Download Wax ester biosynthetic pathway - Iowa State University Digital

Graduate Theses and Dissertations
Graduate College
2013
Wax ester biosynthetic pathway
Daolin Cheng
Iowa State University
Follow this and additional works at: http://lib.dr.iastate.edu/etd
Part of the Biochemistry Commons, Biology Commons, and the Genetics Commons
Recommended Citation
Cheng, Daolin, "Wax ester biosynthetic pathway" (2013). Graduate Theses and Dissertations. Paper 13529.
This Dissertation is brought to you for free and open access by the Graduate College at Digital Repository @ Iowa State University. It has been accepted
for inclusion in Graduate Theses and Dissertations by an authorized administrator of Digital Repository @ Iowa State University. For more
information, please contact [email protected].
Wax ester biosynthetic pathway
by
Daolin Cheng
A dissertation submitted to the graduate faculty
in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
Major: Genetics
Program of Study Committee:
Basil J. Nikolau, Major Professor
Alan A. DiSpirito
David J. Oliver
Martin H. Spalding
Eve S. Wurtele
Iowa State University
Ames, Iowa
2013
Copyright © Daolin Cheng, 2013. All rights reserved.
ii
DEDICATION
I dedicate this dissertation to my wife Yanbing Zhang (张燕冰), without whose
support I would not have been able to complete this work, and to my children Lola
(文澜) and Henry (文治), who are the source of my motivation.
iii
TABLE OF CONTENTS
TABLE OF CONTENTS.................................................................................................... iii
ACKNOWLEDGEMENTS.................................................................................................. v
CHAPTER I: INTRODUCTION ......................................................................................... 1
Cuticular wax ................................................................................................................... 1
Evolution of cuticular wax .............................................................................................. 1
Function of cuticular wax ............................................................................................... 2
Wax esters ....................................................................................................................... 3
Biological diversity in wax esters among plant species. ........................................... 4
Wax ester biosynthesis .................................................................................................. 5
Significances.................................................................................................................... 7
Dissertation organization ............................................................................................... 9
REFERENCES .............................................................................................................. 11
CHAPTER II. HETEROLOGOUS EXPRESSION OF WS GENES IN MICROBIAL
SYSTEMS .......................................................................................................................... 14
ABSTRACT .................................................................................................................... 14
Introduction .................................................................................................................... 15
Materials and methods................................................................................................. 19
Discussion ...................................................................................................................... 29
Figures and tables: ....................................................................................................... 34
iv
REFERENCES .............................................................................................................. 51
CHAPTER III. ECTOPIC EXPRESSION OF WAX PRODUCING GENES IN
TRANSGENIC ARABIDOPSIS SEEDS ........................................................................ 56
ABSTRACT .................................................................................................................... 56
Introduction .................................................................................................................... 57
Materials and methods................................................................................................. 59
Results:........................................................................................................................... 63
Discussions .................................................................................................................... 67
Figures and tables: ....................................................................................................... 71
REFERENCES .............................................................................................................. 79
CHAPTER IV. MUTATIONAL ANALYSIS OF JOJOBA-LIKE WAX ESTER
SYNTHASE IN ARABIDOPSIS ...................................................................................... 83
ABSTRACT .................................................................................................................... 83
Introduction .................................................................................................................... 84
Materials and methods................................................................................................. 87
Figures and tables: ....................................................................................................... 94
REFERENCES ............................................................................................................ 102
CHAPTER V: GENERAL CONCLUSIONS ................................................................ 110
v
ACKNOWLEDGEMENTS
Foremost, I would like to express my sincere gratitude to my major professor
Dr. Basil Nikolau for the continuous support of my Ph.D. study and research, for his
patience, motivation, enthusiasm, and immense knowledge. What I have learnt from
him did not only help me getting this degree, but also will benefit my career as a
scientist. I feel truly fortunate to have had an opportunity to be advised by him.
Special thanks to my committee, Dr. Alan DiSpirito, Dr. David Oliver, Dr.
Martin Spalding, and Dr. Eve Wurtele for their support, guidance and helpful
suggestions. Their guidance has served me well and I owe them my heartfelt
appreciation.
I thank Dr. Libuse Brachova and the whole Nikolau Lab past and present for
their assistance and friendship. They have made the lab a wonderful place to work
in. I would like to thank Dr. Ann Perera and Dr. Zhihong Song for the training on
metabolite analytical skills. I also would like to thank Dr. Marna Yandeau-Nelson for
her great advice and comments on genetics. In addition, a thank you to my dear
friends, Fei Wang, Long Long, Zifeng Yang, Hui Zhang, Zhiwei Zhai and Yan Ling,
for making my life in Ames, Iowa so enjoyable and memorable.
Finally, I would like to thank my parents Jianjin Zheng and Jinwang Cheng,
my brother Daozhang for supporting me spiritually throughout my life. I thank my
wife Yanbing, my daughter Lola and my son Henry for wiping away my stress and
making my life the best in the world.
1
CHAPTER I: INTRODUCTION
Cuticular wax
In early morphological studies, the plant cuticle wax was described as
“cuticular membrane” (Martin and Juniper, 1970; Baker, 1982). The plant cuticle is
a hydrophobic layer coating in the epidermis of the aerial plant body. The structure
of cuticular wax consists of several layers: epicuticular wax crystalloids or films, the
cuticle proper, and a cuticular layer, which interweaves with the epidermal cell wall
(from exterior inwards). From chemical perspective, the cuticle has been described
as a polyester matrix of hydroxy- and hydroxyl-epoxy-fatty acids, C16 and C18 long
(cutin) embedded and overlayed with cuticular wax (Kunst and Samuels, 2003).
From the view of geneticists who study wax related genes, cuticular wax has been
defined as the ‘‘lipids which are removed from plant surfaces after brief immersion
in an organic [nonpolar] solvent’’ (Post-Beittenmiller, 1998). In terms of morphology,
cuticule wax is considered to be the glaucous or whitish bloom on plant shoots,
which corresponds to crystalloid epicuticular wax with light scattering capacity
(Koornneef et al., 1989).
Evolution of cuticular wax
Interfacial interactions and physical properties of boundary layers are
important for plant life at various scaling levels, and is therefore one of the key
adaptations in the evolution of land plants (Raven and Edwards, 2004). Actually,
macrofossil records interpreted as cuticles date back to the very earliest terrestrial
plant species known (Edwards D et al., 1996). The critical role of this crucial
2
protective layer is stressed by the fact that it represents one of the largest interfaces
between biosphere and atmosphere (Riederer and Schreiber, 1995). In moses, the
embryo is surrounded by the maternal gametophyte tissues of the archegonium and
subtending gametophyte (Crum, 2001; Shaw, 2003). A recent case study on a moss
species Funaria hygrometrica suggests that the calyptra and its associated cuticle
represent a unique form of maternal care in embryophytes (Budke et al., 2011). This
organ can be considered an ancestor of the cuticle.
Function of cuticular wax
As the first barrier that a plant presents against to the environment, cuticular
wax carries many functions according to its composition or three dimensional wax
crystals on the plant surface. Cell forms, sizes and their fine structures have a great
influence on several functional impacts on the plant-boundary layer (Koch et al.,
2008). The functions of the plant cuticle are summarized in Figure 1. This layer
controls non-stomatal water loss (Riederer and Schreiber 2001), protects from UV
radiation (Krauss, Markstadter et al. 1997; Solovchenko and Merzlyak 2003;
Pfüindel, Agati et al. 2006), keeps surfaces from attaching particles including dust,
pollen and pathogen spores, and regulates plant interaction with insects, bacterial
and fungal pathogens (Eigenbrode 2004; Carver and Gurr 2008; Leveau 2008;
Müller 2008). The cuticle can also prevent organ fusion during plant development
(Lolle, Hsu et al. 1998; Sieber, Schorderet et al. 2000).
3
Figure 1: Schematic summary of the most prominent functions of the
cuticle as represented by a hydrophobic microstructured plant surface. (A)
Transport barrier: limitation of uncontrolled water loss or leaching from interior and
foliar uptake. (B)Water repellency: control of surface water status. (C) Antiadhesive, self-cleaning properties: reduction of contamination, pathogen attack
and control of attachment and locomotion of insects. (D) Signaling: cues for hostpathogens / insect recognition and epidermal cell development. (E) Spectral
properties: protection against harmful radiation. (F) Mechanical properties:
resistance against mechanical stress and maintenance of physiological
integrity(Bargel et al., 2006).
