruvic acid Carbon dioxide +Water+36 ATP • Pathway A • Glucose Pyruvic acidLactic acid + 2 ATP • Pathway B • Glucose Pyruvic acid Carbon dioxide + Ethyl alcohol + 2 ATP • Pathway C • Glucose Pyruvic acid Carbon dioxide +Water+36 ATP Without gas exchange, a plant would be unable to • make food • make minerals • absorb sunlight • absorb water from the soil. Which term below is LEAST closely related to the others? •Fruit •Ovary •seed •cone Living on land required that plants • evolve photosynthetic pigments • conserve water • exchange gases • have cell walls. Which of the following is NOT a characteristic of all plants? •are eukaryotic •produce seeds •have cell walls •are multicellular Plants use the energy of sunlight to • exchange gases with the atmosphere • carry out cellular respiration • take in water from the soil • carry out photosynthesis. Xylem and phloem are NOT •transport subsystems •present in bryophytes •vascular tissues •present in ferns. Which of the following includes all the others? •Xylem •Phloem •vascular tissue •tracheids A monocot is an angiosperm that has •a taproot •one seed leaf •branched veins •two seed leaves. Which of the following includes a plant embryo, a food supply, and a protective covering? • pollen grain • Seed • Spore • gametophyte Ground tissue is found in plant • stems only • roots and stems only • stems and leaves only • roots, stems, and leaves. Which of the following should a student examine under a compound microscope to observe cell division? • epidermis of a leaf • xylem from a tree trunk • tip of a shoot • phloem from the leaf of a plant The vascular cylinder of a root consists of • xylem only. • phloem only. • xylem and phloem. • xylem, phloem, and ground tissue. Angiosperms produce seeds inside protective structures called •pollen grains •Ovaries •Cones •petals. Root pressure • causes a plant’s roots to absorb water. • forces the water in xylem downward. • is produced in the cortex of the root. • is produced in the vascular cylinder by active transport. If some of the xylem of a young oak tree was destroyed, it would most likely interfere with the tree’s ability to • conduct sugars to the roots • absorb carbon dioxide from the air • absorb sunlight • conduct water to the leaves. Most of the photosynthetic activity in plants takes place in the •mesophyll. •guard cells. •stomata. •xylem. Which of the following is the only tissue that produces new plant cells? •meristematic tissue •ground tissue •phloemd •xylem The stomata of leaves are usually open in • light if a plant has enough water. • light if a plant has too little water. • darkness if a plant has enough water. • darkness if a plant has too little water. Water will move higher in a narrow glass tube than in a wide glass tube because of •adhesion only. •pressure. •capillary action. •cohesion only. A seed plant is anchored in the ground by its •stems. •leaves. •roots. •trichomes. Vascular tissue in plants consists of • meristem. • parenchyma and collenchyma cells. • xylem and phloem. • epidermal cells. A carrot is a(an) •taproot. •monocot. •fibrous root. •extensive root system. Minerals from the soil move into roots by •diffusion. •active transport. •transpiration. •root pressure. Seeds dispersed by animals typically are contained in •fleshy, nutritious fruits. •buoyant structures. •cones. •lightweight structures. One of the main functions of stems is to • carry out photosynthesis. • transport substances between roots and leaves. • store carbohydrates. • store water. The attraction of water molecules to other molecules is called •adhesion. •capillary action. •cohesion. •transpiration pull. The seed type shown in Figure 245 that is generally dispersed by animals is(are) Through which plant cells does water move by capillary action? •phloem cells •mesophyll cells •guard cells •xylem cells A seed that is dispersed to an area far away from the parent plant might face less •Alternation •germination. •pollination. •competition. The sterile leaves of a flower are the •carpel and stamens. •stigma and style. •filaments and anthers. •sepals and petals. Corn, sugar beets, cauliflower, and cabbage were all developed by •plant propagation. •pollination. •germination. •selective breeding. Pollen grains are produced by • male reproductive structures. • ovules. • female reproductive structures. • flowers. The early growth stage of a plant embryo is called •fertilization. •germination. •dormancy. •pollination. A ripened ovary that contains seeds is called a(an) •embryo. •fruit. •ovule. •vegetable. Seeds that are