Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Chapter 12: DNA & RNA What do you already know about DNA? 12.1 Contributors to the Genetic Code 1. Griffith and Transformation – – Worked with bacteria causing pneumonia Two Strains 1. S – strain (smooth) – DEADLY 2. R – strain (rough) - HARMLESS 12.1. Contributors to the Genetic Code 1. Griffith Experiment 1. The Experiment • Mouse + R = Life • Mouse + S = Death • Mouse + heat-killed S = Life • Mouse + heat-killed S and R = Death Transformation: changing one strain of bacteria into another using genes. Pointed to some type of “transforming” factor. 12.1. Contributors to the Genetic Code 1. Griffith • Conclusion: “something” transformed the living R-strain (harmless) into the S-strain (deadly) = Transformation 2. Oswald Avery – repeated Griffith’s work • Destroyed all the organic compounds in heat killed bacteria except DNA: Result = transformation occurred. • Destroyed all the organic compounds and DNA: Result = transformation did not occur. • Conclusion: DNA was the transforming factor that caused the change in the R-strain 12.1 Contributors to the Genetic Code 3. Alfred Hershey & Martha Chase • • Question: Are genes made of DNA or Proteins What they know: viruses use other organisms to reproduce Phage attaches to bacterial cell. Phage injects DNA. Phage DNA directs host cell to make more phage DNA and protein parts. New phages assemble. Cell lyses and releases new phages. 12.1. Contributors to the Genetic Code 3. Alfred Hershey and Martha Chase • Experiment • • They tagged the virus DNA with blue radioactive phosphorous They tagged the protein coat with radioactive sulfur Conclusion: Virus only injects DNA (DNA is the genetic material) Bacteriophage Images 12.1 Three important functions of DNA 1. Store genetic information – stores genes 2. Copy information – copy genes prior to cell division 3. Transmit the information – pass genetic information along to next generation 12.2 Structure of DNA • • • DNA = Deoxyribonucleic Acid A nucleotide is composed of: 1. Sugar (deoxyribose) 2. Phosphate group 3. Nitrogenous Base A nucleotide is the monomer of a DNA strand (polynucleotide): Sugar-phosphate backbone Phosphate group A C Nitrogenous base A Sugar DNA nucleotide C Nitrogenous base (A, G, C, or T) Phosphate group O H3C O T T O P O CH2 O– G C HC O C N N C H O Thymine (T) O C H G H C HC CH H Sugar (deoxyribose) T T DNA nucleotide DNA polynucleotide 12.2 Structure of DNA Nitrogenous Bases 1. Purines – Adenine & Guanine (two rings in structure) 2. Pyrimidines – Cytosine & Thymine (one ring) H O H3C H C C C H H N C H N C N C C C N O H N H H Thymine (T) Cytosine (C) Pyrimidines – one ring structure H N H O N H O C C N C C N H C N N H H C N C C N C C N H Adenine (A) H Guanine (G) Purines – two ring structure N H H 12.2 Structure of DNA DNA is a double-stranded helix James Watson and Francis Crick • Worked out the three-dimensional structure of DNA, based on work (photos taken using x-ray crystallography) by Rosalind Franklin 12.2 Structure of DNA The structure of DNA • Consists of two polynucleotide strands wrapped around each other in a double helix (twisted ladder) Twist 12.2 Structure of DNA Hydrogen bonds (weak) between bases • Hold the strands together Each base pairs with a complementary partner • A with T, and G with C G C T A A Base pair T C G C C G A T O OH P –O O O H2C O O P –O O H2C –O T OH A T O A O P O H2C O –O A T A O P O H2C O CH2 O O– P O O O CH2 O O– O P O O CH2 O O– P O O O CH2 O O– P HO O G C O A O C G O G T Hydrogen bond A T T OH G A Ribbon model C T Partial chemical structure Computer model Chromosome structure • Chromatin = DNA that is tightly packed around proteins called histones - during cell division, chromatin form Nucleosome packed chromosomes Chromosome DNA double helix Coils Supercoils Histones 12-3 DNA Replication When does DNA replicate? – DNA must copy before cell division (mitosis) How does it replicate? 1. DNA is separated 2. Nucleotides are added according to base pairing rules, using DNA polymerase (enzyme). A T A T A T A T A T C G C G C G C G C G G C G C G C G C A T A T A T A T T A T A T A T A Parental molecule of DNA C A Both parental strands serve as templates Two identical daughter molecules of DNA 12-3 DNA Replication DNA replication is semi-conservative 1. The parent strand gives rise to two daughter strands. 