* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Click here for powerpoint
Biochemistry wikipedia , lookup
History of biology wikipedia , lookup
Synthetic biology wikipedia , lookup
Chemical biology wikipedia , lookup
Symbiogenesis wikipedia , lookup
Biomolecular engineering wikipedia , lookup
DNA vaccination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Introduction to genetics wikipedia , lookup
DNA-encoded chemical library wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Molecular paleontology wikipedia , lookup
RNA-binding protein wikipedia , lookup
Messenger RNA wikipedia , lookup
Gene expression wikipedia , lookup
Turn in DNA letter Begin reading Analogy Story and answer the questions Don’t worry about the back page Regents Biology Watch animation Ask questions if something is unclear Then we’ll take a few notes about what we discussed Tomorrow you’ll take what we learned to decode genetic instructions, find out what a fictional creature looks like based on the instructions and draw it. Regents Biology Protein Synthesis Making Proteins Regents Biology 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA Regents Biology DNA Cells Bodies How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA Regents Biology DNA Proteins Cells Bodies DNA has the info to build proteins proteins cells Regents Biology bodies DNA gets all the glory, Proteins do all the work How do proteins do all the work Proteins proteins run living organisms enzymes control all chemical reactions in living organisms structure all living organisms are built out of proteins Regents Biology Cell organization DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus Regents Biology Cell organization Proteins aa aa aa chains of amino acids aa made by a “protein factory” in cytoplasm aa protein factory = ribosome aa cytoplasm aa aa aa aa build proteins nucleus ribosome Regents Biology aa aa Passing on DNA information Need to get DNA gene information from nucleus to ribosome aa aa aa The code to make protein is in DNA. aa Since DNA can’t leave the nucleus a copy aa called mRNA is made, which is sent to the aa ribosome to then make protein aa aa build proteins mRNA cytoplasm nucleus Regents Biology ribosome aa aa aa From nucleus to cytoplasm aa aa aa aa transcription DNA mRNA aa aa protein aa translation trait nucleus Regents Biology cytoplasm DNA vs. RNA DNA deoxyribose sugar nitrogen bases G, C, A, T T:A C:G double stranded Regents Biology RNA ribose sugar nitrogen bases G, C, A, U U:A C:G single stranded Transcription Making mRNA from DNA DNA strand is the template (pattern) match bases U:A G:C Enzyme RNA polymerase Regents Biology Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology Matching bases of DNA & RNA Match RNA bases to DNA C G bases on one of the DNA strands U A G G U U C A AG A C G A U A C A C C RNA polymerase A U G T G G T A C A G C T A G T C A T CG T A C CG T Regents Biology U C Matching bases of DNA & RNA U instead of T is matched to A aa aa aa DNA TACGCACATTTACGTACGCGG aa aa aa mRNA AUGCGUGUAAAUGCAUGCGCC aa aa aa aa ribosome A C C A U G U C G A U C A G U A G C A U G G C A Regents Biology Once a copy is made in the nucleus mRNA goes to the ribosome TRANSLATION: ribosome decodes the instructions on mRNA and makes a protein Regents Biology How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How? mRNA A C C A U G U C G A U C A GU A GC A U G GC A aa Regents Biology aa aa aa aa aa aa aa Codes are written in groups of 3 letters (codon) codon DNA mRNA Regents Biology TAC GCA AUG CGU tRNA tRNA Met Arg mRNA to protein = Translation The working instructions mRNA The reader ribosome The transporter transfer RNA (tRNA) ribosome mRNA A C C A U G U C G A U C A GU A GC A U G GC A U GG tRNA aa aa aa Regents Biology U A C tRNA aa A G C tRNA U A G aa tRNA aa aa cytoplasm aa protein aa aa aa transcription translation aa aa aa aa aa aa nucleus trait Regents Biology Whoops! See what happens when your genes don’t work right! Any Questions?? Regents Biology 2009-2010