Download Tnk1/Kos1

Tnk1/Kos1 knockout mice develop
spontaneous tumors
Sarasija Hoare, Kishalay Hoare, Mary K. Reinhard, Young J. Lee,
S. Paul Oh, and W. Stratford May
University of Florida
Cancer Research
68:8723-8732
November 2008
Tnk1/Kos1
Tnk1 is a non-receptor tyrosine kinase
Negatively regulates Ras activation through phosphorylation of Grb2
Do you predict this to be an oncogene or a TSG?
Trans Am Clin Climatol Assoc. 121: 281
Tnk1/Kos1
Alternative splicing
If the exon-intron junction at the end of exon 8 isn’t used, a polyA signal is encountered
Encodes Kos1 (or Tnk1b)
Fig. S2
Making Tnk1/Kos1-/- mice
(ES cells)
Adapted from Molecular Cell Biology by Lodish et al.
Making Tnk1/Kos1-/- mice
Matches parts
of Tnk1/Kos1
neor allows the cells to resist the drugs in the neomycin family (like G418)
HSV-tk is the thymidine kinase gene from herpes simplex virus
Image adapted from
www.nobelprize.org
Making Tnk1/Kos1-/- mice
neor added
HSV-tk lost
Image adapted from
www.
nobelprize.org
Making Tnk1/Kos1-/- mice
 Sites for restriction enzymes
Fig. 1A
Making Tnk1/Kos1-/- mice
Fig. 1A
Image adapted
from Molecular
Cell Biology by
Lodish et al.
(heterozygous)
Making
Tnk1/Kos1-/-
mice
Image adapted from www.nobelprize.org
Recombinant ‘knockout’ cells injected into blastocysts of C57BL/6 mice
Some mosaics will be Tnk1/Kos1+/- in their germ cells.
Mate together for Tnk1/Kos1- /-
Making Tnk1/Kos1-/- mice
Determine mouse genotype by Southern blotting
Collect genomic DNA from tail
Digest with BamHI
Separate by gel electrophoresis
Blot with “3’ probe”
Wt allele is 7.8kb
Deletion allele is 4.2kb
Fig. 1AB
Making Tnk1/Kos1-/- mice
Western blots
Liver Cell Lysates
Mouse Embryo Fibroblasts (MEFs)
Only Kos1 (45kD) seen on western blots. No Tnk1 (72kD)
Fig. 1CD
Phenotype of Tnk1/Kos1-/- mice
27% (14/52) of the heterozygous mice developed tumors. 72% epithelial
Phenotype of Tnk1/Kos1-/- mice
43% (12/28) of the homozygous mice developed tumors. 75% lymphoid
Phenotype of Tnk1/Kos1-/- mice
One tumor histology example
Stained with H&E (hematoxylin and eosin)
Hepatocellular carcinoma at 40x or 400x
Fig. 2NO
Phenotype of Tnk1/Kos1-/- mice
Trans Am Clin Climatol Assoc. 121: 281
Kos1 Inhibition of Ras
Are these tumors due to excessive activation of Ras?
How can we determine if Ras is activated or not in vivo?
We know that Ras-GTP binds Raf but Ras-GDP does not bind Raf
Measure how much Ras can bind Raf
Isolate the Ras Binding Domain (RBD) of Raf
Fuse to another protein (GST, glutathione-S-transferase), for easy manipulation
Kos1 Inhibition of Ras
Created a GST (Glutathione-S-Transferase) fusion protein
Making a fusion gene:
GST stop codon removed
first codon of Raf-RBD cDNA is
just after the last codon of GST
Recombinant Plasmid
Raf-RBD
Kos1 Inhibition of Ras
Immobilize Raf-RBD by creating a GST fusion protein
Glutathione-S-Transferase binds reduced glutathione (GSH)
Express protein in E. coli
Since GST binds to glutathione, the fusion protein will
bind to insoluble beads with glutathione on the surface
N
GST
Raf-RBD
C
Kos1 Inhibition of Ras
Transform recombinant plasmid into E. coli host.