dispersed by wind and water typically are •lightweight. •nutritious. •large. •sweet and fleshy. Most people in the world depend on food crops such as • sugar beets, cabbage, and broccoli. • strawberries, chilies, and avocadoes. • wheat, rice, and corn. • apples, grapes, and strawberries. RNA Contains the Sugar • • • • • Ribose Deoxyribose Glucose Lactose Ribose Unlike DNA, RNA Contains • • • • • Adenine Uracil Phosphate groups Thymine Uracil Which of the following are found in both DNA and RNA • • • • • A.Ribose, phosphates groups, adenine B.Deoxyribose, phosphate groups, guanine C.Phosphate groups, guanine, cytosine D.Phosphate groups, guanine, thymine C What is the indicator for RNA • • • • • Uracil Guanine Cytosine Adenine Uracil Which of the following is true • • • • • RNA is usually single stranded DNA is usually single stranded DNA contains uracil RNA contains thymine A Which type of RNA brings info in the genetic code from the nucleus to other parts of the cell • • • • • rRNA tRNA mRNA RNA polymerase mRNA Which molecules are involved in protein synthesis • • • • • tRNA, introns, mutagens mRNA, introns, mutagens rRNA, tRNA, mutagens mRNA, tRNA, rRNA D From which molecules are mRNA molecules transcribed • • • • • tRNA rRNA DNA Proteins C What is produced during transcription • • • • • RNA DNA RNA polymerase Proteins A How many nucleotides are needed to specify 3 amino acids • • • • • 3 6 9 12 9 What happens during translation • • • • • mRNA is made from DNA code The cell uses a mRNA code to make proteins tRNA is made from mRNA code Copies of DNA molecules are made B Which of the following terms is LEAST closely related to the others • • • • • Spindle fiber tRNA Polypeptide Anticodon A During translation, the type of amino acid that is added to the growing polypeptide depends on the • Codon on the mRNA and anticodon on the rRNA • Anticodon on the mRNA and the anticodon on the tRNA • Anticodon on the rRNA and the codon on the mRNA • Codon on the mRNA and the anticodon on the tRNA • D A protein is being assembled when • • • • • DNA is being translated RNA is being transcribed RNA is being translated DNA is being transcribed C Genes contain instructions for assembling • • • • • Operons Nucleosomes Proteins Mutagens C Which is the correct sequence of the transfer of info in most organisms • • • • • Protein to DNA to RNA RNA to DNA to protein DNA to RNA to protein RNA to protein to DNA C In eukaryotes • Transcription takes place in the cytoplasm, translation takes place in the nucleus • Transcription takes place in the nucleus, translation takes place in the cytoplasm • Transcription and translation both take place in the nucleus • Transcription and translation both take place in the cytoplasm • B Most mutations • • • • • Have no effect on organisms Are fatal Are helpful Are harmful A Make the DNA compliment • ATTCGGCATTGCCAT Codon is also • • • • • rRNA tRNA mRNA None mRNA Anticodon is also • • • • • rRNA tRNA mRNA None tRNA Make the mRNA from • TTACCGGACTATCAT When does replication take place • • • • • Mitosis Meiosis Protein synthesis All 3 Mitosis Make a flow chart of replication • DNA…hydrogen bonds split…DNA is copied….2 exact copies Make a flow chart of protein synthesis • DNA…mRNA…tRNS…Amino Acid… Protein Make the complimentary strand • ATTCGGATCCAG Make the tRNA • UGGACCUAGUGGACC Translation is LEAST like • • • • tRNA Protein synthesis mRNA mRNA Transcription is LEAST like • • • • mRNA tRNA DNA tRNA Make the compliment, then the mRNA, then the tRNA • AGGCATTAGCGAATTTAGCCC Which cell structure contains the cell’s genetic material and controls many of the cells activities? • • • • Organelle Nucleus Cell envelope cytoplasm Cells fall into two broad categories, depending on whether they • • • • Have a cell wall Contain chloroplasts Have a nucleus Contain genetic material Eukayotes usually contain: • • • • Genetic material Specializec organelles A nucleus All of the above Which of the following is NOT found in the nucleus? • • • • Nucleolus chromatin Cytoplasm DNA Which structures carry out cell movement? • • • • Chromosomes Microtubules and microfilaments Nucleolus cytoplasm and ribosomes Which organelle breaks down compounds into small particles that the cell can us? • • • • Golgi apparatus lysosome Endoplasmic reticulum Mitochondrion Which organelle makes proteins using coded instructions that come from the nucleus? • Golgi apparatus • Mitochondrion • Vacuole • Ribosome Which organelle converts the chemical energy stored in food into compounds that are more convenient for the cell