Download Species - StangBio

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Karyotype wikipedia, lookup

Polyploid wikipedia, lookup

Microevolution wikipedia, lookup

Genome evolution wikipedia, lookup

Hybrid (biology) wikipedia, lookup

Koinophilia wikipedia, lookup

DNA barcoding wikipedia, lookup

Transcript
Speciation
Discussion
 How does a new species arise?
First…what is a species?
 Biological species concept


population whose members can interbreed & produce
viable, fertile offspring
reproductively compatible
Distinct species:
songs & behaviors are different
enough to prevent interbreeding
Eastern Meadowlark Western Meadowlark
But that doesn’t capture every
situation
 Consider
Ensatina
salamanders.
How many
species?
Which ones
are different
species?
Species Definitions
 Other definitions include:



Morphological or typological - They conform to the
same body plan.
Phylogenetic or evolutionary - Share a common
ancestor and a unique evolutionary history.
Ecological - Share a specific niche, unique to them and
them alone.
 “Species” is a human language box. Never forget that
nature exists on a continuum!
Discussion
 Which definitions work or don’t work to
determine whether or not you’re
examining different species if you’re
studying…
Bacteria in a lab petri dish?
 Hooved mammals in the modern-day
arctic?
 Dinosaurs?
 Ancient algae?

How and why do new species originate?
 Species are created by a series of evolutionary
processes

populations become isolated - no gene flow between
them
 geographically isolated and/or
 reproductively isolated

isolated populations
evolve independently
 Isolation

allopatric
 geographic separation

sympatric
 still live in same area
PRE-zygotic barriers
 An obstacle to mating or fertilization
geographic isolation
behavioral isolation
ecological isolation
temporal isolation
mechanical isolation
gametic isolation
Ammospermophilus spp
Geographic isolation
 Species occur in different areas
physical barrier
 allopatric speciation

 “other country”
Harris’s antelope
squirrel inhabits
the canyon’s
south rim (L). Just
a few miles away
on the north rim
(R) lives the
closely related
white-tailed
antelope squirrel
Ecological isolation
 Species occur in same region, but occupy different habitats so rarely
encounter each other

reproductively isolated
2 species of garter snake, Thamnophis,
occur in same area, but one lives in water &
other is terrestrial
lions & tigers could
hybridize, but they
live in different
habitats:
 lions in grasslands
 tigers in rainforest
Temporal isolation
 Species that breed during different times of day, different
seasons, or different years cannot mix gametes


reproductive isolation
sympatric speciation
 “same country”
Eastern spotted skunk
(L) & western spotted
skunk (R) overlap in
range but eastern mates
in late winter & western
mates in late summer
sympatric speciation?
Behavioral isolation
 Unique behavioral patterns & rituals isolate species


identifies members of species
attract mates of same species •
 courtship rituals, mating calls
 reproductive isolation
Blue footed boobies mate
only after a courtship display
unique to their species
Recognizing your
own species
courtship songs of sympatric
species of lacewings
courtship display of
Gray-Crowned Cranes, Kenya
firefly courtship displays
sympatric speciation?
Mechanical isolation
 Morphological differences can prevent successful
mating

reproductive isolation
Plants
Even in closely related
species of plants, the
flowers often have distinct
appearances that attract
different pollinators.
These 2 species of monkey
flower differ greatly in
shape & color, therefore
cross-pollination does not
happen.
Mechanical isolation
Animals
 For many insects, male &
female sex organs of
closely related species do
not fit together, preventing
sperm transfer

lack of “fit” between sexual organs:
hard to imagine for us… but a big issue for insects with
different shaped genitals!
Damsel fly penises
sympatric speciation?
Gametic isolation
 Sperm of one species may not be able to fertilize eggs of
another species

mechanisms
 biochemical barrier so sperm cannot penetrate egg
 receptor recognition: lock & key between egg & sperm
 chemical incompatibility
 sperm cannot survive in female reproductive tract
Sea urchins release sperm
& eggs into surrounding
waters where they fuse &
form zygotes. Gametes of
different species— red &
purple —are unable to fuse.
POST-zygotic barriers
 Prevent hybrid offspring from
developing into a viable, fertile adult
reduced hybrid viability
 reduced hybrid fertility
 hybrid breakdown

zebroid
sympatric speciation?
Reduced hybrid viability
 Genes of different parent species may
interact & impair the hybrid’s development
Species of salamander
genus, Ensatina, may
interbreed, but most
hybrids do not complete
development & those
that do are frail.
Reduced hybrid fertility
 Even if hybrids are vigorous
they may be sterile