Ptac promoter is derived from the lac promoter
can be strongly induced with IPTG (structurally similar to lactose)
Lyse E. coli.
Purify GST-Raf-RBD on column of reduced glutathione (GSH)-beads.
Wash away other E. coli proteins.
GST
Raf-RBD
Kos1 Inhibition of Ras
Add mouse liver cell lysate (includes Ras-GDP and Ras-GTP)
Only Ras-GTP sticks. Ras-GDP (and all other proteins) are washed away.
Wash.
Elute proteins by denaturation.
Western blot for Ras.
GST
Raf-RBD
Kos1 Inhibition of Ras
Mouse liver cell lysate
Tnk1/Kos1 Status:
Pulled down with GST-Raf-RBD
Ras western blot
Quantified
Fig. 3A
Kos1 Inhibition of Ras
Does lack of Tnk1/Kos1 affect activation of Ras by EGF?
MEFs grown on a plate.
Serum-starved 24 hours
Treated with EGF for 5 min.
Pull-down with GST-Raf-RBD
Western blot for Ras
Fig. 3B
Kos1 Inhibition of Ras
Does lack of Tnk1/Kos1 affect activation of Ras by EGF?
Can also answer this question by looking downstream, at Erk phosphorylation.
Phospho-specific antibody
Normal tissue, tumor or MEFs
Fig. S4
Kos1 Inhibition of Ras
Does lack of Tnk1/Kos1 affect activation of Ras by EGF?
Unmodified NIH3T3 cells
Overexpress Kos1
Kos1 on a plasmid with strong promoter
HA epitope tag
also a CN = catalytically null allele
Lys148  Ala
blocks ATP binding
Kos1
3xHA
…AUGGAUUAUAAAGACCAUGAUGAUUAUAAAGACCAUGAUGAUUAUAAAGACCAUGAUAUGCUU…
N-Met-Asp-Tyr-Lys-Asp-His-Asp-Asp-Tyr-Lys-Asp-His-Asp-Asp-Tyr-Lys-Asp-His-Asp-Met-Leu-…
HA Epitopes
Start of
Kos1
N-
3xHA
Kos1
-C
Kos1 Inhibition of Ras
Unmodified NIH3T3 cells. Overexpress Kos1 (or controls). Series of western blots
HA western blot
Fig. S3
Kos1 Inhibition of Ras
Unmodified NIH3T3 cells. Overexpress Kos1 (or controls). Series of western blots
HA western blot
GST-Raf-RBD pull-down
Ras western blot
Phospho-Erk
western blot
Erk western blot
Fig. S3
Kos1 Inhibition of Ras
Does Kos1 inhibit Ras?
Which figure makes the strongest argument?
Why so much redundancy?
Fig. 3AB
Fig. S4
Fig. S3
Kos1 Phosphorylates Grb2
Kos1 is a kinase; does it inhibit Ras activity by phosphorylation?
in vitro kinase assay
Recombinant Grb2 protein
Mammalian cells transfected with plasmid expressing GFP-Kos1 or GFP-Kos1(CN)
GFP-Kos1 was purified by immunoprecipitation (IP)
Kos1 Phosphorylates Grb2
Immunoprecipitation (IP)
Lyse cells.
Add anti-GFP antibody
Add Protein A attached to an insoluble bead
Wash away unattached molecules
A
Kos1 Phosphorylates Grb2
in vitro kinase assay
Kinase: GFP-Kos1
Substrate: Grb2 protein
Substrate: 32P-g-ATP
Separate proteins by electrophoresis
Expose gel to film.
Radioactivity will expose the film
Kos1 Phosphorylates Grb2
in vitro kinase assay
Kinase: GFP-Kos1
Substrate: Grb2 protein
Substrate: 32P-g-ATP
Separate proteins by electrophoresis
Expose gel to film.
Radioactivity will expose the film
Fig. S6
Kos1 Phosphorylates Grb2
and a few controls
Fig. S6
Kos1 Phosphorylates Grb2
Kos1 also phosporylates itself!
Fig. S6
Kos1 Phosphorylates Grb2
Another way to detect the
phosphorylated products.
