* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Species - StangBio
Survey
Document related concepts
Transcript
Speciation Discussion How does a new species arise? First…what is a species? Biological species concept population whose members can interbreed & produce viable, fertile offspring reproductively compatible Distinct species: songs & behaviors are different enough to prevent interbreeding Eastern Meadowlark Western Meadowlark But that doesn’t capture every situation Consider Ensatina salamanders. How many species? Which ones are different species? Species Definitions Other definitions include: Morphological or typological - They conform to the same body plan. Phylogenetic or evolutionary - Share a common ancestor and a unique evolutionary history. Ecological - Share a specific niche, unique to them and them alone. “Species” is a human language box. Never forget that nature exists on a continuum! Discussion Which definitions work or don’t work to determine whether or not you’re examining different species if you’re studying… Bacteria in a lab petri dish? Hooved mammals in the modern-day arctic? Dinosaurs? Ancient algae? How and why do new species originate? Species are created by a series of evolutionary processes populations become isolated - no gene flow between them geographically isolated and/or reproductively isolated isolated populations evolve independently Isolation allopatric geographic separation sympatric still live in same area PRE-zygotic barriers An obstacle to mating or fertilization geographic isolation behavioral isolation ecological isolation temporal isolation mechanical isolation gametic isolation Ammospermophilus spp Geographic isolation Species occur in different areas physical barrier allopatric speciation “other country” Harris’s antelope squirrel inhabits the canyon’s south rim (L). Just a few miles away on the north rim (R) lives the closely related white-tailed antelope squirrel Ecological isolation Species occur in same region, but occupy different habitats so rarely encounter each other reproductively isolated 2 species of garter snake, Thamnophis, occur in same area, but one lives in water & other is terrestrial lions & tigers could hybridize, but they live in different habitats: lions in grasslands tigers in rainforest Temporal isolation Species that breed during different times of day, different seasons, or different years cannot mix gametes reproductive isolation sympatric speciation “same country” Eastern spotted skunk (L) & western spotted skunk (R) overlap in range but eastern mates in late winter & western mates in late summer sympatric speciation? Behavioral isolation Unique behavioral patterns & rituals isolate species identifies members of species attract mates of same species • courtship rituals, mating calls reproductive isolation Blue footed boobies mate only after a courtship display unique to their species Recognizing your own species courtship songs of sympatric species of lacewings courtship display of Gray-Crowned Cranes, Kenya firefly courtship displays sympatric speciation? Mechanical isolation Morphological differences can prevent successful mating reproductive isolation Plants Even in closely related species of plants, the flowers often have distinct appearances that attract different pollinators. These 2 species of monkey flower differ greatly in shape & color, therefore cross-pollination does not happen. Mechanical isolation Animals For many insects, male & female sex organs of closely related species do not fit together, preventing sperm transfer lack of “fit” between sexual organs: hard to imagine for us… but a big issue for insects with different shaped genitals! Damsel fly penises sympatric speciation? Gametic isolation Sperm of one species may not be able to fertilize eggs of another species mechanisms biochemical barrier so sperm cannot penetrate egg receptor recognition: lock & key between egg & sperm chemical incompatibility sperm cannot survive in female reproductive tract Sea urchins release sperm & eggs into surrounding waters where they fuse & form zygotes. Gametes of different species— red & purple —are unable to fuse. POST-zygotic barriers Prevent hybrid offspring from developing into a viable, fertile adult reduced hybrid viability reduced hybrid fertility hybrid breakdown zebroid sympatric speciation? Reduced