to use? • • • • Mitochondria Endoplasmic reticulum Golgi apparatus chloroplast Which of the following is a function of the cell membrane? • Breaks down lipids, carbohydrates, and proteins from foods • Regulates which materials enter and leave the cell • Keeps the cell wall in place • Stores water, salt, proteins and carbohydrates Diffusion occurs because: • Molecules constantly move and collide with one another • Molecules never move or collide with one another • The concentration of a solution is never the same throughout a solution • The concentration of a solution is always the same throughout a solution. An animal cell that is surrounded by fresh water will burst because the osmotic pressure causes • • • • Water to move into the cell Water to move out of the cell Solutes to move into the cell Solutes to move out of the cell The cells of multicellular organisms are: • Not dependent on one another • Specialized to perform particular functions • simpler than those of unicellular organisms • Smaller than those of unicellular organisms. Who was the first person to identify and see cells? • • • • Anton van Leeuwenhoek Matthias Schleinden Robert Hooke Rudolf Virchow The thin, flexible barrier around a cell is called the • • • • Cell wall Cell envelope Cytoplasm Cell membrane Prokaryotes lack •Cytoplasm •A nucleus •Genetic material •A cell membrane Which of the following contain a nucleus? •Bacteria •Organelles •Eukaryotes •Prokaryotes The main function of a cell wall is to • Store DNA • Support and protect the cell • Direct the activities of the cell • Help the cell move Which of the following is a function of the nucleus? • • • • Controls most of the cell’s processes Contains information to make proteins Stores DNA All of the above Which of the following is a function of the cytoskeleton? • Contains DNA • Helps keep the cell in shape • Surrounds the cell • Helps make proteins Which of the following is an organelle found in the cytoplasm? • • • • Ribosome Nucleolus Chromatin Cell wall Which organelle would you expect to find in a plant cells? Mitrochondria Chloroplast Ribosome Smooth endoplasmic reticulum Which of the following structures serves as the cell’s boundary from its environment? • Chloroplast • Channel proteins • Cell membrane • Mitochondrion Diffusion is the movement of particles from • An area of low concentration to an area of high concentration • An area of equilibrium to an area of high concentration • An area of high concentration to an area of low concentration • All of the above The diffusion of water across a selectively permeable membrane is called • Osmosis • Osmotic pressure • Facilitated diffusion • Active transport Which term refers to cells having different tasks in an organism? •Multicellular •Cell specialization •Unicellular •Levels of organizaton Mathching: Know the functions of these organelles: • • • • • Nuclueus Mitochondria Free ribosomes Vacuole Endoplasmic reticulum • nuceolus • Golgi apparatus • Chloroplast • Centrioles • Lysome • Cytoskeleton • Cell wall Answers to matching • Assembles proteins • Powerhouse: creates energy • Storage • janitor: contains enzymes for digestion • Assembles lipid components of cell membrane • Formation of ribosomes • Capture energy from the sun • Maintain shape • Organize cell division • Modify, sort, and package proteins • Provide support and protection for plant cell • Contains genetic material for cell instructions. As a Cell Becomes Larger, its • Volume increases faster than its surface area • Surface area increases faster than its volume • Volume increases, but its surface area stays the same • Surface area stays the same, but its volume increases All of the following are problems that growth causes EXCEPT • • • • DNA overload Excess O2 Obtaining enough food Expelling wastes When during the cell cycle are chromosomes visible? • • • • Only during Interphase Only when they are replicated Only during M phase (mitosis) Only during G1 phase Which pair is correct? • • • • G1 phase, DNA replication G2 phase, preparation for mitosis S phase, cell division M phase (mitosis), cell growth When during the cell cycle is a cells DNA replicated? • • • • G1 G2 S M Which event occurs during Interphase? • • • • Cell growth Centrioles appear Spindle fibers appear Centromeres divide During which phase do the chromosomes line up along the middle? • • • • Prophase Telophase Metaphase anaphase Which represents the right order of Mitosis? • Prophase, metaphase, anaphase, telophase • Interphase, prophase, metaphase, anaphase, telophase • Interphase, prophase, metaphase, teolphase • Prophase, metaphase, anaphase, telophase, cytokinesis What is the role of the spindle during Mitosis? • • • • Helps separate chromosomes Breaks down nuclear envelope Duplicates DNA Divides cell in half The two main stages of cell division • • • • Mitosis, interphase Synthesis, cytokinesis M phase, S phase Mitosis, Cytokinesis Which will stop cells from growing • • • • Contact with other cells Growth factors Cut in the skin Cyclin taken from a cell in mitosis Why would cells in a petri dish stop growing once they have covered the bottom • • • • Cells lack cyclin The petri dish inhibits cell growth Contact with other cells inhibits growth Most cells in petri dishes lack p53 Cancer is a disorder in which some cells have lost their ability to control their • • • • Size Spindle fibers Growth rate Surface area As a cell grows, it • Places more demands on DNA • Uses food and O2 more quickly • Has more trouble moving materials across cell membranes • All of the above Compared with small cells, large cells have more trouble • • • • Dividing Producing daughter cells Moving materials in and out Making copies of DNA The process in which a cell divides into two daughter cells • • • • Cell division Metaphase Interphase mitosis Which of the following happens when a cell divides • Cells volume increases • Becomes more difficult for food and materials to get in • The cell has DNA overload • Each daughter cell receives its own copy of the parent cells DNA Which is a phase in the cell cycle • • • • G1 G2 M All of the above The cell cycle is • Series of events that cells go through as they grow and divide • Period of time between the birth and death of a cell • Time from prophase to cytokinesis • Time it takes for one cell to undergo cytokinesis What is the point in the middle of a chromosome called? • • • • Centromere Centriole Sister chromatid spindle What is a tumor • An accumulation of cyclin • A mass of cells • The rapidly dividing cells found at the site of a wound • A defective p53 gene Information gathered from observing a plant that grows 3 cm over a two-week period results in • • • • • inferences. hypotheses. variables. data. data 162 Scientific hypotheses must be proposed in a way that •ensures that an experiment will be valid. •enables them to be proved valid. •enables them to be tested. •doesn’t contradict previous hypotheses. . . . d . 163 A controlled experiment allows the scientist to isolate and test •a conclusion •several variables. b . •a mass of •a single information. variable. 164 A theory . . . •is always true. •is the opening statement of an experiment. •may be revised or replaced. •is a problem to be solved. 165 Which of the following terms includes all the others? •biologist •botanist •zoologist •ethnologist 166 The basic unit of mass in the International System of Units, or SI, is the . . meter. ounce. liter. gram. 167 The work of scientists begins with . . •create a •perform hypothesis. experiments •observation. •drawing conclusions. 168 A controlled experiment allows the scientist to isolate and test . . •a conclusion. . •a mass of information. . •several variables. •a single variable. 169 Scientists publish the details of important experiments so that . . . . •their work can be repeated. •their experimental procedures can be reviewed. •others can try to reproduce the results. •all of the above 170 A well-tested explanation that supports a broad range of observations is a(an) •hypothesis •inference. •theory. •controlled experiment . . . . 171 All of the following are characteristics of all living things EXCEPT . . •growth. •reproduction. . . •movement. •use of energy. 172 The process by which organisms keep their internal conditions fairly constant is called . . •homeostasis. •evolution. . •metabolism •photosynthesis 173 In the metric system, the basic unit of length is the . . •centimeter. •millimeter •kilometer. •meter. 174 The space surrounding the nucleus of an atom contains . . •protons. •electrons. . . neutrons. ions. 175 Which of the following makes up a molecule of water? . b . c . d . •one atom of hydrogen and one atom of oxygen •one atom of sodium and one atom of chlorine •one atom of hydrogen and two atoms of oxygen •two atoms of hydrogen and one atom of oxygen 176 Which of the following statements about a compound is true? •The physical and chemical properties of a compound are usually very different from those of the elements from which it is formed. •Only the physical properties of a compound are usually the same as those of the elements from which it is formed. •Only the chemical properties of a compound are usually the same as those of the elements from which it is formed. •The physical and chemical properties of a compound are usually the same as those of the elements from which it is formed. 