chromosomes of parents may differ in number
or structure & meiosis in hybrids may fail to
produce normal gametes
Mules are vigorous,
but sterile
Horses have 64
chromosomes
(32 pairs)
Donkeys have 62
chromosomes
Mules have 63 chromosomes! (31 pairs)
sympatric speciation?
Hybrid breakdown
 Hybrids may be fertile & viable in first
generation, but when they mate offspring
are feeble or sterile
In strains of cultivated rice,
hybrids are vigorous but
plants in next generation are
small & sterile.
On path to separate species.
Rate of Speciation
 When considering speciation events over
geological time: Does speciation happen
gradually or rapidly, uniformly or
unevenly?

Gradualism
 Charles Darwin
 Charles Lyell

Punctuated equilibrium
 Stephen Jay Gould
 Niles Eldredge
Niles Eldredge
Curator
American Museum of Natural History
Gradualism
 Gradual, constant
divergence over long spans
of time


big changes occur as the
accumulation of many
small ones
events can increase or
decrease speciations
worldwide, but overall
speciation proceeds fairly
regularly
Punctuated Equilibrium
 Rate of speciation is not
constant



Organisms are in
“stasis” for much of
their history, with little or
no change
When speciation occurs,
it tends to be in a rapid
burst
Species undergo rapid
change when they 1st
bud from parent
population
Time
Discussion
 Based upon what you know of
evolutionary history, where do you fall:
gradualism or punctuated equilibrium
supporter?
Speciation Rates
 Regardless of whether punctuated
equilibrium or gradualism holds,
speciation rates vary by species and
circumstance
Speciation can occur over a scale of
millions of years, or much more rapidly!
 Polyploidy in plants increases
speciation rate to, in some cases, only a
few years

Polyploidy and Hybrid Speciation
 Unlike in animals, in plants, duplicating
the genome (polyploidy) isn’t fatal.
 Plants hybridize more often and more
readily than animals on average
Sometimes in plants, a diploid
hybrid is sterile, but a triploid or
tetraploid hybrid isn’t due to the
mechanisms of chromosome
alignment in their haploid life
phase.
Polyploidy and Hybrid Speciation
 Polyploid offspring may reproduce with other
polyploids, or re-reproduce with a parental
type, or may self-fertilize (oh plants, you so
crazy)
 But by any of the three mechanisms,
polyploids wind up reproductively isolated
from the parental population, but produce
non-sterile offspring = they’re a new
population that evolution will be acting upon!
A new species, in as little as a generation!
Polyploidy and Hybrid Speciation
 This has been observed in species like
the Evening Primrose,
Raphanobrassica, Hemp Nettle, and the
Maidenhair Fern.
Speciation Rates
 In all species, when a new habitat or
new niche becomes available,
speciation rates tend to increase
 Adaptive radiation - ecological &
phenotypic diversity in a rapidly
multiplying lineage
Discussion
 Scientists generally break it down into
two main reasons why this causes a
burst in speciation events. What do
you think they could be?
Speciation Rates
 Ex: Darwin’s finches
 Ex: An explosion in bivalve species
diversity after the loss of brachiopods
in the “Great Dying,” or Permian
extinction 250 mya
Extinction
 But, of course, extinction rates also
fluctuate

Higher in times of environmental stress
% of families
extinct
Million years ago
Discussion
 A population’s ability to respond to
environmental changes is dictated, in
part, by its level of genetic diversity.
 Which do you think is most resistant to
extinction and why: high-geneticdiversity or low-genetic-diversity?
Lines of Evidence
Morphological,
Molecular, and Other
Lines of Evidence
 Modes of investigation into evolutionary
history include






Morphological
Molecular
Developmental (which is part Morphology, part
Molecular Biology)
Geographical*
Geological*
Active change
 * - Not addressed in notes - read up on basic
definition of biogeography, fossil record at home
Discussion
 What is the relationship between:
Recency of two populations’ last
common ancestor
 Amount of similarity between
populations
 Degree of relatedness between
populations

 …and WHY?
Morphological Evidence
 Morphology = body form
 Shared deep body structures are
evidence of shared ancestry, but
appearances and functions aren’t
necessarily… why not?
Anatomical record
 Homologous structures

similarities in characteristics resulting
from common ancestry
Homologous structures
 Similar structure
 Similar development
 Different functions
 Evidence of evolutionary
relationship
Homologous structures
spines
leaves
succulent leaves
needles
colored leaves
tendrils
Homologous Structures
 Produced by divergent evolution
Your typical “population divided,
evolves in two separate directions”
scenario
 Structure present in ancestor passed
down to descendents