Wax esters
The compounds of cuticular wax consist of very long chain alkanes, fatty
acids, alcohols, ketones, aldehydes, terpenoids, and other molecules in addition to
wax esters (Jetter et al., 2006). Functions of surface lipid can only be understood
on the basis of their characteristic compounds and biosynthetic origin. The
biosynthesis of plant surface lipid starts from the elongation of saturated C16 and
C18 fatty acid CoAs to very long chain fatty acid (VLCFA) wax precursors between
4
24 and 36 carbons in length. Their subsequent biochemical modification is either via
the alkane pathway or primary alcohol pathway (Li et al., 2008). The composition of
surface lipid is a result of regulation of these pathway reactions (Figure 2).
Figure 2: Simplified pathways for wax biosynthesis in Arabidopsis stems.
CER, ECERIFERUM; WSD, wax synthase/diacylglycerol acyltransferase; MAH,
mid-chain alkane hydroxylase (Samuels et al., 2008).
Biological diversity in wax esters among plant species.
The wax ester content varies among and within species. Arabidopsis leaves
only 0.1% to 0.2% of the surface lipids is wax esters, and in stem they account for
5
between 0.7% to 2.9% of the surface lipid (Jenks et al., 1995). Carnauba palm
(Copernicia cerifera) in contrast, accumulates up to 85% wax ester in the surface
lipid (Kolattukudy, 1976).
In rare cases wax ester also serve as seed storage
reserves. Specifically in jojoba (Simmondsia chinensis) 97% of its seed oil is wax
ester (Benzioni et al., 2006).
Not only the total level of wax ester affects the characteristic and function of
plant surfaces and lipids, but the composition details, such as chain length
distribution and isomer composition also contribute to its biological function. So far,
only Arabidopsis has been studied to this detail (Lai et al., 2007). The natural
biological compositional diversity in wax esters can be used to understand the
substrate preference and availability of the pathway that assembles wax esters.
Therefore additional studies of wax ester biosynthesis is required.
Wax ester biosynthesis
Figure 3: Wax ester synthesis catalyzed by wax synthase.
The final step of wax ester biosynthetic pathway is catalyzed by wax
synthase, which transfers the acyl group from an acyl-CoA to a fatty acyl alcohol
(Figure 3). There are three unrelated families of wax synthases found in higher
plants, mammals and bacteria (Jetter and Kunst, 2008). The jojoba-like WS family,
the first identified plant wax synthase was from jojoba embryos. The jojoba enzyme
uses a wide range of saturated and unsaturated acyl-CoAs with a chain length from
14 carbons to 24 carbons, with 20:1 being the preferred substrate, and exhibits
6
highest activity with C18:1 alcohol (Lardizabal et al., 2000). Later, a second member
of this WS family was identified from Euglena. It can utilize fatty acids from 12:0,
14:0, 16:0 and 16:1-9, with 14:0 being the most favored fatty acid substrate; and the
preferred primary alcohols substrates are 12:0, 14:0, 16:0 and 16:1-9 with 16:1-9Alc
(Teerawanichpan and Qiu, 2010).
The second family type of WS was first identified in Acinetobacter
calcoaceticus,
and
is
the
WS/DGAT
(Acyl-Coenzyme
A:Diacylglycerol
acyltransferase) family. Enzymes in this family exhibit both WS and DGAT activity,
thus can utilize both primary alcohols and more complex alcohols (e.g., DAG) as
substrates. The Acinetobacter WS/DGAT enzyme shows a preference for C14 and
C16 acyl-CoA substrates together with C14 to C18 primary alcohols when acting as
a WS (Kalscheuer and Steinbuchel, 2003; Stöveken et al., 2005). A plant WS/DGAT
type enzyme is the WSD1 gene of Arabidopsis, and it is capable of using C18, C24
and C28 alcohols and C16 fatty acid to produce wax esters (Li et al., 2008).
The third WS family, is the mammalian wax synthase, and it was first
identified from mice (Cheng and Russell, 2004). The mammalian WS family of
enzymes has the highest activity with acyl-CoAs of between C12 and C16, and
primary alcohols shorter than 20 carbons (Cheng and Russell, 2004). There are no
obvious plant orthologs of this mammalian WS family (Li et al., 2008).
In general, WSs naturally accept acyl groups with carbon chain length of
C16 or C18 and primary alcohols with carbon chain length ranging from C12 to C20
(Shi et al., 2012). Reported activities of WSs with short chain alcohols are low
(Stoveken and Steinbuchel, 2008).
7
Significances
Due to special chemo-physical properties of wax ester, they have many
potential applications, such as lubricants, cosmetics, pharmaceutical products, ink,
polishes and candles. For example, whale oil, which is primarily composed of wax
esters was considered one of the best lubricants and used in specialized lubrication
precision instruments. Despite the fact that wax esters are very common in nature,
the abundance of wax ester is very low because only a few organisms can
accumulate large quantities of wax ester.
Most organisms produce just trace
amounts of these chemicals. Sperm whale oil contains up to 95% of wax ester
consisting of 34 carbons (Crisp, Eaton et al. 1984). Whales were an excellent source
of wax ester, until whale hunting was banned internationally in the 1980s. The best
alternative to whale oil is now jojoba oil, which occurs in the seed oil from the desert
shrub jojoba. This seed oil contains 97% of C38 to C44 wax esters (Jetter and Kunst
2008).
Wax esters are also considered excellent biofuel and biolubricant for the
future. However, the high price of wax esters has restricted their applications to high
value products, such as cosmetics. Many efforts have been made to improve this
situation. Growing jojoba plant in large scale seemed to be an easy solution in the
past, but we still have to face the fact that jojoba is far not suitable for our agriculture
system. Then genetically modified crop was proposed to massively produce wax
ester. By re-constructing the wax ester biosynthetic pathway in genetically modified
crop, not only will we be able to harvest sufficient quantities of wax esters, but also
be able to manipulate the properties of the produced wax esters by manipulating
8
the acyl-chain specificity of the wax synthase enzyme. However, the current
knowledge about the wax ester biosynthetic pathway is still too rudimentary for such
a goal. To date only a few wax synthases have been characterized. Even in the most
studied model organism such as Arabidopsis, only one WS/DGAT gene has been
identified out of 23 putative WS and WS/DGAT homologs.
The studies reported in this thesis provide new insights to this field. We have
set up two platforms for characterizing wax synthase enzymes; one by expressing
them in yeast strains which can be fed substrates to characterize the substrate
specificity of the wax synthase. The second platform utilizes Arabidopsis seeds in
which we also co-expressed 3-ketoacyl CoA synthase and fatty acyl CoA reductase.
In total nine genes were tested in this study and three of them were identified as
wax synthase and their substrate specificities were characterized.
9
Dissertation organization
This dissertation includes five chapters. Chapter I provides introduction to
wax esters, wax synthases and the significances of wax biosynthetic pathway
research. The purpose of this chapter is to do a literature review on wax biosynthesis
pathway research.
Chapter II describes wax synthase characterization in a yeast heterologous
expression system. In this chapter, I constructed phylogenetic trees for both WS and
WS/DGAT family. Nine genes were chosen based on their homology to previously
identified WS or WS/DAGT. These characterizations showed that the Arabidopsis
At5g55340 encoded WS and a maize WS are able to synthesize wax ester using
fatty acids and primary alcohols. These two wax synthase exhibited distinct
substrate preference patterns. The maize WS is also capable of producing ethyl
esters and benzyl esters when proper substrates were provided.
Chapter III details a manuscript that expressing 9 WS or WS/DGAT genes
in Arabidopsis seeds along with jojoba KCS and jojoba FAR. The analysis showed
that KCS and FAR successfully increase VLCFA in seed oil and generated
noticeable amounts of primary alcohols. Analysis of transgenic line with At5g55380
from Arabidopsis found wax esters in the seed oil. Dr. Ling Li conducted the
promoter::GUS experiments in this chapter; this was done under the supervision of
Dr. Eve Wurtele.