177 What type of electron is available to form bonds? . . valence nucleus . . ionic covalent 178 What type of ion forms when an atom loses electrons? . . •neutral •positive . . •negative •possibly positive or negative 179 Ice floats on water because •of •water cohesion. shrinks when it freezes. •ice has a •water higher expands density than when it water. freezes. . . . . 180 The most abundant compound in most living things is . . •carbon dioxide. •water. . . •sodium chloride. •sugar. 181 When salt is dissolved in water, water is the . . •reactant. •solution. . •solute. •solvent. 182 A substance with a pH of 6 is called . . •an acid. . •a base. . •both an acid and a base. •neither an acid nor a base. 183 A monosaccharide is a . . •carbohydrate. •lipid. . . •nucleic acid. •protein. 184 Which statement is true? . . . . •Simple sugars are made of polysaccharides. •Glycerol is made of fatty acids. •RNA molecules are made of nucleotides. •Amino acids are made of proteins. 185 Enzymes affect the reactions in living cells by changing the . . •products of the reaction. . •speed of the reaction. . •temperature of the reaction. •pH of the reaction. 186 The three particles that make up an atom are . . •protons, neutrons, and isotopes. •neutrons, isotopes, and electrons. c . d . •positives, negatives, and electrons. •protons, neutrons, and electrons. 187 The nucleus is made of •protons and electrons. •electrons and neutrons. •protons and neutrons. . •protons, neutrons, and electrons 188 Water molecules are polar, with • • • • the oxygen side being slightly positive and the hydrogen side being slightly negative. the oxygen and hydrogen sides being slightly positive. the oxygen and hydrogen sides being slightly negative. the oxygen side being slightly negative and the hydrogen side being slightly positive. 189 Solutions that contain concentrations of H+ ions lower than pure water •have pH values below 7. •are acids. •are bases. •are enzymes. 190 Which of the following organic compounds is the main source of energy for living things? •carbohydrates •nucleic acids •lipids •proteins 191 What is the term used to describe the energy needed to get a reaction started? •adhesion energy •activation energy c . d . •cohesion energy •chemical energy 192 A substance that speeds up the rate of a chemical reaction is called a(an) •catalyst. •lipid. c . d . •molecule. •element. 193 Which of the following was NOT characteristic of Earth before the oceans formed? •volcanic activity •bombardment by comets and asteroids •an atmosphere of poisonous gases •an atmosphere containing oxygen gas 194 Two gases that probably existed in Earth’s early atmosphere are •oxygen and hydrogen sulfide. •water vapor and oxygen. •oxygen and carbon monoxide. •hydrogen cyanide and carbon monoxide. 195 What prevents organic molecules from forming on their own and remaining intact today? •Earth is too hot. •Atmospheric oxygen is too reactive. •The necessary building blocks no longer exist. •There is no energy source available. 196 One necessary condition for the evolution of the first life on Earth was •the presence of DNA. •abundant oxygen in the atmosphere. •the presence of photosynthetic organisms. •the presence of liquid water. 197 What was the response of the various groups of early organisms that existed when oxygen levels rose in the atmosphere? •Some life forms became extinct. •Some life forms survived in only a few airless habitats. •Some life forms evolved metabolic pathways that used oxygen for respiration. •all of the above 198 In addition to hydrogen, two of the gases used in Miller and Urey’s experiment were •nitrogen and carbon monoxide. •hydrogen cyanide and oxygen. •methane and ammonia. •carbon dioxide and hydrogen sulfide. 199 What do proteinoid microspheres have in common with cells? •They can •They contain store and RNA. release energy. •They contain •They are DNA. communities of organisms. 200 When oxygen was first released in the early seas, it combined with iron to form •RNA. •DNA. •proteins. •rust. 201 The first organisms on Earth were most like today’s •bacteria. •eukaryotes. •multicellular organisms. •DNA molecules. 