hybrid viability Genes of different parent species may interact & impair the hybrid’s development Species of salamander genus, Ensatina, may interbreed, but most hybrids do not complete development & those that do are frail. Reduced hybrid fertility Even if hybrids are vigorous they may be sterile chromosomes of parents may differ in number or structure & meiosis in hybrids may fail to produce normal gametes Mules are vigorous, but sterile Horses have 64 chromosomes (32 pairs) Donkeys have 62 chromosomes Mules have 63 chromosomes! (31 pairs) sympatric speciation? Hybrid breakdown Hybrids may be fertile & viable in first generation, but when they mate offspring are feeble or sterile In strains of cultivated rice, hybrids are vigorous but plants in next generation are small & sterile. On path to separate species. Rate of Speciation When considering speciation events over geological time: Does speciation happen gradually or rapidly, uniformly or unevenly? Gradualism Charles Darwin Charles Lyell Punctuated equilibrium Stephen Jay Gould Niles Eldredge Niles Eldredge Curator American Museum of Natural History Gradualism Gradual, constant divergence over long spans of time big changes occur as the accumulation of many small ones events can increase or decrease speciations worldwide, but overall speciation proceeds fairly regularly Punctuated Equilibrium Rate of speciation is not constant Organisms are in “stasis” for much of their history, with little or no change When speciation occurs, it tends to be in a rapid burst Species undergo rapid change when they 1st bud from parent population Time Discussion Based upon what you know of evolutionary history, where do you fall: gradualism or punctuated equilibrium supporter? Speciation Rates Regardless of whether punctuated equilibrium or gradualism holds, speciation rates vary by species and circumstance Speciation can occur over a scale of millions of years, or much more rapidly! Polyploidy in plants increases speciation rate to, in some cases, only a few years Polyploidy and Hybrid Speciation Unlike in animals, in plants, duplicating the genome (polyploidy) isn’t fatal. Plants hybridize more often and more readily than animals on average Sometimes in plants, a diploid hybrid is sterile, but a triploid or tetraploid hybrid isn’t due to the mechanisms of chromosome alignment in their haploid life phase. Polyploidy and Hybrid Speciation Polyploid offspring may reproduce with other polyploids, or re-reproduce with a parental type, or may self-fertilize (oh plants, you so crazy) But by any of the three mechanisms, polyploids wind up reproductively isolated from the parental population, but produce non-sterile offspring = they’re a new population that evolution will be acting upon! A new species, in as little as a generation! Polyploidy and Hybrid Speciation This has been observed in species like the Evening Primrose, Raphanobrassica, Hemp Nettle, and the Maidenhair Fern. Speciation Rates In all species, when a new habitat or new niche becomes available, speciation rates tend to increase Adaptive radiation - ecological & phenotypic diversity in a rapidly multiplying lineage Discussion Scientists generally break it down into two main reasons why this causes a burst in speciation events. What do you think they could be? Speciation Rates Ex: Darwin’s finches Ex: An explosion in bivalve species diversity after the loss of brachiopods in the “Great Dying,” or Permian extinction 250 mya Extinction But, of course, extinction rates also fluctuate Higher in times of environmental stress % of families extinct Million years ago Discussion A population’s ability to respond to environmental changes is dictated, in part, by its level of genetic diversity. Which do you think is most resistant to extinction and why: high-geneticdiversity or low-genetic-diversity? Lines of Evidence Morphological, Molecular, and Other Lines of Evidence Modes of investigation into evolutionary history include Morphological Molecular Developmental (which is part Morphology, part Molecular Biology) Geographical* Geological* Active change * - Not addressed in notes - read up on basic definition of biogeography, fossil record at home Discussion What is the relationship between: Recency of two populations’ last common ancestor Amount of similarity between populations Degree of relatedness between