Chapter IV contains a genetic study of Arabidopsis T-DNA insertion lines. I
characterized two T-DNA mutants in the WS gene At5g55380. This study indicates
that At5g55380 may be redundant in the ability of the plant to produce wax esters.
10
In this chapter, I also discuss the need of combining reverse genetic approaches
with heterologous expression studies to best characterize wax synthase genes. Dr.
Yuqin Jin discovered morphological phenotypes on the original SALK_060303 TDNA insertion mutant and it was used for further analysis in this chapter. Dr. Marna
Yandeau-Nelson helped design the allelism-test experiment to determine the
association between the T-DNA insertion sites, and the mutation causing the
morphological phenotypes. The last chapter, Chapter V, contains general
conclusions from Chapters II, III, and IV and additionally discusses potential future
research.
This dissertation was under the guidance, supervision and support of my
major professor, Dr. Basil J. Nikolau.
11
REFERENCES
Baker E (1982) Chemistry and morphology of plant epicuticular waxes. Cutler, D,
F,, Alvin, K, L,, Price, C, E ed (s). The plant cuticle. Academic Press: London,
etc: 139-165
Bargel H, Koch K, Cerman Z, Neinhuis C (2006) Structure-function relationships
of the plant cuticle and cuticular waxes - a smart material? Functional plant
biology 33: 893-910
Benzioni A, Van Boven M, Ramamoorthy S, Mills D (2006) Compositional
changes in seed and embryo axis of jojoba (Simmondsia chinensis) during
germination and seedling emergence. Industrial crops and products 23: 297303
Budke J, Goffinet B, Jones C (2011) A hundred-year-old question: is the moss
calyptra covered by a cuticle? A case study of Funaria hygrometrica. Annals
of botany 107: 1279-1286
Cheng JB, Russell DW (2004) Mammalian wax biosynthesis. II. Expression cloning
of wax synthase cDNAs encoding a member of the acyltransferase enzyme
family. J Biol Chem 279: 37798-37807
Crum H (2001) Structural diversity of bryophytes. Recherche 67: 02
Edwards D, Abbot GD, JA R (1996) Cuticles of early land plants. Plant cuticles: an
integrated functional approach: 1-31
Jenks MA, Tuttle HA, Eigenbrode SD, Feldmann KA (1995) Leaf Epicuticular
Waxes of the Eceriferum Mutants in Arabidopsis. Plant Physiol 108: 369-377
Jetter R, Kunst L (2008) Plant surface lipid biosynthetic pathways and their utility
for metabolic engineering of waxes and hydrocarbon biofuels. Plant Journal
54: 670-683
Jetter R, Kunst L, Samuels AL (2006) Compasition of plant cuticular waxes.
Biology of the Plant Cuticle, Annual Plant Review 23: 145-181
Kalscheuer R, Steinbuchel A (2003) A novel bifunctional wax ester synthase/acylCoA:diacylglycerol acyltransferase mediates wax ester and triacylglycerol
biosynthesis in Acinetobacter calcoaceticus ADP1. J Biol Chem 278: 80758082
Koch K, Bhushan B, Barthlott W (2008) Diversity of structure, morphology and
wetting of plant surfaces. Soft matter 4: 1943-1963
12
Kolattukudy PE (1976) Chemistry and biochemistry of natural waxes. Elsevier
Scientific Publishing Company
Koornneef M, Hanhart C, Thiel F (1989) A genetic and phenotypic description of
eceriferum (cer) mutants in Arabidopsis thaliana. Journal of Heredity 80: 118122
Kunst L, Samuels AL (2003) Biosynthesis and secretion of plant cuticular wax.
Prog Lipid Res 42: 51-80
Lai C, Kunst L, Jetter R (2007) Composition of alkyl esters in the cuticular wax on
inflorescence stems of Arabidopsis thaliana cer mutants. Plant J 50: 189-196
Lardizabal KD, Metz JG, Sakamoto T, Hutton WC, Pollard MR, Lassner MW
(2000) Purification of a jojoba embryo wax synthase, cloning of its cDNA, and
production of high levels of wax in seeds of transgenic arabidopsis. Plant
Physiol 122: 645-655
Li F, Wu X, Lam P, Bird D, Zheng H, Samuels L, Jetter R, Kunst L (2008)
Identification of the wax ester synthase/acyl-coenzyme A: diacylglycerol
acyltransferase WSD1 required for stem wax ester biosynthesis in
Arabidopsis. Plant Physiol 148: 97-107
Martin JT, Juniper BE (1970) The cuticles of plants. The cuticles of plants.
Post-Beittenmiller D (1998) The cloned eceriferum genes of Arabidopsis and the
corresponding glossy genes in maize. Plant Physiology and Biochemistry 36:
157-166
Raven JA, Edwards D (2004) Physiological evolution of lower embryophytes:
adaptations to the terrestrial environment. The Evolution of Plant Physiology:
From Whole Plants to Ecosystems ed. Hemsley A, Poole I: 17-41
Riederer M, Schreiber L (1995) Waxes: the transport barriers of plant cuticles. In,
Vol 6. The Oily Press: Dundee, Scotland, pp 131-156
Samuels L, Kunst L, Jetter R (2008) Sealing plant surfaces: cuticular wax
formation by epidermal cells. Annu Rev Plant Biol 59: 683-707
Shaw AJ (2003) Structural Diversity of Bryophytes. The Bryologist 106: 343-343
Shi S, Valle-Rodriguez JO, Khoomrung S, Siewers V, Nielsen J (2012)
Functional expression and characterization of five wax ester synthases in
Saccharomyces cerevisiae and their utility for biodiesel production.
Biotechnology for Biofuels 5: 7
13
Stöveken T, Kalscheuer R, Malkus U, Reichelt R, Steinbuchel A (2005) The wax
ester synthase/acyl coenzyme A:diacylglycerol acyltransferase from
Acinetobacter sp. strain ADP1: characterization of a novel type of
acyltransferase. J Bacteriol 187: 1369-1376
Stoveken T, Steinbuchel A (2008) Bacterial acyltransferases as an alternative for
lipase-catalyzed acylation for the production of oleochemicals and fuels.
Angewandte Chemie-International Edition 47: 3688-3694
Teerawanichpan P, Qiu X (2010) Fatty acyl-CoA reductase and wax synthase from
Euglena gracilis in the biosynthesis of medium-chain wax esters. Lipids 45:
263-273
14
CHAPTER II. HETEROLOGOUS EXPRESSION OF WS
GENES IN MICROBIAL SYSTEMS
In preparation for submission to the Journal of Plant physiology
Daolin Cheng1 and Basil J. Nikolau1
1Roy
J. Carver Department of Biochemistry, Biophysics and Molecular Biology, Iowa
State University, Ames, IA 50011
ABSTRACT
Wax esters occur widely among bacteria, plants and mammals. There are
three gene families encoding enzymes capable of synthesizing wax esters. Two of
them exist in plans; the jojoba-like wax synthase (WS), and the bifunctional wax
synthase/diacylglycerol acyl transferase (WS/DGAT). In this paper, we investigated
the phylogenetic relationships among and between WS and WS/DGAT, based upon
primary sequence homology of the encoded proteins. Nine candidate genes were
chosen for experimental characterization using yeast as a heterologous expression
host. Three of the expressed gene products were detected immunologically,
Arabidopsis WS At5g55340, a maize WS and a moss WS. Moreover, by feeding
these transgenic yeast strains with potential fatty acid and fatty alcohol substrates,
we demonstrated that At5g55340 and the maize WS were expressed in a functional
state, and could direct the synthesis of novel ester lipids. Based upon the ability to
form different esters from different precursors, we were able to deduce the substrate
preferences of these two enzymes. These characterizations indicate that
At5g55340-encoded WS has a rather narrow substrate preference, producing
15
esters with linear fatty acids and fatty alcohols of about equal chain length. In
contrast the maize WS has a wider substrate preference, producing similar linear
esters as At5g55340, but also benzyl and ethyl esters.