Analogous structures
 Separate evolution of structures
similar functions
 similar external form
 different internal structure &
development
 different origin
 no evolutionary relationship

Solving a similar problem with a similar solution
Analogous Structures
 Flight evolved in 3 separate animal groups

evolved similar “solution” to similar “problems”
Analogous Structures
 Fish: aquatic vertebrates
 Dolphins: aquatic mammals
similar adaptations to
life in the sea
 not closely related

Those fins & tails
& sleek bodies are
analogous structures!
Analogous Structures
 Analogous structures produced by
convergent evolution or parallel
evolution

Convergent evolution: Two
separate, asynchronous (different
times, different ecospaces)
evolutionary lineages develop a
similar trait/solution
 Example: pillbugs and pillmillipedes
both develop similar defenses, but
didn’t inherit them from a so-defended
shared ancestor
Parallel Evolution
 Like convergent evolution, but the two species evolve at
the same time and/or in the same ecospace

filling similar ecological roles in similar environments, so
similar adaptations were selected
marsupial
mammals
placental
mammals
Vestigial structures
 Modern structures that have reduced or no
function


remnants of structures that were functional in
ancestral species
deleterious mutations accumulate in genes for
non-critical structures without reducing fitness
 eyes on blind cave fish

are a kind of homology
Vestigial organs
 Hind leg bones on whale fossils and
modern whales
Why would whales
have pelvis & leg bones
if they were always
sea creatures?
Vestigial structures
 Spurs or tiny leg bones in snakes
Vestigial structures
 Arrector pili, post-caudal tail, appendix
in humans
Molecular Evidence
 Evidence from genes & proteins
 The most powerful and commonly-used
these days, in part because the data set
is so vast and in part because it’s easily
quantifiable
“Conservation”
 What does it mean to say a
homologous sequence or structure is
“highly conserved?”
Means it’s extremely similar or identical
amongst the organisms that inherited it
 Conserved sequences = useful
evidence in uncovering ancestry

Conserved Structures
 Example, metabolic pathways = highly
conserved across all domains of life
(archaea, bacteria, eukarya)
 A remnant of life’s common ancestry
Bacterial
metabolic
enzymes notice, more
of them are
common to all
3 domains
than are at all
unique
Conserved Structures
 Example: Structural evidence supports
the relatedness of all eukaryotes

More than just the nucleus is
conserved… linear chromosomes,
membrane-bound organelles, and
endomembrane systems are as well
Molecular record
 Molecular evidence elegantly demonstrates the
relatedness of all life

universal genetic code! The ultimate “conserved
sequence” - the whole darned thing!
 DNA, RNA, proteins - genome, transcriptome, proteome
Closely related species have
sequences that are more similar
than distantly related species
 DNA & proteins are a molecular
record of evolutionary relationships
Discussion
 “The more similar genetic loci two
populations share, the more related
they are”
 WHY would this be??
Conserved Sequences
 Think of a conserved sequence (which
can be as little as a single base pair) as
being a genetic homologous structure
Conserved Sequences
 Suppose an ancestral population has
the sequence
 AAGTCTTTAGCTAGCTGGCTGT
 at a particular locus.
 Over time, it accumulates mutations.
Demo!
AAGTCTTTAGCTAGCTGGCTGT
AAGTCTTTATCTAGCTGGCTGT
AGGTCTTTATCTAGCTGGCTGT
AAGTCTTTATCTAGCTGGCTGG
P
AAATCTTTAGCTAGCTGGCTGT
F1
AAATCTTTAGCTAGCTGTCTGT
F2
AAATATTTAGCTAGCTGGCTGT
AAATCCTTAGCTAGCTGTCTGT
CAGTCTTTATCTAGCTGGCTGG
AAGTCTTTATCTAGCTGGGTGG
AAATCTCTAGCTAGCTGTCTGT
F3
AAATATTTCGCTAGCTGGCTGT
AAATATTTAGCCAGCTGGCTGT
What % of DNA do these two share?
Are they closely related?
What % of DNA do these two share?
Are they closely related?
Can you spot any conserved sequences among the modern (F3) species?
Discussion
 Suppose you have this information for locus
ß135 in three similar species.
 Species A: AGCTTCGATTGCTAGCTA
 Species B: AGCTACGATTGGTAGCTA
 Species C: AGCTACGACCTTGGTAGCTA

Who’s most related? Who shares the most
recent LCA?
It works for proteins, too!
Human Macaque
Dog Bird
Frog
Lamprey
32 45
67
125
Why does comparing
amino acid sequence
measure evolutionary
relationships?
8
0 10 20 30 40 50 60 70 80 90 100 110 120
Number of amino acid differences between
hemoglobin (146 aa) of vertebrate species and that of humans
Molecular Evidence
 An organism’s evolutionary history is
documented in its genome!

