Download Abstract - Biotechniques.org

Id2 and Survivin expression may not be correlated with N-myc
gene amplification in Neuroblastoma Cell Lines
Misonara Ahmed 1
Department of Biological Sciences, Fordham University, New York
___________________________
1
email: [email protected]
Abstract
Neuroblastomas (NBs) are one of the most frequent childhood cancers and a
major cause of death from neoplasias. Proto-oncogene N-myc amplification occurs in
20-25% of NBs and is a reliable negative prognostic marker because no other oncogene
has been shown to be consistently mutated or overexpressed in NB. Studies have shown
that N-myc amplification causes Id2, a helix-loop-helix protein, overexpression. Id2 is
then able to sequester the tumor suppressor retinoblastoma protein and in turn abolish its
antiproliferative effect. Survivin is a member of the inhibitor of apoptosis (IAP) family
of proteins. In the following study, six different NB cell lines (three that do not amplify
N-myc and three that amplify N-myc) were tested using RT-PCR to examine whether Nmyc amplification causes overexpression of Id2 in these cell lines and to determine if
there is any correlation with N-myc amplification and survivin expression. Densitometric
scanning shows no significant data supporting either hypothesis. It may be concluded
that N-myc does not cause overexpression of Id2 in all NB cell lines or that N-myc is not
entirely responsible for the overexpression of Id2.
2
Introduction
Neuroblastomas (NB) are responsible for about 15% of all pediatric cancer deaths
while 96% of cases occur before the age of 10 (2). In NB, unlike most postmitotic
neurons, abnormal expression or activation of proteins that stimulate cell cycle
progression or DNA replication does not result in apoptosis. NBs often express high
levels of the proto-oncogene N-myc, which is a key activator of components of the cell
cycle machinery (9). It was shown that in postmitotic sympathetic neurons, expression of
N-myc at levels similar to those in NBs caused sympathetic neurons to reenter S-phase
and rescued them from apoptosis induced by withdrawal of their necessary survival
factor, nerve growth factor. Thus, N-myc both selectively causes sympathetic neurons to
reenter the cell cycle and protects them from apoptosis, potentially contributing to their
transformation to NBs (9). It was also shown that transgenic mice, in which there was
targeted expression of N-myc, developed NB (2). However, the precise functional
association between the high level of N-myc protein and NB development and
progression remains vague. A recent breakthrough, though, correlates the increase of Nmyc protein and the loss of retinoblastoma tumor suppressor protein (pRb) function (2).
Disturbance of the function of the Rb protein is found in most human tumors. It
has been reported that neuroblastoma cells show accumulation of Id2 protein, which
sequesters and therefore inhibits pRb antiproliferative activity (10). The increased Id2
(on chromosome 2p25) has been reported to be due to N-myc gene amplification and
overexpression because of the occurrence of two high affinity myc-binding regions on the
Id2 gene’s regulatory region. Thus, studies have shown that Id2 is a natural target of the
Rb protein that is recruited by Myc oncoproteins to bypass the tumor suppressor function
3
of Rb (5). Overexpression of Id2 mediates cellular transformation and is necessary to
maintain the malignant behavior of NB cells. Consequently, it has been reported that an
N-myc-Id2 pathway occurs during late development of the nervous system and
corresponds to the rising levels of active Rb in neuronal precursors withdrawing from the
cell cycle (6).
The behavior of some tumors can be directed by apoptotic factors inducing or
preventing cell death. Survivin (on chromosome 17q25) is one of these apoptotic factors
belonging to the inhibitor of apoptosis protein (IAP) family. Survivin’s mechanism of
action has not yet been completely understood, but it seems to be involved in the control
of the mitotic spindle checkpoint (where survivin binds to tubulin), and thereby in cell
cycle progression (3). Disrupting survivin-microtubule interactions results in the loss of
survivin anti-apoptotic activity and gain of caspase 3 (an apoptotic protein) activity.
Thus, survivin may offset a default induction of apoptosis in the G2/M phase (7).