Introduction
Wax esters are linear molecules consisting of a long chain fatty acid
esterified with a long chain alcohol. They are found in a wide variety of organisms
including bacteria, plants and animals. Due to their special properties, they have
many applications such as lubricants, cosmetics, pharmaceutical products, ink,
polishes and candles. For example, whale oil, which is primarily composed of wax
esters was considered one of the best lubricants, and used in specialized lubrication
precision instruments. Despite the fact that wax esters are very common in nature,
the abundance of wax ester is very low because only a few organisms can
accumulate wax ester, and most organisms produce just trace amounts of these
chemicals. Sperm whale oil contains up to 95% of wax ester, consisting of 34
carbons (Crisp et al., 1984). Whales were an excellent source of wax ester, until
whale hunting was banned internationally since the 1980s. The best alternative to
whale oil is now jojoba oil, which is the seed oil from the desert shrub jojoba. This
seed oil contains 97% of C38 to C44 wax esters (Jetter and Kunst, 2008). Although
at much lower amounts, wax esters can also be found in surface cuticular lipids,
which form the thin hydrophobic layer that covers outermost surfaces of the aerial
tissues of terrestrial plants. Together with other plant surface lipids, they create a
barrier between the plant and the environment. This layer controls non-stomatal
water loss (Riederer and Schreiber, 2001), protects from UV radiation (Krauss et al.,
16
1997; Solovchenko and Merzlyak, 2003; Pfüindel et al., 2006), keeps surfaces from
attaching particles including dust, pollen and pathogen spores, and regulates plant
interaction with insects, bacterial and fungal pathogens (Eigenbrode, 2004; Carver
and Gurr, 2008; Leveau, 2008; Müller, 2008). The cuticle can also prevent organ
fusion during plant development (Lolle et al., 1998; Sieber et al., 2000).
Wax esters in plant cuticular lipids vary from species to species, and even
within a single species there are variations among different surfaces of a plant. For
example, Arabidopsis leaf and stem surfaces contain 0.1% to 0.2% and 0.7% to
2.9% of wax esters, respectively (Jenks et al., 1995), whereas this number could be
as high as 85% in leaf wax of the carnauba palm, Copernicia cerifera (Kolattukudy,
1976). Wax esters in the same organism are usually a mixture of different carbon
chain lengths, consisting of different chain lengths of carboxylic acids and alcohols.
The physical and chemical properties of wax esters are determined by the fatty acid
and primary alcohol moieties. Thus, understanding the wax ester biosynthetic
pathway is essential to generate wax esters with optimal properties for special
applications.
The final step of wax ester biosynthetic pathway is catalyzed by wax
synthase, which transfers the acyl group from an acyl-CoA to a fatty acyl alcohol.
There are three unrelated families of wax synthases found in higher plants,
mammals and bacteria (Jetter and Kunst, 2008). The jojoba-like WS family, the first
identified plant wax synthase was from jojoba embryo. The jojoba enzyme uses a
wide range of saturated and unsaturated acyl-CoAs with a chain length from 14
carbons to 24 carbons, with 20:1 being the preferred substrate, and exhibits highest
17
activity with C18:1 alcohol (Lardizabal et al., 2000). Later, a second member of this
WS family was identified from Euglena. It can utilize fatty acids from 12:0, 14:0, 16:0
and 16:1-9, with 14:0 being the most favored fatty acid substrate; and the preferred
primary alcohols substrates are 12:0, 14:0, 16:0 and 16:1-9 with 16:1-9Alc
(Teerawanichpan and Qiu, 2010). The second family type of WS was first identified
in
Acinetobacter
calcoaceticus,
and
is
the
WS/DGAT
(Acyl-Coenzyme
A:Diacylglycerol) family. Enzymes in this family exhibit both WS and DGAT activity,
thus can utilize both primary alcohols and more complex alcohols (DAG) as
substrates. The Acinetobacter WS/DGAT enzyme shows a preference for C14 and
C16 acyl-CoA substrates together with C14 to C18 primary alcohols when acting as
WS (Kalscheuer and Steinbuchel, 2003; Stöveken et al., 2005). A second WS/DGAT
type enzyme is the WSD1 gene of Arabidopsis, and it is capable of using C18, C24
and C28 alcohols and C16 fatty acid to produce wax esters (Li et al., 2008). The
third WS family, is the mammalian wax synthase, and it was first identified from mice
(Cheng and Russell, 2004). This third WS family of enzymes, have the highest
activity with acyl-CoAs of between C12 and C16 in and primary alcohols shorter
than 20 carbons (Cheng and Russell, 2004). There are no obvious plant orthologs
in this third WS family (Li et al., 2008). In general, WSs naturally accept acyl groups
with carbon chain length of C16 or C18 and primary alcohols with carbon chain
length ranging from C12 to C20 (Shi et al., 2012). Reported activities of WSs with
short chain alcohols are low (Stoveken and Steinbuchel, 2008).
The most common platforms for studying these WSs are E. coli and yeast
(Saccharomyces cerevisiae). E. coli has been successfully used as a heterologous
18
expression system for some WS/DGAT enzymes (Kalscheuer and Steinbuchel,
2003; Stöveken et al., 2005; Li et al., 2008). Considering that most of these enzymes
are from eukaryotic organisms and membrane associated, it's not surprising that
successful examples are quite rare. Actually, none of WS from jojoba family has
been characterized in E. coli; only a few WS/DGATs have been expressed in E. coli.
Another characterized eukaryotic factory, which has been proven to work, better for
WSs is yeast. Besides advantages that include the ease of cultivation and genetic
manipulation, short generation time and extensive knowledge about its metabolism
(Tehlivets et al., 2007; Nielsen, 2009; Beopoulos et al., 2011; Matsuda et al., 2011),
for this study a quadruple yeast mutant strain, H1246 was used. This strain carries
mutations in four genes that are responsible in the biosynthesis of ester-lipids,
specifically triacylglycerol (TAG) and sterol ester biosynthesis. Therefore, in this
strain potential substrates will not flow to TAG and sterol ester biosynthesis sinks,
which we are not of interest to this study.
In this study, we selected candidate jojoba-like WS and WS/DGAT genes
from Arabidopsis, soybean, maize and moss, and we report on their characterization
following heterologous expression in yeast. These characterizations identified
enzymes with distinct substrate specificities.
19
Materials and methods
Phylogenetic tree constructions
TBlastn analysis was used to identify protein sequences in the NCBI NR
database that are homologous to the jojoba WS-like and WS/DGAT family. The
query sequences for this search were the amino acid sequences of experimentally
characterized jojoba WS family and WS/DGAT family, and, 12 Arabidopsis WS
homologs and 11 Arabidopsis WS/DGAT (Table 1). Homologs were selected based
on the score threshold >200, an E-value >0.001. These identified homologs were
added to a second query list and the search was repeated. Such iterations of the
Tblastn analyses were repeated until no new homologs were identified.
The selected homologs were imported to MEGA 4.0 and amino acid
sequences were pairwise aligned by MEGA, and a phylogenetic trees were
constructed (Tamura et al., 2007). The phylogenetic tree of the jojoba WS-like
homologs was out-grouped with the experimentally characterized bi-functional
WS/DGAT sequences, and the phylogenetic tree of the WS/DGAT homologs was
out-grouped with the experimentally characterized jojoba WS-like sequences. Each
tree was assembled its rigor tested with Neighbor-joint method with a bootstrap of
N=1000 (Saitou and Nei, 1987).
Codon optimization and chemical gene synthesis
In order to improve protein expression in heterologous systems, all WS
sequences were codon-optimized for yeast using the tool provided by GenScript
(http://www.genscript.com). Codon optimization significantly reduced codon bias of
20
the final coding sequences and also eliminated extreme GC content, repetitive
sequences, and avoided unfavorable mRNA secondary structure and unnecessary
restriction sites. Chemically synthesized, codon-optimized genes were obtained
from GenScript, and they were delivered as pUC57 clones.
Plasmid construction
All target genes were cloned into expression systems using Gateway
Technology (Landy, 1989). Target genes were PCR amplified from pUC57-clones
with primers that contained the CACC nucleotide sequence at the beginning of
forward primers, at the 5’-end of each gene. PCR products were purified and added
to TOPO cloning reaction, cloning the ORF into a Gateway Entry Vector (Invitrogen,
Carlsbad, CA). Target genes were then transferred to the Gateway destination
vector pYES-DEST52. This vector is capable of performing LR recombination
reaction with the entry vector.