How many similarities are shared between
populations?
 DNA hybridization experiments



Track SNPs (single nucleotide
polymorphisms), conserved sequences,
common loci, duplicated genes
Analyze pseudogenes (“vestigial genes”)
Even analyze whole genomes…
Genome sequencing
 What can data from whole
genome sequencing tell us
about evolution of humans?
Primate Common Ancestry
Chromosome Number in
the Great Apes
(Hominidae)
orangutan (Pogo)
gorilla (Gorilla)
chimpanzee (Pan)
human (Homo)
48
48
48
46
Could we have
just lost a pair of
chromosomes?
Hypothesis:
Change in chromosome number?
If these organisms share a common
ancestor, then is there evidence in
the genome for this change in
chromosome number
Chromosomal fusion
Testable prediction:
If common ancestor had 48 chromosomes (24 pairs),
then humans carry a fused chromosome (23 pairs).
Ancestral
Chromosomes
Fusion
Chromosome Number in
the Great Apes
(Hominidae)
orangutan (Pogo)
gorilla (Gorilla)
chimpanzee (Pan)
human (Homo)
Homo sapiens
Inactivated
centromere
Telomere
sequences
48
48
48
46
Centromere
Telomere
Hillier et al (2005) “Generation and Annotation of the DNA
sequences of human chromosomes 2 and 4,” Nature 434: 724 – 731.
Test of the Human Genome
Ancestral
Chromosomes
Fusion
Homo sapiens
Inactivated
centromere
Telomere
sequences
Chr 2
“Chromosome 2 is unique to the human
lineage of evolution, having emerged as a
result of head-to-head fusion of two
chromosomes that remained separate in
other primates. The precise fusion site has
been located in 2q13–2q14.1, where our
analysis confirmed the presence of multiple
subtelomeric duplications to chromosomes
1, 5, 8, 9, 10, 12, 19, 21 and 22. During the
formation of human chromosome 2, one of
the two centromeres became inactivated
(2q21, which corresponds to the centromere
from chimp chromosome 13) and the
centromeric structure quickly deterioriated.”
Human Chromosome #2 shows the exact
point at which this fusion took place
Discussion
 If you want to analyze the evolutionary
history of an order, a phylum, a
kingdom, etc., what kinds of genes do
you think would be most productive to
study?
Molecular Clocks
 Some genes show a constant rate of
umber of mutations
mutation/evolution
 They can be used as molecular clocks and
used to calculate the time since divergence,
calibrated against branches whose dates are
known from the fossil record
90
60
30
0
30
60
90
Divergence time (millions of years)
Molecular Clocks
 Example: Use of molecular clocks
demonstrates that HIV leapt from
simians to humans in the 1930s
Index of base changes between HIV gene sequences
0.20
0.15
HIV
0.10
Range
Adjusted best-fit line
(accounts for uncertain
dates of HIV sequences)
0.05
0
1900
1920
1940
1960
Year
1980
2000
Evo-Devo: Morpho+DNA Evidence
 Comparative embryology reveals
anatomical similarity not visible in adults

Ex: all vertebrate embryos have similar
structures at similar stages of development
 gill pouch in fish, frog, snake, birds, human, etc.
Pharyngeal
pouches
Post-anal
tail
Chick embryo (LM)
Human embryo
Evo-Devo
 Major changes in body form can
Chimpanzee fetus -> adult
result from changes in the
sequences and regulation of
developmental genes


Human fetus -> adult
Genes that program development
control the rate, timing, and spatial
pattern of changes in an organism’s
form as it develops
Ex: A change in the rate of gene
expression produces very different
skulls from the same genes
Evo-Devo
 Ex: A change in spatial expression of
the Hox gene produces body parts in a
new location, without a change in
coding genes
Hox gene 6
Hox gene 7
Hox gene 8
About 400 mya
Drosophila
Artemia
Repeated Hox expression
extends body
Evo-Devo
 Among MANY other evolutionary
applications, these means that modern
organisms have many ancient genes
still in place that can be used to study
the ancestral form

Those genes are just producing
different phenotypes now because of
changes to regulatory sequences
Active Change
 Examples of ongoing change
Artificial selection
 Antibiotic resistance
 Industrial melanism

