Download Evolution - Effingham County Schools

Mutation
A change in a DNA sequence, usually occurring because of errors in
replication or repair. Mutation is the ultimate source of genetic variation .
Gene Flow (Migration)
The chance of an individual
migrating to another population and
sharing it’s genes there.
Genetic Drift
The drift over time of allele
frequencies in a population due to
random sampling effects forming
successive generations.
Natural Selection
A process of evolution in which traits that result in better fitness of an individual
survives to the next generation.
Evolution
Evolution
Over a great period of time evolution can result in the formation of a new
species.
This is called?
Speciation
I. What is Evolution?
A theory stating that things change over
time.
– In Science, evolution refers to the
process in which organisms produce
offspring which are biologically
different than their ancestors, yet are
more capable of surviving and
producing offspring in the
environment.
B. Theory- A theory, in science, is a
widely accepted set of explanations of
observations and phenomena.
Theories
1. Are more than an educated guess
2. Can never be proven, only
disproved.
3. Have evidence that support it.
4. Become more widely accepted
with more evidence supporting them.
What is it?
A theory stating that things change
over time.
– In Science, evolution refers to the
process in which organisms
produce offspring which are
biologically different than their
ancestors, yet are more capable of
surviving and producing offspring
in the environment.
Evolution
Charles Darwin – credited with the theory of
evolution
In 1859 The Origin of Species by Means of
Natural Selection.
Major Idea of his work: Organisms living
today have been produced through a long
slow process called evolution
Figure 15–1 Darwin’s Voyage
Section 15-1
Giant Tortoises of the Galápagos
Islands
Section 15-1
Shape of Shell Corresponds
to different habitats
Pinta
Pinta Island
Tower
Marchena
Intermediate shell
Fernandina
James
Santa Cruz
Isabela
Santa Fe
Hood Island
Floreana
Isabela Island
Dome-shaped shell
Hood
Saddle-backed shell
Mastadon
Pterosaur
Brittle Star
T-Rex
Evidence of Evolution
1. Paleontology- study of extinct life
Fossils- most found in sedimentary rock where
bone has been replaced by minerals. (Fossils
found in tar, amber, or ice may be better
preserved)
• Provides evidence about the history of life
• Shows how organisms have changed over time
• Fossil record is incomplete because most
organisms die without leaving any trace!
• Shows that there were several mass extinctions
Dating Fossils
Radioactive (absolute dating): Some radioactive
elements breakdown over time at a known, steady rate.
Each radioactive element has a different half life.
Ex: U-238 has a half life of 4.5 billion years
C-14 has a half life of 5,770 years
IV. Dating Fossils
Radioactive (absolute dating): Some radioactive
elements breakdown over time at a known, steady rate.
Each radioactive element has a different half life.
Ex: U-238 has a half life of 4.5 billion years
C-14 has a half life of 5,770 years
Relative dating: Lower layers of rock are usually older
than the layers above. Can be less accurate than
radioactive methods due to erosion, faulting from
earthquakes, etc.
Sediment Layers
Relative Dating
Younger
Older
You can tell
about the
history of the
land by looking
at layers of the
Earth.
How has this
environment
changed over
the years?
IV. Dating Fossils
(Using data collected from rock samples from
the Earth, moon, and meteorites, most
scientists agree that the Earth is about 4.6
billion years old)
Compare/Contrast Table
Section 17-1
Comparing Relative and Absolute Dating of Fossils
Relative Dating
Absolute Dating
Can determine
Age of fossil with respect to
another rock or fossil (that is,
older or younger)
Age of a fossil in years
Is performed by
Comparing depth of fossil in
the layers of rock to the
position of a reference fossil or
rock
Determining the relative
amounts of a radioactive
isotope and nonradioactive
isotope in a specimen
Not a precise age (only a
comparison)
Difficulty of radioassay
laboratory methods
Drawbacks
Go to
Section:
. Fossils of animals the size of goats were dated at 5
million years old. Similarly, fossils of larger animals were
dated at 3 million years old. Both animals were similar in
body structure to today's horses. Using these data, which
inference can scientists make?
1
A. The animals were probably ancestors of today’s horses
B. The animals had no relationship to one another.
C. Today's horses and these animals probably lived together at some
time in the past.