Heterologous Expression in Saccharomyces cerevisiae
Plasmid pYES-DEST52 carrying different WS cDNA homolog were
transformed into yeast (S. cerevisiae) strains H1246 (MATα; are1-Δ::HIS3 are2Δ::LEU2 dga1-Δ::KanMX4 lro1-Δ::TRP1 ADE2) (Oelkers et al., 2002; Sandager et
al., 2002) using electroporation (Neumann et al., 1996). Plasmid pYES2.1
transformed yeast strains were used as negative controls.
Transformed yeast strains were grown at 30°C for 24 hours in 10 ml of the
synthetic dropout medium containing 0.17% (w/v) yeast nitrogen base, 0.5% (w/v)
ammonium sulfate, 2% (w/v) glucose and 0.06% (w/v) dropout supplement lacking
21
uracil (DOB + GLU-URA). The yeast cells were collected by centrifugation and
resuspended in 25 ml of the same synthetic dropout medium, except glucose was
replaced with 2% (w/v) raffinose. After 24 hours growth, the expression of the
transgenes was induced by culturing the yeast at 20°C for 24 hours in 25 ml of the
same synthetic dropout medium but this time containing 2% (w/v) galactose, 1%
(w/v) raffinose as the carbon-source (DOB + GAL + RAF-URA). This induction
medium was also supplemented with fatty acids or different alcohols as substrates
for the expressed WS. After induction, cells were harvested, and analyzed for
protein expression or accumulation of wax esters. For the substrate feeding
experiments, 10 mM fatty acids and/or 10 mM alcohols (dissolved in ethanol or
DMSO) were used as 200X stock solution, and these substrates were supplemented
in the media at a final concentration of 50 uM. In these experiments 10 ml of culture
was withdrawn, the cells were collected by centrifugation, and lyophilized for lipid
extraction.
Western blot analysis
Yeast cells were extracted using Invitrogen Standard Protocol (Invitrogen,
Carlsbad, CA). Protein samples were resolved by sodium dodecyl sulfate–
polyacrylamide gel electrophoresis (SDS–PAGE), and the proteins were transfer to
a PVDF (polyvinylidene difluoride) membrane (GE Healthcare Bio-Science KK,
Piscataway,
NJ).
Protein
signals
were
detected
using
the
enhanced
chemiluminescence method (ECL, Amersham, Piscataway, NJ). Primary antibody
was anti-His tag monoclonal antibody (BioRad, Hercules, CA). Secondary antibody
was goat–anti-mouse Ig conjugated to horseradish peroxidase (ECL). Blots were
22
developed with Pierce Super Signal West Pico Chemiluminescent substrate
(Thermo Fisher Scientific, Rockford, IL).
Yeast lipid extraction
The yeast lipids were extracted using a modified method previous described
(Bligh and Dyer, 1959). Prior to extraction, an aliquot of an internal standard was
added to the lyophilized cells. This internal standard was a solution of 5 mg/ml
behenyl dodecanoate (C34H68O2), and this was added at a rate of 10 µl per 100 mg
dry cell weight. To extract lipids, 1ml of near boiling methanol (60°C) was added to
each sample, it was vortexed and immediately incubated at 60°C for 1-min. After
cooling to room temperature, 500 µl of chloroform was added to the sample, and
mixed by vortexing for 30 seconds. Following the addition of 400 ul of ddH2O the
sample was further vortexed for 5 minutes. An additional 500 ul of chloroform was
added, and again vortexed for 30 seconds. After a final addition of 500 ul of ddH2O
and vortexing for 30 seconds the mixture was filtered through a 0.45 um PTFE filter.
The two phases were separated by centrifugation at 5000g for 4 min, and the lower
chloroform layer was recovered and evaporated to dryness using a stream of
nitrogen gas.
Thin-layer chromatography (TLC)
The dry lipid extract from yeast was dissolved in hexane, and the lipid
solution was spotted on silica gel plates (Sigma-Aldrich, St. Louis, MO). The solvent
hexane:diethyl ether:acetic acid (90:7.5:1, v/v) was used to develop the plates (Li et
al., 2008). TLC reference standards (alkane: C22H46, sterol ester: Cholesterol
23
dodecanoate, wax esters: behenyl dodecanoate (C34H68O2), triacylglycerols: canola
oil, free fatty acids: palmitic acid, primary alcohols: octadecanol, sterols: ergosterol)
were dissolved in hexane at a concentration of 0.5 mg/ml each. The TLC plate was
air dried after development. The TLC plate was then sprayed with primuline solution
(Taki et al., 1994) (5 mg in 100 ml of acetone/water, 80/20, v/v) with a Sigma glass
sprayer. The plate was visualized under UV illumination.
GC/MS analysis
Lipid samples were silylated for GC analysis (Martin and Synge, 1941). An
aliquot of 1-µL silylated lipid sample was injected into Agilent Technologies Model
6890 Gas Chromatograph equipped with an Agilent 19091S-433 column (30.0m x
250 um x 0.25 um), coupled to a Model 5973 Mass Selective Detector capable of
electrical ionization (EI). The temperature programs used in this study were 50 °C
for 1 minute, then 25 °C per minute to 200 °C, then 200 °C for 2 minute, then 10 °C
per minute to 280 stay for 2 minutes, then 20 °C per minute to 320 stay for 20
minutes.
Results
Phylogenetic classification of WS and WS/DGAT sequences
Twelve jojoba WS-like genes have been identified in Arabidopsis based on
sequence homology to the jojoba wax synthase amino acid sequence (Lardizabal
et al., 2000; Beisson et al., 2003; Kunst and Samuels, 2003; Klypinaa and Hanson,
2008). These proteins share a high degree of homology, being of similar size, and
sharing high degree of sequence similarity and identity (
24
(Continued on next page)
Figure ).
Tblastn (Altschul et al., 1990; Altschul et al., 1997) was used to search for
additional homologs of the jojoba-like wax synthase. This search conducted in
August, 2009 identified 52 homologs of the jojoba-like wax synthase.
The jojoba WS-like family phylogenetic tree was constructed using these 52
putative homologs from many species, using the three known WS/DGAT proteins
as the out-group (Figure 2). All but one of the 52 WS family members is sourced
from higher plants of both monocots and dicots; the one exception is from a moss
(Physcomitrella patens subsp. patens.). No organisms lower than a moss was
included in this tree. The tree can be divided into 3 major clades: moss, monocots
and dicots. In the dicots clade, each species has multiple homologs. Homologs from
same species did not clustered in the same branch. The monocots clade has only
four representative homologs (1 from S. bicolor and Z. mays, and 2 from rice).
The WS/DGAT family phylogenetic tree was constructed using 171 putative
WS/DGAT homologs identified by Tblastn, using known WS/DGAT amino acid
sequences and their homologs in Arabidopsis as the query (Figure 3). Besides the
homologs from plants, this phylogenetic tree also contains many homologs from
bacteria. Homologs from the same species in the WS/DGAT tree tend to cluster
together, indicating that gene duplication events after speciation is probably the
evolutionary origins of these homologs. Only one moss WS/DGAT homolog was
found, similar to the jojoba-like WS family.
25
Selecting candidates for functional characterization
Based on the phylogenetic classification of wax ester biosynthesis genes (Figure 2
& Figure 3), six putative jojoba WS-like and three WS/DGAT homologs from
several different species were chosen for functional characterization (Table 2).
(They will be referred as gene names in this table for the rest of this paper) In
Arabidopsis there are 11 WS homologs in the genome, and 8 of them are
physically clustered adjoining each other on chromosome 5. We selected 3 of
these (At5g55320, At5g55340 and At5g55380) that phylogenetically fall into three
different Arabidopsis clades, which would enable us to investigate if these genes
that probably arose via gene duplication events have also functionally diverged.