Artificial selection
 Artificial breeding can use variations in
populations to create vastly different
“breeds” & “varieties”
“descendants” of wild mustard
“descendants” of the wolf
Selective
breeding
the raw genetic
material (variation)
is hidden there
Selective breeding
Hidden variation can
be exposed through
selection!
Antibiotic Resistance
Industrial Melanism
 Classic Peppered Moth study: Dark vs.
light variants
Year
1848
1895
1995
% dark
5
98
19
% light
95
2
81
“Tree Thinking”
Phylogenetics,
Cladistics,
Systematics
“Tree Thinking”
 Phylogeny is the evolutionary history of
a species or group of related species
Systematics uses fossil, molecular, and
morphological data to infer evolutionary
relationships and classify organisms
 Depict these relationships in branching
cladograms or phylogenetic trees

Order
Family Genus
Species
Panthera
Felidae
Panthera
pardus
(leopard)
Taxidea
Lutra
Mustelidae
Carnivora
Taxidea
taxus
(American
badger)
Lutra lutra
(European
otter)
Canis
Canidae
Canis
latrans
(coyote)
Canis
lupus
(gray wolf)
Phylogenetic Trees
 A phylogenetic tree is a hypothesis
about evolutionary relationships
Moves forward in time from the root
 Each branch point represents a shared
common ancestor (usually not labeled)
 Sister taxa represented by the tips of
the branches

Branch point:
where lineages diverge
Taxon A
Taxon B
Taxon C
Sister
taxa
Taxon D
ANCESTRAL
LINEAGE
Taxon E
Taxon F
Taxon G
This branch point
represents the
common ancestor of
taxa A–G.
This branch point forms
an unresolved
pattern of divergence, shared
by taxa D, E, and F.
Discussion – Who is most related? Where’s the LCA?
Lizards
and snakes
Crocodilians
Common
ancestor of
crocodilians,
dinosaurs,
and birds
Ornithischian
dinosaurs
Saurischian
dinosaurs
Birds
Phylogenetic Trees - Limitations &
Rules
 Show patterns of descent,
not phenotypic similarity.
Don’t necessarily indicate
how long ago species
diverged, or how much it’s
changed since then.
 Taxa DID NOT evolve from
any sister taxa!
Cladistics
 Trees are constructed based on
homologies, physical or molecular
 Cladistics groups organisms by
common descent.
A clade = a group of species that
includes an ancestral species and its
descendents
 To be valid, a clade must be
monophyletic - include all descendent
species, and no non-descendents

(a) Monophyletic group (clade)
A
B Group 
C
D
E
F
G
Cladistics
 Invalid clades are


Paraphyletic – Includes the ancestor but
not all of its descendents
Polyphyletic - Includes some species
that do not share the ancestor in
question
(a) Monophyletic group (clade)
(b) Paraphyletic group
(c) Polyphyletic group
A
A
B
B
C
C
C
D
D
D
E
E
F
F
F
G
G
G
A
B
Group 
Group 
E
Group 
Valid Clades
 Are reptiles monophyletic, paraphyletic,
or polyphyletic?
 Should “reptile” be a valid
classification?
Cladistics
 When comparing it to its ancestor, a
species/clade displays various
homologies.
Shared ancestral characters - originated
in an ancestor, shared with all
members.
 Shared derived characters - An
inherited novelty unique to that clade.

Cladistics
 Can use either morphological or
molecular homologies

Generally, a chart with + or 1 for “has
it,” 0 or - for “doesn’t”
 To construct a tree, examine shared
and derived characters, and follow the
principle of parsimony, also called
Occam’s Razor: the simplest
explanation is usually the best.
Lamprey
Bass
Frog
Turtle
Leopard
TAXA
Lancelet
(outgroup)
CHARACTERS
Discussion – Practice!
Vertebral
column
(backbone)
0
1
1
1
1
1
Hinged jaws
0
0
1
1
1
1
Four walking
legs
0
0
0
1
1
1
Amnion
0
0
0
0
1
1
Hair
0
0
0
0
0
1
(a) Character table
Variations
 Cladograms can be constructed to
show time or distance since
divergence, amount of difference…
 Trees can take different shapes: angled
splits, square splits, circular…
Branch lengths indicate time
Drosophila
Lancelet
Zebrafish
Frog
Chicken
Human
Mouse
PALEOZOIC
542
MESOZOIC
251
Millions of years ago
CENOZOIC
65.5
Present
Tree Shapes