202 Lipid molecules are composed of : •carbon and hydrogen •carbon and nitrogen •hydrogen and nitrogen •hydrogen and oxygen 203 Three common categories of lipids are •fatty acids, triglycerides, and amino acids •fatty acids, triglycerides, and phospholipids : •triglycerides, phospholipids, and monosaccharides •fatty acids, triglycerides, nucleotides 204 The main component found is the cell membranes is: •carbohydrate •lipid •nucleic acid •protein 205 The building block structure of proteins are: •nucleotides •phospholipids •monosaccharides •amino acids 206 Protein functions in living organisms as •control the rate of chemical reactions •structure of bone and muscle •c•regulation . and transport •d•all of the . above 207 : Refer to Figure 2-1 to answer the following question: Which of the following is the strongest acid? •hydrochloric acid •sodium hydroxide •pure water •sea water 208 Refer to figure 2-1 to answer the following question: Which of the following is the strongest base? •hydrochloric •pure water acid •sodium •rainwater hydroxide 209 Refer to Figure 2-1 to answer the following question: Which of the following is considered neutral? •rainwater •hydrochloric acid •tomatoes •pure water 210 What does pH represent? •the amount of oxygen in a solution •the amount of carbon in a solution •the amount of hydrogen in a solution •the amount of water in a solution 211 The sulfur and nitrogen compounds in smog combine with water to form •ozone. •acid rain. •Ammonia. •chlorofluorocarbons. An organism that uses energy to produce its own food supply from inorganic compounds is called a(an) • heterotroph. • detritivore. • consumer. • autotroph. Which of the following descriptions about the organization of an ecosystem is correct? • Communities make up species, which make up populations. • Populations make up species, which make up communities. • Species make up communities, which make up populations. • Species are grouped in populations, which make up communities. The simplest grouping of more than one kind of organism in the biosphere is a(an) • population. • ecosystem. • community. • species. A snake that eats a frog that has eaten an insect that fed on a plant is a •first-level producer. •second-level producer. •first-level consumer. •third-level consumer. The algae at the beginning of the food chain in Figure 3-1 are consumers. producers. decomposers. heterotrophs. What animals eat both producers and consumers? •Herbivores •chemotrophs •Omnivores •autotrophs Only 10 percent of the energy stored in an organism can be passed on to the next trophic level. Of the remaining energy, some is used for the organism’s life processes, and the rest is • used in reproduction. • stored as fat. • stored as body tissue. • eliminated as heat. Carbon cycles through the biosphere in all of the following processes EXCEPT • photosynthesis. • respiration. • transpiration. • decomposition. The movements of energy and nutrients through living systems are different because • energy flows in one direction and nutrients recycle. • energy is limited in the biosphere and nutrients are always available. • nutrients flow in one direction and energy recycles. • energy forms chemical compounds and nutrients are lost as heat. The branch of biology dealing with interactions among organisms and between organisms and their environment is called •Economy. •recycling. •modeling. •ecology. What is the original source of almost all the energy in most ecosystems? •Carbohydrates •Water •Sunlight •carbon Organisms that obtain nutrients by breaking down dead and decaying plants and animals are called •decomposers. •autotrophs. •omnivores. •producers. The total amount of living tissue within a given trophic level is called the •organic mass. •energy mass. •trophic mass. •biomass. The repeated movement of water between Earth’s surface and the atmosphere is called •the water cycle. •precipitation. •the condensation cycle. •evaporation. Organisms need nutrients in order to • utilize hydrogen and oxygen. • recycle chemical compounds. • carry out essential life functions. • carry out nitrogen fixation. Earth has three main climate zones because of the differences in latitude and • amount of solar energy received. • ocean currents. • angle of heating. • prevailing winds. The unequal heating of Earth’s surface • drives wind and ocean currents. • causes winds that transport heat throughout the biosphere. • has important effects on Earth’s climate regions. • all of the above Which is a biotic factor that affects the size of a population in a specific ecosystem? • average temperature of the ecosystem • type of soil in the ecosystem • number and kinds of predators in the ecosystem • concentration of oxygen in the ecosystem The chemistry of aquatic ecosystems is determined by the • amount of salts, nutrients, and oxygen dissolved in the water. • number of other organisms present in the water. • amount of rainfall the water receives. • biotic and abiotic factors in the water. Each of the following is an abiotic factor in the environment EXCEPT •plant life. •rainfall. •soil type. •temperature. Which is NOT an adaptation that organisms have for living in flowing water? •Hooks •streamlined bodies •Tentacles •suckers Which of the following statements is NOT true about the oceanic zone? • The open ocean has very low levels of nutrients. • Organisms in the deep oceanic zone are exposed to frigid temperatures and total darkness. • The oceanic zone begins at the low-tide mark and extends to the end of the continental shelf. • Most of the photosynthetic activity on Earth occurs in the open ocean within the photic zone. Aquatic ecosystems are classified by all of the following EXCEPT • depth and flow of the water. • temperature of the water. • organisms that live there. • chemistry of the water. The average year-after-year conditions of temperature and precipitation in a particular region is the region’s •weather. •Ecosystem. •latitude. •climate. An organism’s niche is • the way the organism uses the range of physical and biological conditions in which it lives. • all the physical factors in the organism’s environment. • the range of temperatures that the organism needs to survive. • a full description of the place an organism lives. All the interconnected feeding relationships in an ecosystem make up a food •interaction. •network. •Chain. •web. Ponds and lakes are • wetlands. • standing-water ecosystems. • estuaries. • flowing-water ecosystems. As resources in a population become less available, population growth • becomes negative. • increases slowly. • reaches carrying capacity. • enters a phase of exponential growth. Which are two ways a population can decrease in size? • immigration and emigration • increased death rate and immigration • decreased birthrate and emigration • emigration and increased birthrate Which would be least likely to be affected by a density-dependent limiting factor? • a small, scattered population • a population with a high birthrate • a large, dense population • a population with a high immigration rate The photic zone • extends to the bottom of the open ocean. • extends to a depth of about 200 meters. • is deep, cold, and permanently dark. • is where chemosynthetic bacteria are the producers. What can cause a population to grow? • The birthrate becomes higher than the death rate. • The birthrate stays the same, and the death rate increases. • The birthrate becomes lower than the death rate. • The birthrate and the death rate remain the same. When individuals in a population reproduce at a constant rate, it produces a growth pattern called •logistic growth. •demographic growth. •growth density. •exponential growth. If a population grows larger than the carrying capacity of the environment, the • death rate may rise. • population will grow faster. • birthrate may rise. • carrying capacity will change. Which of the following is a densityindependent factor? •Earthquake •Emigration •disease •parasitism Any factor in the environment that causes population growth to decrease is a •carrying capacity. •limiting factor. •limiting nutrient. •growth factor. Which of the following describes the largest number of individuals that an environment can support? •Carrying capacity. •emigration. •immigration. •exponential growth. Each of the following is a densitydependent limiting factor EXCEPT •competition. •crowding. •unusual weather. •disease. An example of a sustainable-use practice is the use of beneficial insects like ladybugs to •harm natural resources. •control unwanted pests. •pollinate plants. •eat unwanted plants. The goals of conservation biology include all of the following EXCEPT • wise management of natural resources. • protection and management of individual species. • preservation of habitats and wildlife. • introducing foreign species into new environments. The major cause of ozone depletion is •nitric acid. •chlorofluorocarbons. •sulfuric acid. •ultraviolet light. Imported plants in Hawaii have • crowded out many native species. • introduced diseases. • reduced the native bird species. • depleted natural resources. •Water can enter the atmosphere through the processes of evaporation and _________________. •How does a food web differ from a food chain?