2. Each daughter strand is composed of one half the parent (old strand) and one half new. Parental strand Origin of replication Daughter strand Bubble Two daughter DNA molecules 12.3 DNA Replication DNA replication is a complex process: • The helical DNA molecule must untwist • Each strand of the double helix is oriented in the opposite direction (antiparallel) 5 end 3 end P 5 4 3 2 T T A A T T A C G C C G G A G TA C 3 4 5 T 1 A P C A T G C G C A T G 1 A P G C A HO 2 G P P G T C T C P G C G C G C C A T G T A A T T A A T P T OH 3 end A P 5 end DNA Replication Replication = process of copying DNA - occurs during S phase of Interphase - process: 1. DNA is separated into two strands by an enzyme 2. Free nucleotides are added by DNA polymerase according to base pairing rule DNA Replication New strand Original strand DNA polymerase Growth DNA polymerase Growth Replication fork Replication fork New strand Original strand Nitrogenous bases Chapter 13: Protein Synthesis Central Dogma of Cell Biology • DNA codes for DNA = REPLICATION • DNA codes for RNA = TRANSCRIPTION • RNA codes for protein = TRANSLATION Chapter 13 Protein Synthesis - Overview – The DNA of the gene is transcribed into RNA • Which is translated into protein • The flow of genetic information from DNA to RNA to Protein is called the CENTRAL DOGMA DNA Transcription RNA Translation Protein Chapter 13 Protein Synthesis (Overview) FLOW IS FROM DNA TO RNA TO PROTEIN • Genes on DNA are expressed through proteins, which provide the molecular basis for inherited traits • A particular gene, is a linear sequence of many nucleotides – Specifies a polypeptide (long protein made of amino acids) 13-1 Messenger (mRNA) 1. Monomer: nucleotide 2. Parts of a mRNA Nucleotide • • • Ribose Sugar Phosphate Nitrogenous Base 3. Three main differences between mRNA and DNA • • • Ribose instead of deoxyribose mRNA is generally single stranded mRNA has uracil in place of thymine (U instead of T) 13.1 RNA 4. Three Types of RNA • • • Messenger RNA (mRNA) – carries copies of genes (DNA) to the rest of the cell. Ribosomal RNA (rRNA) – make up the ribosomes. Transfer RNA (tRNA) – transfers the amino acids to the ribosomes as specified by the mRNA RNA can be Messenger RNA also called Ribosomal RNA which functions to mRNA Transfer RNA also called which functions to rRNA Combine with proteins Carry instructions from to to make up DNA Ribosome Ribosomes also called which functions to tRNA Bring amino acids to ribosome 13.1 TRANSCRIPTION: The process of making mRNA from DNA DNA – Why do you need this process? • Location of DNA? Nucleus • Location of Ribosome? RNA Cytoplasm Strand to be transcribed T A C T T C A A A A T C A T G A A G T T T T A G U A G Transcription A – mRNA takes code from DNA in the nucleus to Polypeptide the cytoplasm U G A A G U U U Start condon Stop condon Translation Met Lys Phe 13.1 Transcription produces genetic messages in the form of mRNA – During transcription, segments of DNA serve as templates to produce complementary RNA molecules. Adenine (DNA and RNA) Cytosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNA polymerase DNA RNA Transcription – Transcription requires an enzyme, known as RNA polymerase, that is similar to DNA polymerase. – RNA polymerase binds to DNA during transcription and separates the DNA strands. Adenine (DNA and RNA) Cytosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNA polymerase DNA RNA Promoters – RNA polymerase binds only to promoters, regions of DNA that have specific base sequences. – Promoters are signals in the DNA molecule that show RNA polymerase exactly where to begin making RNA. – Similar signals in DNA cause transcription to stop when a new RNA molecule is completed. 13.1 In the nucleus, the DNA helix unzips • And RNA nucleotides line up along one strand of the DNA, following the base pairing rules – As the single-stranded messenger RNA (mRNA) is released away from the gene • The DNA strands rejoin RNA nucleotides RNA polymerase T C C A A T A U C C A T A G G T T A Direction of transcription Newly made RNA Template Strand of DNA Exon Intron 13.1 Eukaryotic mRNA is processed before leaving the nucleus – Noncoding segments called introns are spliced out leaving only the coding exons • A 5’ cap and a poly A tail are added to the ends of mRNA • Cap and tail protect mRNA Exon Intron Exon DNA Cap RNA transcript with cap and tail Transcription Addition of cap and tail Introns removed Tail Exons spliced together mRNA Coding sequence Nucleus Cytoplasm The Genetic Code – Proteins are made by joining amino acids together into long chains, called polypeptides. – As many as 20 different amino acids are commonly found in polypeptides. The Genetic Code – The specific amino acids in a polypeptide, and the order