Survivin also interacts with caspase 9, another apoptotic protein, suggesting it prevents
the activation of caspase 3 and 7, apoptotic proteins associated with caspase 9. These
effects prevent the upregulation of this key apoptotic pathway. NBs show a particularly
elevated amount of this protein and the amount of survivin is directly correlated with the
more aggressive cancer stages (stages 3 and 4). That is, NB cases with poor prognosis
show a high gene dosage of survivin (4). Although the mechanism of survivin
accumulation in NB has not been clarified, it is possible that at least in some cases, it
depends on gene amplification (8).
For this project, three NB cell lines that do not amplify N-myc (1. SK-N-SH (SHSY-5Y), 2. SMS-JMN, and 3. LA-N-6) and three NB cell lines that amplify and
4
overexpress N-myc (4. LAN-1 (LA1-55n), 5. BE(2)-M17, and 6. KCN-69N) are studied
to determine the relationships of Id2 and survivin in terms of N-myc amplification. No
studies as of yet show a correlation between N-myc and survivin, so the following
research sets out to determine if there exists any such correlation between N-myc
amplification and survivin expression as well as to determine if Id2 expression increases
with N-myc amplification in the cell lines studied.
Materials and Methods
Cell Culture
Neuroblastoma cell lines SK-N-SH (SH-SY-5Y), SMS-JMN, LA-N-6, LAN-1
(LA1-55n), BE(2)-M17, and KCN-69N were provided by Barbara Spengler and Dr.
Robert Ross, Fordham University, New York. The cells were cultured at approximately
2-3x107 cells per flask. One 75-cm2 flask of cells from each cell line was trypsinized,
collected, centrifuged at 4000 rpm for 5 minutes, and supernatant discarded. The pellets
were then washed with PBS, centrifuged again at 4000 rpm for 5 minutes, and
supernatant discarded.
Total RNA Isolation
Total RNA was extracted from the cell pellets using Ambion’s RNAqueous
Phenol-Free Total RNA Isolation Kit and performed according to the manufacturer’s
specifications. All centrifugations in this protocol were performed at 13,000 rpm. Each
cell pellet was homogenized thoroughly in 1 ml of lysis/binding solution and then 1 ml of
64% ethanol. The lysate/ethanol mixture was applied to a filter, centrifuged for 1 minute,
and flow-through discarded. The filter was then washed with 700 ls of Wash Solution
#1, centrifuged for 1 minute, and flow-through again discarded. This washing step was
5
repeated twice for 500 ls of Wash Solution #2/3 and any last traces of wash solution
were removed by further centrifugation. The RNA was eluted by adding 60 ls of
RNase-free distilled water at 70C to the filter cartridge, heating the tube at 70C for 10
minutes, and then centrifuging for 1 minute. These steps are repeated after adding
another 60 ls of RNase-free distilled water to the filter cartridge for a total volume of
120 ls of total RNA. One g of total RNA for each of the six cell lines was run on a
0.8% agarose gel containing ethidium bromide and viewed under UV light. A picture
was taken of the gel using the Quantity One computer program.
DNase Treatment
Total RNA was DNase treated using Ambion’s DNA-free DNase Treatment and
Removal Reagents. Briefly, 0.1 volume of 10x DNase Buffer and 2 units of DNase 1
were added to 2 gs of each total RNA sample and the mixture*6 incubated at 37C for
30 minutes. Then 0.1 volume of resuspended DNase Inactivation Reagent was added, the
mixture incubated at room temperature for 2 minutes, and finally centrifuged at 13,000
rpm for 1 minute to pellet the reagent.
First strand synthesis by reverse transcription (3’ RACE)
Dnased RNA was used in the production and amplification of cDNA by heating a
mixture of 1 g of Dnased RNA and Rnase-free distilled water (for a total volume of 9.4
ls) at 70C for 10 minutes and then cooling the mixture on ice. Next, the following
were added: 4 ls 5x Reverse Transcriptase First Strand Buffer, 4 ls of 2.5mM dNTP’s,
2 ls of 0.1M DTT, 0.6 ls of Qt primer, and finally 1 l of Superscript 2 RT. The
mixture was incubated at room temperature for 5 minutes, and then put in the thermal
cycler under the following conditions: 42 for 1 hour, 50C for 10 minutes, 70C for 15
6
minutes (to inactivate the RT), and a final hold at 4C. Finally, 0.075 units (0.75 ls) of
RNase H was added to the mixture and incubated at 37C for 20 minutes.