At5g55320 was picked because it’s located on another phylogenetic sub-clade
and it is specifically expressed in reproductive organs, such as flowers and
siliques. At5g55380 was chosen because it has highest expression level among
the genes that form its sub-clade (Klypinaa and Hanson, 2008). At5g55340 was
also selected based on its high expression among tissues and the fact that it is in
a different sub-clade than At5g55320 and At5g55380. We also selected three WS
homologs from soybean, maize and moss that are phylogenetically distinct from
the Arabidopsis WS clade. WS/DGATs from soybean, maize and moss were also
chosen as their WS corresponding genes and there is a good chance that at least
one of them is responsible for wax ester synthesis since all of them only have one
or two WS and WS/DGAT homologs. It might provide useful information about
function redundancy and pathway regulation in soybean, maize and moss.
Protein structure computation
26
All the homologs are predicted to be integral membrane proteins, and the
transmembrane domain topology was calculated with hydropathy analysis using
TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) (Emanuelsson et
al., 2007). All 6 jojoba-like WS homologs 7 or 8 transmembrane domains, while
WS/DGAT homologs usually have 1 or 2 transmembrane domains (Figure 4).
Expression of WS and WS/DGAT homologs in yeast
Earlier published experiences indicate that expression of such integral membrane
proteins as WS and WS/DGAT is difficult and risky in microbial hosts (Lardizabal
et al., 2000). We therefore utilized a heterologous expression system and strategy
that reduced some of the complexity of these experiments, and reduced the risks
associated with obtaining functional expression. First, all cDNAs coding for WS
and WS/DGAT sequences were codon optimized for yeast expression, and
chemically synthesized. Second Gateway technology (Landy, 1989) was used to
provide a rapid and highly efficient means of transferring genes from an entry
vector to multiple expression vector systems that are capable of expressing the
target genes in different hosts. To express the WS and WS/DGAT homologs in
yeast, we were only able to clone seven cDNAs into the yeast destination vector
pYES-DEST52 (Table 3), and the recombinant vectors were introduced in yeast
strain H1246 (Sandager et al., 2002). Due to interruption of four TAG and sterol
ester synthesis genes, H1246 is ideal for wax ester study since fatty acyl CoAs in
this strain will be directed to wax ester synthesis only.
27
Heterologous expression of each construct was evaluated by immunological
western blot analysis of protein extracts prepared from yeast strains, using anti-his
tag serum. This antibody detected the 6xHis-tag that was fused to the C-terminus
of the WS and WS/DGAT sequences as they were cloned into pYES-DEST52.
Using this assay, the culture condition for expression of each construct was
optimized. These analyses established that we obtained detectable expression of
At5g55340, At5g55380 and the maize WS (Figure 5). No immunological bands
were detected in either yeast strain with empty vector or in strains that were not
induced with galactose.
In vivo functional characterization of WS and WS/DGAT homologs expressed
in yeast H1246
The activity of the putative WS and WS/DGAT was investigated by feeding the
yeast H1246 strains carrying each WS or WS/DGAT transgenes with a variety of
potential substrates. Fatty acids of different chain lengths and many potential acyl
group acceptors were included in the feeding list, including primary alcohols,
branched alcohols, sterols, aromatic alcohols, methanol and ethanol. These acyl
donors and acceptor were fed into the medium in pairs so that the identification of
the ester product would be facilitated.
TLC analysis of the lipids extracted from the recombinant yeast strains that
express the WS or WS/DGAT revealed that the lipid profiles remain the same as
the empty vector control and non-recombinant strains when grown in induction
medium with or without fatty acids supplemented as potential substrates. In
28
contrast, cultivation of these strains in induction medium containing acyl donor
(fatty acid) and acyl acceptors (alcohols), led to the formation of esters (Figure 6).
When all transgenic yeast strains were fed with fatty acid and primary alcohol
mixtures including C13:0, C15:0, C17:0, C19:0 of both kinds, there were spots comigrated with wax ester standard in strains carrying At5g55340 and maize WS
(Figure 6A). In feeding experiment with fatty acids, benzyl alcohol and phenylethyl
alcohol mixture provided, there was also a spot co-migrate with wax ester
standard in maize WS carrying strain (Figure 6B). Similarly, when maize WS
transgenic strain was fed with 0.2% ethanol (v/v) and fatty acid mixture, it also
synthesized some lipid that would co-migrate with wax ester standard (Figure 6C).
To further test their substrate specificity with fatty acid and primary alcohols,
strains carrying at5g55340 and maize WS, were fed with combinations of one fatty
acid with chain length of C13:0, C15:0, C17:0, C19:0 and one alcohol with chain length
of C13:0, C15:0, C17:0, C19:0 (Figure 7 above; Figure 8 above). To compare enzyme
activity with saturated and unsaturated substrates, C14:0 and C14:1 fatty acids and
C16:0 and C16:1 primary alcohol were fed in combinations, too (Figure 7 below;
Figure 8 below). GC/MS analysis of yeast lipids revealed that At5g55340 prefers
median chain substrates than long chain substrates; maize WS also prefers
median chain substrate and it cannot used primary alcohols with chain length
longer than 15 carbons. When compare saturated and unsaturated substrates,
both of them have high activity with unsaturated primary alcohols.
29
The maize WS also exhibited activities when fed with ethanol, ethyl ester were
found in the lipid profile. Ethyl esters were found (). Analyzed by GC/MS, it is most
efficient incorporating C17:0 fatty acid into ethyl ester (Figure 9). When
synthesizing ethyl ester, it still prefers unsaturated fatty acid with a 4-fold higher
activity. It also synthesized aromatic ester when fed with benzyl and fatty acid. GC
separated aromatic ester and we were able to identified it was benzyl ester. It is
unable to use fatty acids with a chain length longer than 15 carbons (Figure 10).
C13:0 fatty acid has much higher activity than C15:0. This enzyme also prefers
unsaturated fatty acid when fed with benzyl alcohol and fatty acids.
Discussion
Metabolite profiling experiments indicate that wax esters are widely
occurring in many taxonomic classes suggesting that the wax ester biosynthetic
pathway is expressed in animals, plants and even microorganisms (Jetter and
Kunst, 2008). Yet knowledge concerning the distribution of this pathway is rather
limited, with only a few WSs and WS/DGATs enzymes and genes having been
functionally identified (Lardizabal et al., 2000; Kalscheuer and Steinbuchel, 2003;
Stöveken et al., 2005; Li et al., 2008; Teerawanichpan and Qiu, 2010; Barney et
al., 2012). In this study, sequence similarity was used to identify homologs of WSs
and WS/DGATs from many organisms, using BLAST (Altschul et al., 1990;
Altschul et al., 1997). Amino acid sequence alignment of the selected proteins
revealed that these homologs share very high identity and similarity among their
own families, even though they may have different types of fatty acyl-CoA and
alcohol substrates.
30
The jojoba-like WS family homologs all have the absolutely conserved
histidine and glutamate residues (analogous to H254, E255 in jojoba WS)
embedded in a hydrophobic region postulated to be part of the membrane-bound
O-acyltransferase superfamily (MBOAT) active site (Hofmann, 2000). In addition,
almost all putative plant WS proteins contain a highly conserved asparagine
residue (analogous to N210 in the jojoba WS). This residue is conserved in all
plant homologs, except At5g51420 where this residue is a threonine. This
homolog is predicted to be a larger protein than the other WS, with 435 residues,
whereas other plant homologs all have 333-345 residues. Also the expression of
the At5g51420 gene has never been detected by RT-PCR or any of the publicly
available gene expression database (Costaglioli et al., 2005; Klypinaa and
Hanson, 2008). These characteristics suggest that At5g51420 is very likely to be a
pesudogene, at least not the best candidate for this research.
The 52 WS homologs that were identified by BLAST analysis were
phylogenetically classified based upon primary sequence similarity. The analyses
segregated the sequences based upon their taxonomic source, i.e., the monocot,
dicot groups and one member from mosses. This finding suggests that these
genes emerged before the divergence of moss, monocots and dicots. In the
monocots node, there are homologs from maize (Zea mays), rice (Oryza sativa),
and milo (Sorghum bicolor). Inside the dicots cluster, the separation among
species is not so clear. The homologs from one species usually are separated in
to two, even three groups. For example, homologs from Vitis vinifera, some
clustered with jojoba WS, which has been characterized (Lardizabal et al., 2000);
31
some are closer to a branch containing At5g51970, which has been characterized
as a sterol acyltransferase (Chen et al., 2007); the rest clustered with soybean
and Ricinus communis. In Arabidopsis, except at5g51970 has been characterized
as sterol acyltransferase, the rest homologs from Arabidopsis are located in a
different cluster than jojoba WS, together with two WS homologs from Ricinus
communis. The phylogenetic tree of WS/DGAT family contains much more
homologs from bacteria. The plant half of this tree has similar distribution like WS
family. Monocots and dicots do not cluster with each other, but inside them,
homologs from same specie do not necessarily stay in the same branch. Moss
WS/DGAT homolog still stays out of monocots and dicots cluster but there are
WS/DGATs from soybean and grape stay close to moss WS/DGAT. After
phylogenetic studies, we chose 6 WS and 3 WS/DGAT proteins for this wax
biosynthetic pathway study.
