* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download The Pines - Davidson College
History of genetic engineering wikipedia , lookup
Minimal genome wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genomic library wikipedia , lookup
Human genome wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Genome evolution wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Human microbiota wikipedia , lookup
Mir-92 microRNA precursor family wikipedia , lookup
Oncogenomics wikipedia , lookup
Genomic Medicine A. Malcolm Campbell James G. Martin Genomics Program Director Professor of Biology, Davidson College The Pines October 28, 2013 Outline of Talk 1. What is a genome? 2. How to sequence genomes? 3. Diagnose and Treat Cancers Better? 4. New Drugs from Failures: Iressa 5. New Treatment Paradigms 6. Gut microbiome Science Presentation Give you the data, help you interpret. What is a Genome? What is a Genome? • Genetic information that you unique • Human genome 3.4 billion base pairs • G:C or A:T • ~23,000 genes base pairs What is the Human Genome? If the human genome were compiled in books: • 200 volumes, 1000 pages each • read 10 bases/second = 315,360,000 bases/year • 9.5 years to read out loud (without stopping) How do you sequence a genome? • Determine order of bases on all 23 (24) chromosomes • Can only read 30 to 700 bases at a time • Cannot sequence a genome in one run • “Whole Genome Shotgun” sequencing How do you sequence a genome? • Determine order of bases on all 23 (24) chromosomes • Can only read 30 to 700 bases at a time • Cannot sequence a genome in one run • “Whole Genome Shotgun” sequencing Modern Genome Sequencing Modern Genome Sequencing This is an analogy for genome assembly. This page will be torn into horizontal strips. Modern Genome Sequencing is an s an This i Modern Genome Sequencing This i is a s an Modern Genome Sequencing This i is a s an This is an analogy for genome assembly. This page will be torn into horizontal strips. You don’t know the language or syntax. This i is a s an Huge Pile of Strips This i is a s an Needle in a Haystack? This i is a s an Reassemble the Tree from Paper Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads consensus genome sequence Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads consensus genome sequence Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads high coverage consensus genome sequence low coverage Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads consensus genome sequence Reference Genome Assembly ATGGCATTGCAA TGGCATTGCAATTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAATTTGAC ATGGCATTGCAATTT AGATGGTATTGCAATTTG Reference Genome Assembly ATGGCATTGCAA TGGCATTGCAATTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAATTTGAC ATGGCATTGCAATTT AGATGGTATTGCAATTTG consensus AGATGGCATTGCAATTTGAC How do I remember them all? 206 bones > 60 organs Think like a genomicist… 206 bones > 60 organs 1 – 22 + X & Y Even Easier Is there a better way to diagnose and treat cancers? Is there a better way to diagnose and treat cancers? Diffuse Large B Cell Lymphoma (DLBCL) Diffuse Large B Cell Lymphoma (DLBCL) 25,000 new cases each year in America Half of patients die despite chemotherapy Why subject them to chemo if not helpful? Who will benefit from chemotherapy? Brown and Botstein Who will benefit from chemotherapy? patient and control biopsies control set Measure Gene Activity in All Cells Characterize Cancers by Gene Activity Retrospective Clinical Outcomes based on gene activity Retrospective Clinical Outcomes based on gene activity traditional prediction Retrospective Clinical Outcomes wrong 27% wrong 32% Retrospective Clinical Outcomes wrong 37% Resort Low Risk Patients wrong 37% wrong 29% Six Key Indicator Genes Genes On Genes On LMO2 BCL6 FN1 BCL2 SCYA3 CCND2 chemo no chemo Can Breast Cancer Treatment Be Improved? Can Breast Cancer Treatment Be Improved? tissue biopsies Can Breast Cancer Treatment Be Improved? No Patterns Emerged control set patient biopsies People Are More Unique Than Their Cancers before (BE) and after (AF) chemotherapy Characterize Cancers by Personal Differences Characterize Cancers by Personal Differences “Breast Cancer” is a