Primer Synthesis and Preparation
After designing the desired primers, the primers were generously synthesized in
the oligosynthesizer by Dr. Sylvia Anderson, Fordham University, New York. Once they
were synthesized, they were deprotected by incubating at 70C for 1-16 hours. After
deprotection, 50 ls of each primer was dried down for 1 hour and then resuspended in
the same volume of dH2O. An optical density reading was taken and each primer was
diluted down to a concentration of 10 pmol. The primers generated and used are as
follows:
N-myc Fwd primer: 5’ GACCACAAGGCCCTCAGTAC 3’,
N-myc Rev primer: 5’ GTGGACATACTCAGTGGC 3’,
Id2 Fwd primer: 5’ CGATGAGCCTGCTATACAAC 3’,
Id2 Rev primer: 5’ CCACACAGTGCTTTGCTGTC 3’,
Survivin Fwd primer: 5’ AGGCTGGCTTCATCCACTG 3’, and
Survivin Rev primer: 5’ CTTGGCTCTTTCTCTGTCC 3’. Actin primers were provided
by Dr. Rubin’s laboratory. Primers were designed so that they spanned at least one intron
as a test of DNA contamination when PCR results were viewed.
Polymerase Chain Reaction
The polymerase chain reaction was completed for the following transcripts: Nmyc, Id2, survivin, and actin. PCR reactions were carried out with the following
reagents: 1 l of 1:10 dilution cDNA, 5 ls 10x Reaction Buffer, 1.5 ls of 50mM
MgCl2, 4 ls of 2.5mM dNTPs, 36.25 ls of dH2O, 1 l of each set of forward and
7
reverse primers, and 0.25 ls Taq polymerase. Template cDNA was used from each of
the six cell lines in conjunction with each of the four sets of primers to make twenty-four
reactions. Thermal cycler conditions were as follows: 94C for 1 minute, then 33 cycles
of 94C for 30 seconds, 55C for 30 seconds, and 72C for 1 minute. Finally, there was
an extension at 72C for 7 minutes, followed by cooling of the samples to 4C. Another
set of PCR reactions were performed at 34 cycles that showed N-myc bands from the SKN-SH (SH-SY-5Y) and SMS-JMN cell lines (data not shown). Five ls of PCR product
from each reaction were run on a 0.8% agarose gel containing ethidium bromide and
viewed under UV light. A picture was taken using the Quantity One computer program.
PCR Purification
PCR products were purified using the Life Technologies PCR Purification Kit. A
PCR product for each gene was purified by adding 400 ls of Binding Solution (H1) to
the amplification reaction, loading this mixture in a cartridge placed in a wash tube,
centrifuging for 1 minute at 13,000 rpm, and then discarding the flow-through. The
cartridge was washed in the same way with Wash Buffer (H2) and any residual wash
buffer was removed by centrifuging again for 1 minute at 13,000 rpm. The purified DNA
was then eluted with the addition of 30 ls of 70C distilled water and a final spin in the
centrifuge at 13,000 rpm for 2 minutes.
Sequencing
DNA sequencing was performed on the purified PCR products of the four
different genes using the Sanger Dideoxy method of sequencing. Fifty fmol of purified
PCR product were added to 4 ls of 10x cycling buffer, 0.2 ls of  33P-ATP, 2 ls of a
primer, and enough distilled water for a total volume of 30ls. Then each tube was
8
further divided into 4 tubes where 6 ls of the previous mixture were then added to 2 ls
of the corresponding ddNTP. Finally, a drop of mineral oil was overlaid onto each tube
to prevent evaporation, and the tubes were placed in the thermal cycler under the
following conditions: 35 cycles of denaturing at 94C for 30 seconds, annealing at 58C
for 30 seconds, and elongating at 72C for one minute. The samples were held at 4C
upon completion. Four ls of stop solution were then added to each tube and all tubes
were heated at 94C to denature the sequencing products. Finally, 3 ls of each reaction
were run on a sequencing gel for 1.5 hours. The gel was then dried for one hour and
exposed overnight to x-ray film. The sequences were read using the MacVector software
and compared to the complete gene sequences using Clustal W Alignment.