The heterologous expression system we set up in this study can be used
as a platform for screening wax synthase. This platform covers, codon
optimization, optimized protein expression and in vivo functional enzyme assays.
We have shown that it is capable of expressing proteins that have multiple
transmembrane domains to a level that is sufficient for detection by western blot
analysis, which has never been achieved in previous studies. Adding the needed
substrates to the yeast growth medium and then analyzing the lipid extract for the
expected ester products was used to identify the substrate specificities of the
individual expressed WS proteins.
32
The yeast quadruple mutant strain (H1246) was useful in this WS
screening platform. Yeast itself does not synthesized wax esters, but the existing
triacylglycerol and sterol ester pathways could act as a lipid sink for the fatty acids,
and interfered with the in vivo assay for WS activity. In the yeast strain H1246,
mutations have eliminated TAG and sterol ester synthesis pathway, and this made
this yeast strain ideal for this study.
We have characterized two putative proteins in jojoba WS family and have
demonstrated that they are indeed WS enzymes. The protein encoded by
At5g55340 is capable of using fatty acids and primary fatty alcohols from 13
carbons and 19 carbons into wax ester. Optimum activity was observed when both
fatty acid and fatty alcohols have similar chain lengths. When comparing
substrates with same chain length but with or without double bounds, this enzyme
prefers saturated fatty acids and an unsaturated primary alcohol.
Compared to At5g55340, the maize WS shows broader substrate
specificity. Not only can it use primary alcohol as acyl group acceptor, but also
ethanol and benzyl alcohols. The ability of utilize long-chain primary alcohols is
much higher than utilizing ethanol or benzyl alcohols. This suggests that we shall
not only focus on fatty alcohol in the future when studying wax synthases. The
ability to synthesize ethyl esters and benzyl esters will be useful to engineering
biofuel producing organisms.
Moss WS was also expressed in yeast and could be detected by western
blot using anti-His-tag antibody. However, after fed with potential acyl acceptor
33
groups including primary alcohols, branched alcohols, sterols, aromatic alcohols,
methanol and ethanol, we still could not find any types of ester in the transgenic
yeast lipids. This could be caused by several reasons. First, we cannot rule out the
possibility that moss WS might not be functional in yeast due to protein posttranslational regulation differences between moss and yeast. Second, we have no
evidence that showed moss WS is wax synthase and based on its location on WS
phylogenetic tree, it is distant from all other WS homologs. Third, even moss WS
is functional and acts as a wax synthase, we might still need to feed the right
substrates in the medium and they might not be included in our feeding list since it
is not possible and certainty not practical to provide all possible substrates.
In summary, we demonstrated at5g55340, maize WS and moss WS can
be expressed after codon optimization in yeast. By feeding potential substrates
into the induction medium, we demonstrated that two of these proteins are
capable of assembling wax esters from different fatty acids and alcohols.
34
Figures and tables:
Organism
S. chinensis
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
Acinetobacter sp. ADP1
P. hybrida
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
A. thaliana
Gene
Jojoba-WS
At1g34490
At1g34500
At1g34520
At3g51970
At5g51420
At5g55320
At5g55330
At5g55340
At5g55350
At5g55360
At5g55370
At5g55380
ADP1-WS/DGAT
Petunia-WS/DGAT
At1g72110
At2g38995
At3g49190
At3g49200
At3g49210
At5g12420
At5g16350
At5g22490
At5g37300
At5g53380
At5g53390
Accession
AAD38041.1
AEE31719.1
AEE31720.1
AED96616.1
AAQ65159.1
AED96079.1
AED96616.1
AED96617.1
AED96618.1
AED96619.1
AED96620.1
AED96621.1
AAL91291.1
Q8GGG1.1
AAZ08051.1
NP_177356
AEC09622.1
NP_190488
NP_190489
NP_190490
NP_568275
NP_197139
NP_197641
NP_568547
NP_200150
NP_200151
Length
352
337
341
336
345
435
339
346
333
345
342
343
341
458
521
479
487
522
507
518
480
488
482
481
483
485
Table 1: Query amino acid sequences for WS and WS/DGAT family homolog BLAST.
Gene
WS
WS
WS
WS
WS
WS
WS
WS
WS
WS
WS
WS
WS
WS/DGA
WS/DGA
WS/DGA
WS/DGA
WS/DGA
WS/DGA
WS/DGA
WS/DGA
WS/DGA
WS/DGA
WS/DGA
WS/DGA
WS/DGA
35
Physcomitrella patens subsp.
patens
Z.mays
A. thaliana
A. thaliana
A. thaliana
G.max
Z.mays
Physcomitrella patens subsp.
patens
G.max
AED96616.1
AED96618.1
AAL91291.1
ACU22750.1
NP_001147171.1
XP_001765175.1
ACU20370.1
XP001780431.1
ACN31544.1
At5g55320
At5g55340
At5g55380
Soybean WS
Maize WS
Moss WS
Soybean
WS/DGAT
Moss WS/DGAT
Maize WS/DGAT
Table 2: Gene candidates for heterologous expression.
Organism
Gene
Accession
342
497
461
Length (amino
acids)
339
333
341
351
345
347
WS/DGAT
WS/DGAT
WS/DGAT
WS
WS
WS
WS
WS
WS
Family
36
37
(Continued on next page)
Figure 1: Multiple sequence alignment of Arabidopsis jojoba-like wax
synthase homologues and jojoba wax synthase. The multiple alignment of predict
amino acid sequences of Arabidopsis wax synthases and jojoba wax synthase
sequence was made with Clustal W.
38
Figure 1 continued
39
Figure 1 continued
40
91 V.vin.XP 002265856.1
100
V.vin.XP 002272250.1
100
V.vin.CAO21134.1
90
V.vin.CAO14447.1
V.vin.XP 002272329.1
100 V.vin.CAN64383.1
37
R.com.XP 002532421.1
88
39
R.com.XP 002532420.1
98
P.tri.ABK94277.1
100 P.tri.XP 002322536.1
27
R.com.XP 002527947.1
93
P.tri.XP 002313330.1
69
R.com.XP 002527949.1
81
P.tri.XP 002314065.1
P.tri.XP 002313329.1
31
100
P.tri.XP 002299916.1
P.tri.XP 002299545.1
50
M.tru.ABD33005.1
86
86
P.tri.XP 002322537.1
100
P.tri.XP 002308777.1
28
AT3G51970
Jojoba WS
V.vin.XP 002276902.1
96
69
26
V.vin.CAO38873.1
V.vin.XP 002276928.1
93
100
V.vin.CAN61367.1
66 V.vin.AAO18665.1
R.com.XP 002529023.1
99
R.com.XP 002529022.1
AT5G55370
100
AT5G55380
44
AT5G55350
76
84
99
44
AT5G55360
52
AT5G51420
AT5G55340
99
AT5G55330
AT5G55320
64
AT1G34500
55
AT1G34490
39
100
AT1G34520
G.max.ACU22750.1
54
R.com.XP 002529021.1
98
95
P.tri.XP 002311581.1
V.vin.XP 002276950.1
100
92
V.vin.AAO18666.1
100
100
V.vin.CAN76085.1
100
V.vin.XP 002276970.1
100 O.sat.NP 001046772.1
O.sat.EAY85727.1
100
S.bic.XP 002468615.1
100
Z.may.NP 001147171.1
P.pat.XP 001765175.1
Acinetobacter bifunctional WS/DGAT
Petunia WS/DGAT
100
At5g37300
0.2
Figure 2: Phylogenetic tree of the 12 Arabidopsis and other species
proteins related to jojoba WS, rooted with three identified WS/DAGTs. This
analysis using MEGA 4.0 was performed using the neighbor-joining tree with
1000 replicates; the handling gap option was pairwise deletion. Sequence
alignments were assembled by the ClustalW.
