Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II. RNA interference A. Basics of RNAi B. RNAi methods in flies III. Targeted gene replacement P element constructs enhancer trap: expresses bGal in same pattern as target gene enhancer lacZ target gene white P element constructs controlled misexpression: expresses target gene in Gal4dependent manner white GAL4 UAS white GAL4 enhancer trap: expresses Gal4p in same pattern as target gene P element constructs insulators: block enhancers and position effects on expression white yellow Mapped P element Insertion Lines (Bloomington Stock Center, as of 11/12/02) P{PZ} enhancer trap P{lacW} enhancer trap 523 1176 P{Gal4} Gal4 expression 141 P{EP} UAS-controlled expression 263 P{SUPor-P} insulator P{GT1} gene trap 2076 511 4690 Transposition of P Elements dominant P transposase marker (chromosome 3) w P{w+} P element on X chromosome Sb D2-3 + w P{w+} ; Sb D2-3 Y + w screen for red-eyed sons w Y P{w+} ; + new insertion on autosome P elements rarely insert into coding sequences Spradling et al. (1995) Excision of P Elements dominant P transposase marker (chromosome 3) P element on chromosome 3 w ; P{w+} w Y ; Sb D2-3 + P{w+} w Sb D2-3 w Y P{w+}** ; + screen for loss of w+, indicating excision white P transposase 8-bp target site 31-bp P inverted repeat ...ATGCCAAACATGATGAAATAACATAAGGTGGTCCCGTCG... ...TACGGTTTGTACTACTTTATTGTATTCCACCAGGGCAGC... P transposase ...ATGCCAAACATGATGAAATAACATA ...TACGGTTT 17-nt 3’ overhang (double-strand break) non-homologous end-joining homologous recombination different products, depending on: template for repair extent of repair gap widening before repair A. Repair using sister chromatid as a template white restoration of P element (w+) whi internal deletion of P element (w-) sometimes alters expression of target gene B. Repair using homologous chromosome as a template precise excision useful for proving that phenotypes are due to P element insertion C. “Imprecise excision” exonuclease repair deletion of flanking DNA RNA Interference dsRNA Dicer endonuclease 21-23 bp (or nt) siRNA find complementary mRNA (RISC complex) destroy mRNA Functions for RNA Interference Repression of repeated genes (e.g., transposable elements) Defense against viruses (plants) Developmental control of gene expression (small temporal RNAs) X chromosome inactivation (mammals) Silencing of mating type loci and centromeric regions (S. pombe) DNA elimination in macronuclei (Tetrahymena) Experimental manipulation of gene function. RNAi Methods in Drosophila 1. Addition of dsRNA to cell culture 2. Injection of dsRNA into embryos 3. Expression of hairpin RNA in vivo. UAS Gal4 RNA dsRNA Gene Targeting Technologies S. cerevisiae Generate linear targeting DNA by PCR Transform suitable strain Plate on medium for positive selection (10-8?) M. musculus Generate targeting DNA by cloning, cutting Transform ES cells Conduct positive and negative selections (typical = 10-7) Gene Targeting in Drosophila Problems No culture system for germline stem cells DNA introduced by injection in single embryos Existence of DNA repair in early development questionable Solution (Rong and Golic) Generate linear DNA in vivo: Obtain stable transformants of donor construct Use FLP – FRT system to excise donor DNA from chromosome Use I-SceI to linearize donor DNA Use visible marker gene to screen for potential homologous gene replacements FLP Recombinase Catalyzes Exchange Between Target Sequences (FRTs) FRT FLP recombinase crossover Intrachromosomal Recombination Between Tandem FRTs Results in Excision from the Chromosome FRT FRT extrachromosomal circle with 1 FRT chromosome with 1 FRT I-SceI makes a double-strand break at an 18-bp target sequence 5' ATTACCCTGTTATCCCTAAATT 3' 3' TAATGGGACAATAGGGATTTAA 5' I-SceI 5' ATTACCCTGTTAT 3' TAATGGGAC CCCTAAATT 3' AATAGGGATTTAA 5' FRT FRT I-SceI site donor construct (integrated P element) FLP recombinase extrachromosomal circular donor I-SceI endonuclease DSB * integration * tandem duplication w+ * FLP recombinase I-SceI endonuclease * integration w+ * Tandem Duplications can be Reduced to Single Copy I-CreI site w+ * I-CreI endonuclease w+ * DSB Repair of a DSB between direct repeats * Reverse Genetics in Drosophila I. P elements in reverse genetics A. P element insertional mutagenesis projects B. Using P elements to make mutations II. RNA interference A. Basics of RNAi B. RNAi methods in flies III. Targeted gene replacement