in which they are joined, determine the properties of different proteins. – The sequence of amino acids influences the shape of the protein, which in turn determines its function. The Genetic Code – RNA contains four different bases: adenine, cytosine, guanine, and uracil. – These bases form a “language,” or genetic code, Each three-letter “word” in mRNA is known as a codon. – A codon consists of three consecutive bases that specify a single amino acid to be added to the polypeptide chain. How to Read Codons – Because there are four different bases in RNA, there are 64 possible threebase codons (4 × 4 × 4 = 64) in the genetic code. How to Read Codons – Most amino acids can be specified by more than one codon. – For example, six different codons—UUA, UUG, CUU, CUC, CUA, and CUG— specify leucine. But only one codon—UGG— specifies the amino acid tryptophan. Start and Stop Codons – The methionine codon AUG serves as the initiation, or “start,” codon for protein synthesis. – Following the start codon, mRNA is read, three bases at a time, until it reaches one of three different “stop” codons, which end translation. DNA:CCGTCATGTTCGCGCTACAAA TGAAATGAGGCAGTACAAGCGCGA TGTACTTTACT mRNA: Polypeptide: 13-2 Protein Synthesis Translation • Translation is defined as going from mRNA to protein – tRNA which have amino acids attached are going to the ribosome. • What are amino acids? monomers of proteins • Does the order of amino acids matter? Yes, they must be in order for the protein to fold correctly. – How does the correct tRNA (with amino acid attached) bind to the mRNA? The tRNA contains an anticodon which matches up with the mRNA sequence (codon). Transfer RNA (tRNA) molecules serve as interpreters during translation – Translation • Takes place in the cytoplasm – A ribosome attaches to the mRNA and translates its message into a specific polypeptide aided by transfer RNAs (tRNAs) • tRNAs can be represented in several ways Amino acid attachment site Amino acid attachment site Hydrogen bond RNA polynucleotide chain Anticodon Anticodon 13.2 Translation – Each tRNA molecule • Is a folded molecule bearing a base triplet called an anticodon on one end – A specific amino acid • Is attached to the other end Amino acid attachment site Anticodon 13.2 Translation Ribosomes build polypeptides (proteins) – A ribosome consists of two subunits • Each made up of proteins and a kind of RNA called ribosomal RNA tRNA molecules Growing polypeptide Large subunit mRNA Small subunit 13.2 Translation – The subunits of a ribosome • Hold the tRNA and mRNA close together during translation tRNA-binding sites Large subunit Next amino acid to be added to polypeptide Growing polypeptide tRNA mRNAbinding site Small subunit mRNA Codons – An initiation codon marks the start of an mRNA message – mRNA, a specific tRNA, and the ribosome subunits assemble during initiation Met Met Large ribosomal subunit Initiator tRNA P site U A C A U G U A C A U G Start codon 1 mRNA A site Small ribosomal subunit 2 Elongation adds amino acids to the polypeptide chain until a stop codon terminates translation – Once initiation is complete amino acids are added one by one to the first amino acid – The mRNA moves a codon at a time • A tRNA with a complementary anticodon pairs with each codon, adding its amino acid to the peptide chain – Each addition of an amino acid • Occurs in a three-step elongation process Amino acid Polypeptide P site A site Anticodon mRNA Codons 1 Codon recognition mRNA movement Stop codon 2 Peptide bond formation New Peptide bond Figure 10.14 3 Translocation 13.3 Mutations • Mutations – heritable changes in genetic information (changes to the DNA sequence) • Two types - gene and chromosomal mutations • Mutations can be caused by chemical or physical agents (mutagens) – Chemical – pesticides, tobacco smoke, environmental pollutants – Physical – X-rays and ultraviolet light 13.3 Mutations • Gene mutations – Point Mutation: mutations that affect a single nucleotide – Frameshift mutation: shift the reading frame of the genetic message. • Can change the entire protein so it doesn’t work • Gene Mutations Explained 13.3 Mutations 13.3 Chromosomal Mutations • Chromosomal mutation: mutation that changes the number or structure of chromosomes. 13.3 Chromosomal Mutations • Types of chromosomal mutations: – Deletion: The loss of all or part of a chromosome – Duplication: A segment is repeated – Inversion: part of the chromosome is reverse from its usual direction. – Translocation: one chromosome breaks off an attaches to another chromosome.