* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download RNA StructureHerndon
Survey
Document related concepts
Transcript
RNA Structure Date: 2/28/07 Day B Objectives Identify the role of RNA Compare RNA with DNA DNA Decoding RNA is made up of four components – 1. Phosphate – 2. Sugar (Ribose, not Deoxyribose) – 3. Nitrogen Bases (A, U, C, G- instead of having Thymine RNA contains Uracil – 4. Hydrogen bonds between the two nucleotides RNA Structure RNA is called Ribonucleic Acid RNA is the principle molecule that carries out the instructions coded in DNA RNA is considered a macromolecule RNA has three different types: – 1. mRNA (messenger RNA- mailman) – 2. rRNA (ribosomal RNA- the factory) – 3. tRNA (transfer RNA- deliveryman) Comparing DNA with RNA DNA Deoxyribonucleic Acid Deoxyribose Sugar Uses thymine (A=T, C=G) Only found in nucleus One type Master copy RNA Ribonucleic Acid Ribose Sugar Uses Uracil (A=U, C=G) Can move from nucleus to cytoplasm Three types (mRNA, rRNA, tRNA) Blueprint Forms Of RNA mRNA rRNA tRNA Name Messenger RNA Ribosomal RNA Transfer RNA Role Transcribes the DNA into RNA by changing the T into U everything else is the same Are the proteins where the assembly of the amino acids takes place The delivery man who brings the proper amino acids for the sequences of RNA Found In Cell Nucleus/ cytoplasm mailman Cytoplasm Cytoplasm factory Delivery man Nickname Transcription Transcription: Is the process by which RNA is made – In transcription part of the nucleotide sequence of DNA molecule is copied into RNA • DNA acts as template for RNA, – MAJOR COMPONENT • RNA Polymerase RNA Polymerase Is an enzyme the binds directly to a molecule of DNA RNA Polymerase produces a strand of RNA – – – – – One nucleotide at a time RNA turns all T U Example: AACT UUGA It gives it its complementary pair without the T’s RNA Polymerase Example #2 DNA strand , give the complementary strand AATCGGCATTACGAACTACCGA TTAGCCGTAATGCTTGATGGCT COMP STR From the Original Strand give the RNA UUAGCCGUAAUGCUUGAUGGCU RNA STRAND So RNA is the some pattern as the complementary strand with T replacing U RNA as a Message First, single sequence in DNA may be copied again and again Second, by making RNA, the cell is able to keep its DNA in reserve controlling access to it and carefully regulating its use and replication QUIZ Original Strand:CGCCTGACTAGGACATACGGG Complementary Strand:? RNA strand: ? Answer Complementary Strand: GCGGACTGATCCTGTATGCCC RNA Strand: GCGGACUGAUCCUGUAUGCCC