Download Genomic analyses/gene knockouts

Microarray
Comparison of Gene Expression during Fermentation and Respiration in a Brewery
Strain of Saccharomyces cerevisiae using a DNA Microarray.
Yeast cells isolated from a bottle of Red Tail Ale (Mendocino Brewing Company, Ukiah,
CA) were grown under two different conditions, "fermentative" and "respirative".
To encourage fermentation, cells were grown in YEPD (glucose) under quasi-anaerobic
conditions (sealed vessel but with agitation). To encourage respiration, cells were grown
in glycerol and lactate medium with aeration.
RNA was isolated from each culture. Cy5 (red) labeled target sequences representing
gene expression under anaerobic-fermentative conditions on glucose, and Cy3 (green)
labeled target sequences representing gene expression during respiration and use of
nonfermentable carbon sources were prepared by reverse transcription.
The probes were mixed and hybridized to a PCR product microarray containing more
than 6000 yeast gene probes. (see movie)
The scan of the complete slide is shown below (Fig 1).
There are 32 blocks (each block printed by one of the 32 printing pins on the arrayer).
Each block has 20 X 20=400 spots. The entire array has about 400 X 32=12,800 spots.
There are just over 6000 yeast genes, and each yeast gene-derived PCR product DNA is
printed twice, side by side on this array. This makes it easy to evaluate by eye, since
pairs of spots should behave the same (Fig 2).
Using the GenePix® software that comes from the scanner (Axon, Inc.) the image of the
scan was analyzed. Spots were identified and "cut out" computationally, background
fluorescence was estimated and subtracted from the signal in each spot and the amount of
Cy5 and Cy3 fluorescence in each spot was compared. The median ratio Cy5/Cy3 for all
the spots was 1.2, suggesting that the amount of total Cy5 in the reaction was more than
Cy3. Remember we tried to label and mix the two samples in a 1:1 ratio, but there is
variation in our ability to to this. Since we assume that most of the 6000 genes will not
change in this experiment, we "normalized" all the ratios by multiplying the observed
Cy5/Cy3 ratio by 0.83 (= the reciprocal of 1.2), to get a "normalized" Cy5/Cy3 ratio for
each spot.
We then looked at the fluorescence in each pixel in each spot (not us personally but the
computer did). The intensity of each pixel for each fluor (Cy5 or Cy3) was compared
and median intensities (recall the median is the value above or below which half the
values in the distribution lie) for each pixel were determined, and then the Cy5/Cy3 ratio
of these medians was determined. This is the ratio of the medians. The pixel by pixel
Cy5/Cy3 ratios were also figured, and a median of these ratio values was determined (the
median of the ratios). The reason for this is that the two numbers should be about the
same if the spot is of good quality and the signal from the spot is uniform throughout the
spot.
This generates a large file that will choke your browser (3.5 Megs), so we have done
some selection for you. The software generates a report called "Interesting Genes".
Whether such genes are interesting may be a matter of debate, nonetheless one can define
cutoffs so that most of the genes that don't change much are excluded. We chose for you
genes that are within 20% of 4 fold higher or 3.3 fold lower in the anaerobic-fermentative
conditions on glucose than in the respiration and use of nonfermentable carbon sources
sample. We have loaded the data into an Excel file for you. Note that a green spot with a
Cy5/Cy3 ratio of 0.1 represents a gene whose expression is 10 fold higher during
respiration than fermentation, as defined in this experiment.
The array data for the ~434 genes whose expression levels most differ between
fermentative and respiratory conditions is as a excel file.
Testing the function in respiration of genes whose expression is induced upon growth in
glycerol.
In this exercise, we analyzed a microarray experiment and identified genes whose
expression differed greatly between fermentative (beer making) growth conditions
(glucose, no oxygen) and respiratory growth conditions (glycerol and lactate, vigorous
aeration).
We will now focus on genes (LEE1, USV1, GAC1, and FMP16) whose expression was
up in respiratory conditions relative to fermentative conditions (Don't forget to report
these expression values and explain what they mean). Our hypothesis was that such genes
might be important for respiration. We could test our hypothesis by knocking out each
gene we chose, and then by determining how well it could grow on glycerol as a carbon
source, the classical test for a respiratory deficient yeast.
Please address the following questions somewhere in your report (but please don't just
make a section where you answer all the questions in a row as asked--let's try to integrate
the answers into the flow of the report!)