Nonradioactive ATP
After allowing the kinase to work,
western blot with an
anti-phosphotyrosine antibody
Fig. S6
Kos1 Phosphorylates Grb2
That was in vitro.
Does Kos1 phosphorylate Grb2 in vivo?
Cells transfected with Flag-tagged Kos1 (wt or CN)
IP Sos1
Grb2 also co-immunoprecipitates
(coIPs)
Series of western blots
Conclusion?
Fig. 4B
Kos1 Phosphorylates Grb2
That was in cell culture. Does Kos1 phosphorylate Grb2 in a living animal?
Livers from knockout mice
IP Grb2. Detect phosphorylation with anti-phosphotyrosine antibody western blot
Fig. 4C
Kos1 Phosphorylates Grb2
Hypothesis: Phosphorylation of Grb2 blocks it’s association with Sos1
coIP experiment. Liver cell lysate. IP with Sos1 antibody. Western blot for Grb2.
Is the hypothesis supported or refuted?
Fig. 4D
Epigenetic Silencing of Tnk1/Kos1
27% (14/52) of the heterozygous mice developed tumors.
If Kos1 is a tumor suppressor protein, why do these tumors develop?
Hypothesis #1: Haploinsufficiency
Two functional Tnk1/Kos1 genes are needed to suppress tumors
Hypothesis #2: Somatic mutation
The wildtype allele has been mutated
Hypothesis #3: Epigenetic silencing
The wildtype allele has been silenced
Testing Hypothesis #1: Haploinsufficiency
GTP-Ras assay on mice
What data would support this hypothesis?
GTP-Ras level similar to non-tumor tissue
from non-tumor tissue
Epigenetic Silencing of Tnk1/Kos1
What data would refute this hypothesis?
GTP-Ras level similar to Tnk1-/-
Fig. 5A
Epigenetic Silencing of Tnk1/Kos1
Testing Hypothesis #1: Haploinsufficiency
Also measured Kos1 levels by western blotting
Fig. 5C
Epigenetic Silencing of Tnk1/Kos1
Testing Hypothesis #2: Somatic mutation
Not directly tested. How would you test it?
Epigenetic Silencing of Tnk1/Kos1
Testing Hypothesis #3: Epigenetic silencing
Methylation of CpG dinucleotides near promoters leads to silencing
Epigenetic Silencing of Tnk1/Kos1
Testing Hypothesis #3: Epigenetic silencing
Purify genomic DNA from tumors
Modify DNA with Sodium Bisulfite
Unmethylated cytosines become Uracils
Methylated cytosines are protected
Epigenetic Silencing of Tnk1/Kos1
Testing Hypothesis #3: Epigenetic silencing
Designed PCR primers for 136 bp of Tnk1/Kos1 promoter
Primer: 5’GAAAACGAAAAAAACAACTACGAA3’
-CH3
-CH3
Target Site:
GAAAACGAAAAAAACAACTACGAA
CTTTTGCTTTTTTTGTTGATGCTT
-CH3
-CH3
if not methylated, primers won’t bind well!
GAAAAUGAAAAAAACAACTAUGAA
CTTTTGUTTTTTTTGTTGATGUTT
Epigenetic Silencing of Tnk1/Kos1
Testing Hypothesis #3: Epigenetic silencing
Normal Liver Tissue, Tnk1+/+
Lymphoma
Lymphoma
Lymphoma
Hepatoma
Hepatocellular carcinoma
Adenocarcinoma
Methylation-Specific PCR
Fig. 5B
Major Conclusions
• Loss of Tnk1/Kos1 increases tumor frequency (Table 1)
• Kos1 inhibits Ras activity (Fig. 3)
• Kos1 phosphorylates Grb2, inhibiting its association with Sos1 (Fig. 4)
• Tnk1/Kos1 promoter can be methylated (Fig. 5)
Major New Techniques for us
• Knockout mouse
• GST fusion proteins
• Epitope tagging
• IP/coIP
• in vitro kinase assay
• Phosphorylation-specific western blot
• Methylation-specific PCR