* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Tiktaalik
Genetic engineering wikipedia , lookup
Genome (book) wikipedia , lookup
Pathogenomics wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Human genetic variation wikipedia , lookup
Human genome wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Human–animal hybrid wikipedia , lookup
Genome evolution wikipedia , lookup
Koinophilia wikipedia , lookup
History of genetic engineering wikipedia , lookup
Human microbiota wikipedia , lookup
Designer baby wikipedia , lookup
Microevolution wikipedia , lookup
Tiktaalik Fossil dated to 385359 million years ago Tiktaalik Discovered in 2004 on Ellesmere Island, Canada. 1 Archaeopteryx Fossil dated to 150 Million years ago 2 Nostrils Source: evolution.berkeley.edu 3 “Fossil” beta globin Scientists have discovered that The Antarctic Ice Fish (Chaenocephalus aceratus) does not have any red blood cells. Instead of transporting oxygen through their blood, they absorb oxygen from the water through their skin and large gills. Looks like a broken down beta globin gene Ice fish genome It is discovered that the ice fish genome contains a segment that looks like the beta globin gene found in closely-related fish, but is not functional. Human chromosome 2 Human chromosome 2 Looks like a centromere centromeres Chimp chromosomes 2q and 2p Humans have 23 pairs of chromosomes. All other ape species have 24 pairs. 6 Vestigial parts • Humans have much smaller appendices than herbivorous animals. • In herbivorous animals, but not in humans, the appendix serves to aid digestion of plant material. • It is still unclear what function, if any, the appendix serves in humans. • Humans have a small immobile tail made up of four fused vertebrae. • In other primates, these vertebrae are not fused and allow the tail to move, aiding in balance and mobility. Guppy experiment #1 Initial observations: Scientists observe that male guppies that stand out from their surroundings attract more females evolution.berkeley.edu Guppy experiment #2 evolution.berkeley.edu Staphylococcus aureus • Bacteria commonly found on mucous membranes and skin • Can cause infections (Staph infections) • Penicillin introduced as antibiotic in 1940 – very effective against Staph in the early 1940’s • 95% of staph strains now resistant to penicillin • Many strains are now resistant to multiple antibiotics: penicillin, methicillin, tetracycline – MRSA: Methicillin-resistant Staphylococcus aureus Nested traits Nucleus Chloroplast Seeds Nervous system Jaws Placenta Feathers Bacteria Algae X X Corn X X X Palm Tree X X X Jellyfish X Starfish X X Human X X X X Cow X X X X Crocodile X X X Robin X X X X Cardinal X X X X Comparing DNA Species Partial sequence of beta globin gene Human ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGG Macaque ATGGTGCATCTGACTCCTGAGGAGAAGAATGCCGTCACCACCCTGTGG Mouse ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTCTCTGGCCTGTGG Rat ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTTAATGGCCTGTGG Dog ATGGTGCATCTGACTGCTGAAGAGAAGAGTCTTATCTCCAGCATGTGG