1. Why did we pick these particular four genes? There were many genes in the
expression class we chose, so why these in particular?
2. What do the proteins encoded by these genes do? What is truly known, what is only
guessed at, and what is not really known about each of their functions? (You don't need
an infinite list of everything that is not known, just point at a few things that are
important.)
3. What would be the predicted growth phenotype of the knock out of these genes (ie
what is the hypothesis again?)
4. How did we do the knockout (don't just cite Longtine et al--you designed the primers
remember? What were the elements of that design and how do they work?
5. We made a PCR product for that experiment so you should report on that. How did
you characterize the PCR product?
6. Describe the results of the transformation. You used PCR to test whether the
transformed strains had the correct knockout. You need to report that.
7. Finally we streaked each strain on both glucose plates and glycerol plates. Relate what
happened there to our original hypothesis.
You will need:
The PCR primers you designed for preparative PCR synthesis of the linear DNA
fragment to transform and knock out the genes:
PCR conditions to knockout the genes:
94 degrees, 4 minutes (denatures the template well the first time)
then 30 cycles of:
94 degrees 30 sec (denature)
55 degrees 30 sec (anneal primers)
72 degrees 2 min 30 sec (extension: note this is long because we are trying to make a
~2000 bp fragments).
Then 72 degrees for 5 minutes.
YEAST TRANSFORMATION
REAGENTS:
Lithium acetate: 0.1 M LiOAc in 10 mM Tris pH 7.5, 1mM EDTA (TEL).
40% PEG (3500 or 4000) in 10 mM Tris pH 7.5, 1mM EDTA. MUST BE STERILE
FILTERED! NOT AUTOCLAVED!
Sonicated herring sperm DNA, 10 ug/ul
Method1
from colonies on a plate (low efficiency)
1. On a agar plate, streak out the yeast strain to be transformed and incubate overnight at
30C . Can use older plates.
2. Scrape one generous loopful of cells (as large a glob as you can conveniently pick up on a
wire loop) per sample from the yeast plate and suspend in LiTE (150 ul per sample) by
vortexing.
3. Place the transforming DNA (2-5ul plasmid DNA about 0.5 ug) in a microfuge tub e with
100 ug denatured carrier (sonicated herring sperm) DNA.
4. Vortex the cell suspension, then add 150 ul to each DNA. Vortex briefly.
5. Add 1ml 40% PEG. Vortex thoroughly. Incubate at 30C for 1-2h
6. Incubate 42C for 10 min.
7. Pellet the cells in the microfuge (5 second spin) and discard the supernatant. Resuspend
the cells in 0.1 ml sterile water by vortexing.
Then spread onto selective plates.
Method2 from overnight liquid culture (high efficiency)
1. The night before (5 PM) seed 50 ml of YPAD with 1-10 ul of a saturated starter culture of
the strain to be transformed (More as the starter culture ages).
2. Read OD600 the next day-should be near 1. Spin cells down and resuspend in an amount
of LiTE in mls equal to the OD reading. (Example OD600= 0.73, use 0.73 ml).
3. Place the transforming DNA (5-10 ul plasmid miniprep) in a microfuge tube with 100 ug
denatured carrier (sonicated herring sperm) DNA.
4. Vortex the cell suspension, then add 50 ul to each DNA. Vortex briefly.
5. Add 1ml 40% PEG. Vortex thoroughly. Incubate at 30C for 1-2h
6. Incubate 42C for 10 min.
7. Pellet the cells in the microfuge (5 second spin) and carefully discard the supernatant.
Resuspend the cells in 0.1 ml sterile water, then spread onto selective plates
The following PCR primers were used to confirm the deletion of the target gene and the
insertion of the Kan gene:
FMP16_A
5'GCACATAAGTATATAAAGGTC3'
USV1_A
5'GGCAGATAAAGTTTCGTCTTG3'
GAC1_A
5'CAGTTATTGCTACAGCTAATC3'
LEE1_A
5'CTCTTGTGCCGTCATATTAG3'
KAN_B
5'CTGCAGCGAGGAGCCGTAAT3'
The PCR conditions were as follows, using DNA template made by ..........
PCR conditions to confirm the knockouts
94 degrees, 4 minutes (denatures the template well the first time)
then 30 cycles of:
94 degrees 30 sec (denature)
55 degrees 30 sec (anneal primers)
72 degrees 30 sec (extension)
Then 72 degrees for 5 minutes.