populations …and WHY? Morphological Evidence Morphology = body form Shared deep body structures are evidence of shared ancestry, but appearances and functions aren’t necessarily… why not? Anatomical record Homologous structures similarities in characteristics resulting from common ancestry Homologous structures Similar structure Similar development Different functions Evidence of evolutionary relationship Homologous structures spines leaves succulent leaves needles colored leaves tendrils Homologous Structures Produced by divergent evolution Your typical “population divided, evolves in two separate directions” scenario Structure present in ancestor passed down to descendents Analogous structures Separate evolution of structures similar functions similar external form different internal structure & development different origin no evolutionary relationship Solving a similar problem with a similar solution Analogous Structures Flight evolved in 3 separate animal groups evolved similar “solution” to similar “problems” Analogous Structures Fish: aquatic vertebrates Dolphins: aquatic mammals similar adaptations to life in the sea not closely related Those fins & tails & sleek bodies are analogous structures! Analogous Structures Analogous structures produced by convergent evolution or parallel evolution Convergent evolution: Two separate, asynchronous (different times, different ecospaces) evolutionary lineages develop a similar trait/solution Example: pillbugs and pillmillipedes both develop similar defenses, but didn’t inherit them from a so-defended shared ancestor Parallel Evolution Like convergent evolution, but the two species evolve at the same time and/or in the same ecospace filling similar ecological roles in similar environments, so similar adaptations were selected marsupial mammals placental mammals Vestigial structures Modern structures that have reduced or no function remnants of structures that were functional in ancestral species deleterious mutations accumulate in genes for non-critical structures without reducing fitness eyes on blind cave fish are a kind of homology Vestigial organs Hind leg bones on whale fossils and modern whales Why would whales have pelvis & leg bones if they were always sea creatures? Vestigial structures Spurs or tiny leg bones in snakes Vestigial structures Arrector pili, post-caudal tail, appendix in humans Molecular Evidence Evidence from genes & proteins The most powerful and commonly-used these days, in part because the data set is so vast and in part because it’s easily quantifiable “Conservation” What does it mean to say a homologous sequence or structure is “highly conserved?” Means it’s extremely similar or identical amongst the organisms that inherited it Conserved sequences = useful evidence in uncovering ancestry Conserved Structures Example, metabolic pathways = highly conserved across all domains of life (archaea, bacteria, eukarya) A remnant of life’s common ancestry Bacterial metabolic enzymes notice, more of them are common to all 3 domains than are at all unique Conserved Structures Example: Structural evidence supports the relatedness of all eukaryotes More than just the nucleus is conserved… linear chromosomes, membrane-bound organelles, and endomembrane systems are as well Molecular record Molecular evidence elegantly demonstrates the relatedness of all life universal genetic code! The ultimate “conserved sequence” - the whole darned thing! DNA, RNA, proteins - genome, transcriptome, proteome Closely related species have sequences that are more similar than distantly related species DNA & proteins are a molecular record of evolutionary relationships Discussion “The more similar genetic loci two populations share, the more related they are” WHY would this be?? Conserved Sequences Think of a conserved sequence (which can be as little as a single base pair) as being a genetic homologous structure Conserved Sequences Suppose an ancestral population has the sequence AAGTCTTTAGCTAGCTGGCTGT at a particular locus. Over time, it accumulates mutations. Demo! AAGTCTTTAGCTAGCTGGCTGT AAGTCTTTATCTAGCTGGCTGT AGGTCTTTATCTAGCTGGCTGT AAGTCTTTATCTAGCTGGCTGG P AAATCTTTAGCTAGCTGGCTGT F1 AAATCTTTAGCTAGCTGTCTGT F2 AAATATTTAGCTAGCTGGCTGT AAATCCTTAGCTAGCTGTCTGT CAGTCTTTATCTAGCTGGCTGG AAGTCTTTATCTAGCTGGGTGG AAATCTCTAGCTAGCTGTCTGT F3 AAATATTTCGCTAGCTGGCTGT AAATATTTAGCCAGCTGGCTGT What % of DNA do these two share? Are they closely related? What % of DNA do these two share? Are they closely related? Can you spot any conserved sequences among the modern (F3) species? Discussion Suppose you have this information for locus ß135 in three similar species. Species A: AGCTTCGATTGCTAGCTA Species B: AGCTACGATTGGTAGCTA Species C: AGCTACGACCTTGGTAGCTA Who’s most related? Who shares the most recent LCA? It works for proteins, too! Human Macaque Dog Bird Frog Lamprey 32 45 67 125 Why does comparing amino acid sequence measure evolutionary relationships? 