Densitometric Scanning
PCR bands observed on the gel were subject to densitometric scanning using the
Sigma Gel software provided generously by Dr. R. Ross, Fordham University, New
York. Density values were represented by the area under the curves plotted for the
intensity of each individual band. Each band ‘density’ was compared across all six cell
lines with the highest value for each gene corresponding to 100% of the total expression
of that gene. The values remaining for the bands of each gene were computed as a
percentage of the highest value.
Results
Total RNA was extracted, as described in materials and methods, from the six
neuroblastoma cell lines and run on a 0.8% agarose gel (Fig. 1). The 28S and 18S RNA
subunits are clearly visible in all cell lines at approximately 1.7kb and 0.85kb,
respectively. Genomic DNA is still present (note bands across the top) as this is prior to
9
DNase treatment. The RNA was shown to be intact and suitable for further DNase
treatment and first strand synthesis.
PCR of the six neuroblastoma cell lines with primers for N-myc, Id2, survivin,
and actin were performed as described in materials and methods (33 cycles) (Fig.2). PCR
product from cell line SK-N-SH (SH-SY-5Y) were loaded in lanes 1-4, SMS-JMN PCR
product in lanes 5-8, LA-N-6 in lanes 9-12, LAN-1 (LA1-55n) in lanes 13-16, BE(2)M17 in lanes 17-20, and KCN-69N in lanes 21-24. N-myc was loaded (at 552 bp) in
lanes 1,5,9,13,17 and 21; Id2 (307 bp) in lanes 2,6,10,14,18, and 22; survivin (at 213 bp)
in lanes 3,7,11,15,19, and 23; and actin (at about 680 bp) in lanes 4,8,12,16,20 and 24.
The non-amplified N-myc cell lines, as expected, showed little (3rd cell line LA-N-6) or
hardly any N-myc DNA product (1st and 2nd cell lines, SK-N-SH and SMS-JMN). These
two cell lines, SK-N-SH and SMS-JMN did show bands for N-myc at a PCR conducted
at 34 cycles (data not shown). There is no DNA contamination as evidenced by the fact
that only one band is seen per lane. Because the primers spanned at least one intron, if
there were DNA contamination, a longer sequence would have been amplified and there
would be bands of DNA visible above the bands seen in this picture. Densitometric
scanning shows relative numbers of the intensity of each band as a percentage of the
highest value for each respective gene’s bands (Table 1). The three amplified N-myc cell
lines clearly showed more intense bands for N-myc than the non-amplified N-myc cell
lines as is shown by the data. There seems to be no significant difference or pattern in
survivin expression when comparing the N-myc amplified to the N-myc non-amplified
cell lines. In addition, surprisingly, the same was true for Id2. The N-myc amplified cell
10
lines do not all necessarily increase expression of Id2 such that they are greater than the
Id2 expression of non-amplified N-myc cells.
Sequencing of four different purified PCR products, i.e., that of N-myc, Id2,
survivin, and actin show that the bands observed by PCR amplification are indeed those
of the genes targeted by the gene-specific primers, i.e. there is greater than 99%
homology (data not shown).
Discussion
Findings have correlated NB development with aberrations of two crucial cellular
processes, that is, the cell division cycle and apoptosis. N-myc can both selectively cause
sympathetic neurons to reenter the cell cycle and protect them from apoptosis. Id2 was
reported to be involved in the N-myc-Id2 pathway, and could consequently hamper pRb
antiproliferative activity. In addition, survivin, which is an inhibitor of the apoptotic
response, makes NBs more resistant to programmed cell death (1). Thus, it seems that
NB cells have acquired the capability to proliferate easily (by reentering the cell cycle)
and die difficultly (by inhibiting apoptosis).
It is clearly seen that N-myc is indeed amplified in the N-myc amplified cell lines
according to the densitometric scanning results. However, the findings presented also
suggest that Id2 is not overexpressed due to N-myc amplification. The values obtained
from the densitometric scanning did not show significant differences between the two cell
types, that is, N-myc amplified vs. N-myc non-amplified, and, in one case, a nonamplified N-myc cell line has a higher densitometric scanning value for Id2 than an
amplified N-myc cell line. The same holds true for survivin in that there is no significant
difference between the two cell types in the values obtained from densitometric scanning.