Misnomer There are at least 5 Different Breast Cancers No such thing as THE cure for cancer. The Discovery of Iressa non-small cell lung cancer Success from Failure: Iressa Cancer Treatment from Nature’s Oddities Naked Mole Rat (NMR) Face That Only A Mother Could Love Face That Only A Mother Could Love? Cancer Treatment from Nature’s Oddities lives 40 years never has cancer lives 4 years tumors common What prevents cancer in naked mole rats? high-molecular-mass hyaluronan (HA), What prevents cancer in naked mole rats? 5 times bigger than human HA lower degradation rate than human HA Over Produced in NMR Tissues HA Over Produced in NMR Tissues HA Over Produced in NMR Tissues relative amount of HA HA Over Produced in NMR Tissues Block HA Tumors Form mouse cells neg. control carcinogen 1 carcinogen 2 carcinogen 3 NMR NMR - HA Block HA Tumors Form mouse cells neg. control carcinogen 1 carcinogen 2 carcinogen 3 NMR NMR - HA Block HA Tumors Form mouse cells neg. control carcinogen 1 carcinogen 2 carcinogen 3 NMR cells NMR - HA Block HA Tumors Form mouse cells neg. control carcinogen 1 carcinogen 2 carcinogen 3 NMR cells NMR no HA Inject Mice with NMR Cells +/- HA injection mouse tumor NMR cells NMR cells ++ HAase NMR cells HA not made recipient tumors tumors Inject Mice with NMR Cells +/- HA injection mouse tumor NMR cells NMR cells ++ HAase NMR cells HA not made recipient tumors Inject Mice with NMR Cells +/- HA injection mouse tumor NMR cells NMR cells ++ HAase NMR cells HA not made recipient tumors Inject Mice with NMR Cells +/- HA injection mouse tumor NMR cells NMR cells ++ HAase NMR cells HA not made recipient tumors Inject Mice with NMR Cells +/- HA injection mouse tumor NMR cells NMR cells ++ HAase NMR cells HA not made recipient tumors Inject Mice with NMR Cells +/- HA injection mouse tumor NMR cells NMR cells ++ HAase NMR cells HA not made recipient tumors Inject Mice with NMR Cells +/- HA injection mouse tumor NMR cells NMR cells ++ HAase NMR cells HA not made recipient tumors Inject Mice with NMR Cells +/- HA injection mouse tumor NMR cells NMR cells ++ HAase NMR cells HA not made recipient tumors Cancer Treatment from Nature’s Oddities Remember this next time Congress makes fun of scientists studying odd creatures. Human Body Is Mostly Non-Human 50 trillion human cells Human Body Is Mostly Non-Human 50 trillion human cells 500 trillion non-human cells Human Body Is Mostly Non-Human 50 trillion human cells 500 trillion non-human cells 10% human, 90% bacterial Define the Human Microbiome 27 sites 9 adults 4 occasions Define the Human Microbiome each sample colored by location clustered by similar species Human Microbiome by Location Human Microbiome by Location Human Microbiome by Location Human Microbiome by Location Human Microbiome by Location Two Types of Skin Habitats Human Microbiome by Location Human Microbiome Variations Human Microbiome Variations Microbiome Transplant Experiments compare to natives compare to transplants Human Microbiome Variations compare to natives compare to transplants Human Microbiome Variations forearm sustains transplants forehead replaces transplants Human Microbiome many skin sites more diversity than gut high-diversity skin sites • forearm • palm • index finger • back knee • sole of the foot Myth Busters: dog’s mouth is really clean Myth Busters: dog’s mouth is really clean Medical Uses of Microbiome mice fed low doses of antibiotics long term 15% more body fat than the control mice, Medical Uses of Microbiome sequenced bacteria in stool samples humans • 55 were thin • 122 overweight or obese Medical Uses of Microbiome obese people lack bacterial diversity in guts antibiotics reduce microbiome diversity Medical Uses of Microbiome obese people lack bacterial diversity in guts missing microbes methane producers, “the carbon that does not get out as gas could be incorporated as fat.” Medical Uses of Microbiome Using six species, predict obese 80% of the time Predictions based on genetics only 58% of the time Guess what is being tested now… Guess what is being tested now… fecal transplants Thanks to my Colleagues Laurie Heyer Leland Taylor ‘12 supported by James G. Martin Genomics Program Davidson College