8 0 10 20 30 40 50 60 70 80 90 100 110 120 Number of amino acid differences between hemoglobin (146 aa) of vertebrate species and that of humans Molecular Evidence An organism’s evolutionary history is documented in its genome! How many similarities are shared between populations? DNA hybridization experiments Track SNPs (single nucleotide polymorphisms), conserved sequences, common loci, duplicated genes Analyze pseudogenes (“vestigial genes”) Even analyze whole genomes… Genome sequencing What can data from whole genome sequencing tell us about evolution of humans? Primate Common Ancestry Chromosome Number in the Great Apes (Hominidae) orangutan (Pogo) gorilla (Gorilla) chimpanzee (Pan) human (Homo) 48 48 48 46 Could we have just lost a pair of chromosomes? Hypothesis: Change in chromosome number? If these organisms share a common ancestor, then is there evidence in the genome for this change in chromosome number Chromosomal fusion Testable prediction: If common ancestor had 48 chromosomes (24 pairs), then humans carry a fused chromosome (23 pairs). Ancestral Chromosomes Fusion Chromosome Number in the Great Apes (Hominidae) orangutan (Pogo) gorilla (Gorilla) chimpanzee (Pan) human (Homo) Homo sapiens Inactivated centromere Telomere sequences 48 48 48 46 Centromere Telomere Hillier et al (2005) “Generation and Annotation of the DNA sequences of human chromosomes 2 and 4,” Nature 434: 724 – 731. Test of the Human Genome Ancestral Chromosomes Fusion Homo sapiens Inactivated centromere Telomere sequences Chr 2 “Chromosome 2 is unique to the human lineage of evolution, having emerged as a result of head-to-head fusion of two chromosomes that remained separate in other primates. The precise fusion site has been located in 2q13–2q14.1, where our analysis confirmed the presence of multiple subtelomeric duplications to chromosomes 1, 5, 8, 9, 10, 12, 19, 21 and 22. During the formation of human chromosome 2, one of the two centromeres became inactivated (2q21, which corresponds to the centromere from chimp chromosome 13) and the centromeric structure quickly deterioriated.” Human Chromosome #2 shows the exact point at which this fusion took place Discussion If you want to analyze the evolutionary history of an order, a phylum, a kingdom, etc., what kinds of genes do you think would be most productive to study? Molecular Clocks Some genes show a constant rate of umber of mutations mutation/evolution They can be used as molecular clocks and used to calculate the time since divergence, calibrated against branches whose dates are known from the fossil record 90 60 30 0 30 60 90 Divergence time (millions of years) Molecular Clocks Example: Use of molecular clocks demonstrates that HIV leapt from simians to humans in the 1930s Index of base changes between HIV gene sequences 0.20 0.15 HIV 0.10 Range Adjusted best-fit line (accounts for uncertain dates of HIV sequences) 0.05 0 1900 1920 1940 1960 Year 1980 2000 Evo-Devo: Morpho+DNA Evidence Comparative embryology reveals anatomical similarity not visible in adults Ex: all vertebrate embryos have similar structures at similar stages of development gill pouch in fish, frog, snake, birds, human, etc. Pharyngeal pouches Post-anal tail Chick embryo (LM) Human embryo Evo-Devo Major changes in body form can Chimpanzee fetus -> adult result from changes in the sequences and regulation of developmental genes Human fetus -> adult Genes that program development control the rate, timing, and spatial pattern of changes in an organism’s form as it develops Ex: A change in the rate of gene expression produces very different skulls from the same genes Evo-Devo Ex: A change in spatial expression of the Hox gene produces body parts in a new location, without a change in coding genes Hox gene 