D. Today's horses are faster than these animals were.
. Fossils of animals the size of goats were dated at 5
million years old. Similarly, fossils of larger animals were
dated at 3 million years old. Both animals were similar in
body structure to today's horses. Using these data, which
inference can scientists make?
1
A. The animals were probably ancestors of today’s horses
B. The animals had no relationship to one another.
C. Today's horses and these animals probably lived together at some
time in the past.
D. Today's horses are faster than these animals were.
2. Geographic Distribution- unrelated species now living on
different continents, under similar ecological conditions
evolve certain striking features in common.
A.
B.
C.
Suggests that different organisms living in similar
environments could evolve similar traits
North American muskrat and the South American
coypu
Beaver in North America and capybara in South
America
Figure 15–14 Geographic Distribution
of Living Species
Section 15-3
Beaver
Beaver
Muskrat
NORTH
AMERICA
Muskrat
Beaver and
Muskrat
Coypu
Capybara
Capybara
SOUTH
AMERICA
Coypu
Coypu and
Capybara
Evidence (8): Geography
Marsupials
• Geographic spread of
organisms also tells of
their past evolution.
• Marsupials occur in
two populations today
in the Americas and
Australia.
• This shows the group
evolved before the
continents drifted apart
evolution.berkeley.edu/evosite/lines/IVCexperiments.shtml
en.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg
3. Embryology- study of organisms at an
early stage of development
Similarities in the development of many
organisms suggest an evolutionary
relationship (common ancestor).
4. Homologous Structures- body parts of different
organisms that have the same basic structure.
Develop from the same embryonic tissues but have
different mature forms
Similarities in body parts suggest a common ancestor
Ex: whale flipper and a human hand
Figure 15–15 Homologous Body
Structures
Section 15-3
Turtle
Alligator
Typical primitive fish
Bird
Mammals
5. Vestigial Structures- body parts that are reduced
in size and have no function
Suggests that as body part was no longer needed in
environment they were lost
Ex: human appendix or hip and leg bones in snakes
Vestigial Structures
• As evolution progresses, some
structures get side-lined as they
are not longer of use. These
are known as vestigial structures.
• The coccyx is a much reduced
version of an ancestral tail, which
was formerly adapted to aid
balance and climbing.
• Another vestigial structure in
humans is the appendix.
The coccyx is a vestigial tail
en.wikipedia.org/wiki/Image:Illu_vertebral_column.jpg
6. Artificial Selection- Because of natural variation,
breeders are able to produce a wide range of plants and
animals that look very different from their ancestors
– Natural Variation- Differences among individuals of
the same species (ex: no 2 human beings look
exactly like unless they are identical twins)
– Variations – due to mutations (changes in a gene).
Remember not all mutations are harmful!
Biochemistry- All organisms share similar biochemistry
•All organisms have DNA & RNA
•All organisms use ATP as cellular energy
•Many organisms use many of the same hormones
Ex: Prolactin- milk production in mammals
Similar Genes
HUMAN
CHIMPANZEE
GORILLA
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
Genetic code of chimps and gorillas is almost identical to humans
• If evolution is true then we might also expect that closely
related organisms will be more similar to one another than more
distantly related organisms.
• Comparison of the human genetic code with that of other
organisms show that chimpanzees are nearly genetically identical
(differ by less than 1.2%) whereas the mouse differs by ≈15%.
Natural Selection- Works much like artificial selection,
but the environment “selects” the best traits.
A. Causes Survival of the fittest!
B. Fitness is a result of adaptation.
• Fitness= the ability of an individual to survive
• Adaptation= an inherited characteristic that
increases the chance of survival
Natural Selection- Peppered Moths
1.A farmer sprayed his fields with a new insecticide to rid his crops
of grasshoppers. Twenty-four hours later nearly all the grasshoppers
were dead. A few, however, survived. Each year he continues to
spray his fields with the insecticide, but fewer and fewer of the
grasshoppers die. Which of the following best explains the results?
a) The insecticide caused a mutation in the species.
b) The grasshoppers learned to fight off the insecticide.
c) The insecticide caused a side effect of immunity that was
passed on to the next generation of grasshoppers.
d) A few grasshoppers in the first population were immune
and passed this trait to their offspring.