11
Cell lines #1 (SK-N-SH) and #4(LAN-1) have been reported in previous studies
where it was shown that Id2 expression is significantly greater in the N-myc amplified
cell line as opposed to the non-amplified cell line. This conclusion was made with 10
different NB cell lines, only two of which I have tested, and in which the statement: ‘Nmyc amplification causes Id2 overexpression’ is potentially true. However, there is no
known research on the other four cell lines I have tested to support this hypothesis. My
findings may suggest that Id2 is overexpressed in only certain N-myc amplified cell lines,
or more importantly, that Id2 overexpression is not entirely caused by N-myc
amplification. Very recently (April, 2002), however, there has been new research to
suggest that there is no correlation with N-myc amplification and Id2 overexpression
(personal communication, Barbara Spengler, Fordham University). It would be
interesting to know, more precisely, the correlation between N-myc and Id2 and the
mechanism by which each functions. Further research could also be done to study the
other Id family of proteins and to determine their relationship, if any, to N-myc.
Survivin did not show a significant difference between the two cell types and
therefore it may be concluded that there is no correlation between N-myc amplification
and survivin expression. It may have been an auspicious finding if there were a
correlation between N-myc and survivin in terms of new therapeutic strategies that could
develop in fighting off neuroblastomas.
Acknowledgements
I would like to thank Dr. R. Ross and Barbara Spengler for providing their time,
their valuable advice, and the neuroblastoma cells needed for this project. I would also
like to acknowledge Dr. Rubin for providing his lab and resources and for allowing me to
12
gain such valuable skills and techniques. Finally, I would like to thank Sabrina Volpi and
Rocco Coli for their patience, tremendous support, and guidance throughout the semester.
References
1.Azuhata, T., Scott D., Takamizawa, S., Wen, J., Davidoff, A., Fukuzawa, M., and
Sandler, A. (2001) The inhibitor of apoptosis protein survivin is associated with high
risk behavior of neuroblastoma. Journal of Pediatric Surgery 36(12), 1785-91.
2.Boriello, A., Roberto R., Della Ragione F., and Iolascon A., (2002) Proliferate and
survive: cell division cycle and apoptosis in human neuroblastoma. Haematologica 87,
196-214.
3.Islam, A., Kageyama, H., Takada, N., Kawamoto, T., Takayasu, H., Isogai, E., Ohira,
M., Hashizume, K., Kobayashi, H., Kaneko, Y., and Nakagawara, A. (2000) High
expression of survivin, mapped to 17q25, is significantly associated with poor
prognostic factors and promotes cell survival in human neuroblastoma. Oncogene
19(5), 617-23
4.Islam, A., Hajime, K., Kohei, H., Yasuhiko, K., and Nakagawara, A. (2000) Role of
survivin, whose gene is mapped to 17q25, in human neuroblastoma and identification
of a novel dominant-negative isoform, survivin-/2B. Medical and Pediatric Oncology
35, 550-553.
5.Lasorella, A., Boldrini, R., Dominici, C., Donfrancesco, A., Yokota, Y., Inserra, A.,
and Iavarone, A. (2002) Id2 is critical for cellular proliferation and is the oncogenic
effector of N-myc in human neuroblastoma. Cancer Research 62(1), 301-6.
6.Lasorella, A., Noseda, M., Beyna, M., and Iavarone, A. (2000) Id2 is a retinoblastoma
protein target and mediates signaling by Myc oncoproteins. Nature 407, 592-98
13
7.Shankar, S.L., Mani, S.,O’Guin, K.N., Kandimalla, E.R., Agrawal, S., and Zagardo,
B.S. (2001) Survivin inhibition induces human neural tumor cell death through
caspase-independent and –dependant pathways. Journal of Neurochemistry 79, 426436.
8.Toma, J.G., El-Bizri, H., Barnabe-Heider, F., Aloyz, R., and Miller, F.D. (2000)
Evidence that helix-loop-helix proteins collaborate with retinoblastoma tumor
suppressor protein to regulate cortical neurogenesis. Journal of Neuroscience 20, 764856.
9.Wartiovaara K., Barnabe-Heider, F., Miller, F.D., and Kaplan, D.R. (2002) N-myc
promotes survivial and induces S-phase entry of postmitotic sympathetic neurons.
Journal of Neuroscience 22(3), 815-824.
10.Weinberg, R.A.(1995) The retinoblastoma protein and cell cycle control. Cell 81,
323-330
14