6 Hox gene 7 Hox gene 8 About 400 mya Drosophila Artemia Repeated Hox expression extends body Evo-Devo Among MANY other evolutionary applications, these means that modern organisms have many ancient genes still in place that can be used to study the ancestral form Those genes are just producing different phenotypes now because of changes to regulatory sequences Active Change Examples of ongoing change Artificial selection Antibiotic resistance Industrial melanism Artificial selection Artificial breeding can use variations in populations to create vastly different “breeds” & “varieties” “descendants” of wild mustard “descendants” of the wolf Selective breeding the raw genetic material (variation) is hidden there Selective breeding Hidden variation can be exposed through selection! Antibiotic Resistance Industrial Melanism Classic Peppered Moth study: Dark vs. light variants Year 1848 1895 1995 % dark 5 98 19 % light 95 2 81 “Tree Thinking” Phylogenetics, Cladistics, Systematics “Tree Thinking” Phylogeny is the evolutionary history of a species or group of related species Systematics uses fossil, molecular, and morphological data to infer evolutionary relationships and classify organisms Depict these relationships in branching cladograms or phylogenetic trees Order Family Genus Species Panthera Felidae Panthera pardus (leopard) Taxidea Lutra Mustelidae Carnivora Taxidea taxus (American badger) Lutra lutra (European otter) Canis Canidae Canis latrans (coyote) Canis lupus (gray wolf) Phylogenetic Trees A phylogenetic tree is a hypothesis about evolutionary relationships Moves forward in time from the root Each branch point represents a shared common ancestor (usually not labeled) Sister taxa represented by the tips of the branches Branch point: where lineages diverge Taxon A Taxon B Taxon C Sister taxa Taxon D ANCESTRAL LINEAGE Taxon E Taxon F Taxon G This branch point represents the common ancestor of taxa A–G. This branch point forms an unresolved pattern of divergence, shared by taxa D, E, and F. Discussion – Who is most related? Where’s the LCA? Lizards and snakes Crocodilians Common ancestor of crocodilians, dinosaurs, and birds Ornithischian dinosaurs Saurischian dinosaurs Birds Phylogenetic Trees - Limitations & Rules Show patterns of descent, not phenotypic similarity. Don’t necessarily indicate how long ago species diverged, or how much it’s changed since then. Taxa DID NOT evolve from any sister taxa! Cladistics Trees are constructed based on homologies, physical or molecular Cladistics groups organisms by common descent. A clade = a group of species that includes an ancestral species and its descendents To be valid, a clade must be monophyletic - include all descendent species, and no non-descendents (a) Monophyletic group (clade) A B Group C D E F G Cladistics Invalid clades are Paraphyletic – Includes the ancestor but not all of its descendents Polyphyletic - Includes some species that do not share the ancestor in question (a) Monophyletic group (clade) (b) Paraphyletic group (c) Polyphyletic group A A B B C C C D D D E E F F F G G G A B Group Group E Group Valid Clades Are reptiles monophyletic, paraphyletic, or polyphyletic? Should “reptile” be a valid classification? Cladistics When comparing it to its ancestor, a species/clade displays various homologies. Shared ancestral characters - originated in an ancestor, shared with all members. Shared derived characters - An inherited novelty unique to that clade. Cladistics Can use either morphological or molecular homologies Generally, a chart with + or 1 for “has it,” 0 or - for “doesn’t” To construct a tree, examine shared and derived characters, and follow the principle of parsimony, also called Occam’s Razor: the simplest explanation is usually the best. Lamprey Bass Frog Turtle Leopard TAXA Lancelet (outgroup) CHARACTERS Discussion – Practice! Vertebral column (backbone) 0 1 1 1 1 1 Hinged jaws 0 0 1 1 1 1 Four walking legs 0 0 0 1 1 1 Amnion 0 0 0 0 1 1 Hair 0 0 0 0 0 1 (a) Character table Variations Cladograms can be constructed to show time or distance since divergence, amount of difference… Trees can take different shapes: angled splits, square splits, circular… Branch lengths indicate time Drosophila Lancelet Zebrafish Frog Chicken Human Mouse PALEOZOIC 542 MESOZOIC 251 Millions of years ago CENOZOIC 65.5 Present Tree Shapes