41
100 M.avi.NP 959281.1
100
M.avi.YP 879642.1
20
M.int.ZP 05227420.1
M.mar.YP 001848848.1
81
100 M.ulc.YP 905239.1
M.tub.NP 218251.1
M.kan.ZP 04750965.1
100
19
41
M.mar.YP 001853530.1
M.kan.ZP 04749348.1
100 M.mar.YP 001853537.1
99
M.ulc.YP 907824.1
M.kan.ZP 04747159.1
100
6
M.tub.ZP 03417976.1
75
100 M.bov.NP 857403.1
48 M.tub.NP 218257.1
100 M.sp..YP 001073143.1
M.sp..YP 641664.1
73
80
M.kan.ZP 04749239.1
100
M.ulc.YP 905962.1
M.int.ZP 05227585.1
100
M.avi.NP 959065.1
100
68
100 M.avi.YP 879422.1
93 M.avi.ZP 05214687.1
21
M.sme.YP 890540.1
N.far.YP 117375.1
33
N.far.YP 121795.1
R.jos.YP 701572.1
20
100
R.opa.YP 002778497.1
R.ery.YP 002764633.1
58
100 R.ery.ZP 04388235.1
G.bro.ZP 03887554.1
72
M.abs.YP 001705267.1
92 45
R.jos.YP 700081.1
100
R.opa.YP 002777402.1
K.fla.ZP 03860317.1
N.sp..YP 924893.1
R.jos.YP 702929.1
100
56
100
R.opa.YP 002779887.1
89
55
R.jos.YP 707847.1
R.jos.YP 705294.1
100
R.opa.YP 002782647.1
100
92
M.tub.ZP 03414875.1
M.tub.ZP 05140320.1
100
M.tub.ZP 03419291.1
49
M.tub.NP 215410.1
62
M.tub.ZP 02550609.1
59 M.tub.NP 335351.1
M.tub.ZP 03424082.1
M.gam.ZP 01626518.1
100
m.gam.ZP 05093434.1
100
S.ala.YP 615587.1
G.pro.ZP 01101223.1
56
100
G.pro.ZP 05126217.1
43 M.bov.YP 979623.1
40 M.tub.NP 217997.1
37
100 M.tub.NP 338129.1
M.tub.ZP 03426905.1
100
57 M.tub.ZP 03430367.1
100
M.mar.YP 001853214.1
M.gil.YP 001132329.1
89
100
M.van.YP 956544.1
75
M.gam.ZP 05095013.1
G.pro.ZP 04956551.1
L.sp..ZP 01915979.1
85
M.sp..ZP 01736818.1
99
41
M.alg.ZP 01893763.1
100
M.aqu.YP 960328.1
78
100 M.hyd.ABO21021.1
A.bor.YP 693524.1
100
A.sp..ZP 05043539.1
18
L.sp..ZP 01914209.1
A.bor.YP 694462.1
100
99
47
A.sp..ZP 05041631.1
99
H.che.YP 436128.1
99
M.aqu.YP 957462.1
100 M.hyd.ABO21020.1
P.arc.YP 263530.1
100
99
52
P.cry.YP 579515.1
100
P.sp..YP 001280730.1
P.sp..YP 001280731.1
A.rad.ZP 05360001.1
100
100 A.sp..YP 045555.1
100
Acinetobacter bifunctional WS/DGA
A.sp..ZP 03822105.1
36
76
A.bau.ABO13188.2
100
81
43
A.bau.YP 001847685.1
A.bau.ZP 04661667.1
31
A.bau.YP 001706290.1
28 A.bau.YP 001085790.1
41 A.bau.YP 001712672.1
V.par.YP 002946672.1
100
M.kan.ZP 04750465.1
89
M.kan.ZP 04750453.1
59
100
M.ulc.YP 905765.1
M.sp..ZP 01900421.1
M.sp..ZP 01899829.1
100
100
M.sp..ZP 01900085.1
M.tub.NP 216801.1
M.mar.YP 001851711.1
100
100 M.ulc.YP 906494.1
100 V.vin.CAN72806.1
100
V.vin.XP 002282418.1
85
G.max.ACU20370.1
P.pat.XP 001780431.1
71 O.sat.AAT58707.1
67
100
O.sat.EEE64643.1
O.sat.NP 001056279.1
O.sat.EAY98969.1
100
S.bic.XP 002440221.1
Z.may.ACN31544.1
100
85
71 Z.may.NP 001140997.1
O.sat.EAZ13098.1
61
O.sat.EEC71274.1
100
95 O.sat.NP 001043877.1
S.bic.XP 002459294.1
S.bic.XP 002458560.1
43
O.sat.EEE55448.1
100
99
60 O.sat.EAY75973.1
100
O.sat.NP 001044374.1
100
O.sat.BAD52718.1
49
O.sat.EAY75974.1
41
O.sat.EAZ13682.1
46
65
O.sat.NP 001044375.1
S.bic.XP 002447567.1
100 A.tha.ABF59162.1
A.tha.NP 190489.1
95
A.tha.BAF01088.1
100
100 A.tha.NP 190490.1
A.tha.NP 190488.1
16
P.tri.XP 002318416.1
71
R.com.XP 002516707.1
7 17
95
V.vin.CAO48523.1
100 V.vin.XP 002268615.1
A.tha.NP 197641.1
A.tha.NP 200150.1
96
4
A.tha.NP 197139.1
65
100
A.tha.NP 568275.1
A.tha.NP 177356.1
56 A.tha.BAB09801.1
100 A.tha.NP 200151.2
68
A.tha.BAC42871.1
100
50
A.tha.BAE98867.1
A.tha.NP 850307.1
99
At5g37300
91
100 A.tha.BAB09102.1
51 A.tha.NP 568547.1
P.x h.AAZ08051.1
100
Petunia WS/DGAT
P.hyb.AAZ08051.1
V.vin.CAN78450.1
62
V.vin.CAO42629.1
41
V.vin.CAO39781.1
12
54 V.vin.XP 002278404.1
10
P.tri.XP 002325936.1
100
P.tri.XP 002325937.1
92 V.vin.CAO42632.1
100
15
11
V.vin.XP 002262609.1
V.vin.CAO68567.1
4
G.max.ACU18891.1
R.com.XP 002523348.1
100 V.vin.CAN71951.1
59 V.vin.XP 002263137.1
4
100
V.vin.CAO14372.1
V.vin.XP 002263196.1
76
89
98
V.vin.CAN71950.1
V.vin.XP 002263409.1
V.vin.CAO14369.1
97
V.vin.CAO42627.1
V.vin.CAO68568.1
98
99
V.vin.CAO14368.1
98 V.vin.XP 002263252.1
Jojoba WS
0.1
42
Figure 3: Phylogenetic tree of the 233 proteins related to WS/DAGT,
rooted with jojoba WS and at5g55380. This analysis using MEGA 4.0 was
performed using the neighbor-joining tree with 1000 replicates; the handling gap
option was pairwise deletion. Sequence alignments were assembled by the
ClustalW. Gene candidates were marked with red frames.
43
At5g55320
Soybean WS
At5g55340
Maize WS
At5g55380
Moss WS
Soybean WS/DGAT
Moss WS/DGAT
Maize WS/DGAT
Figure 4: Hydropathy analysis of gene candidates in this study.
Hydropathy analysis was performed on all the 9 putative proteins chosen using
algorithm TMHMM (Emanuelsson, Brunak et al. 2007). Regions predicted to be
transmembrane domains are shown in bold red.
44
Table 3: Transgenic yeasts used in this study.
Expression Vectors
Gene Expressed
Yeast Strains
pYES-DEST52
At5g55340
H1246
pYES-DEST52
At5g55380
H1246
pYES-DEST52
Soybean WS
H1246
pYES-DEST52
Maize WS
H1246
pYES-DEST52
Moss WS
H1246
pYES-DEST52
Soybean
H1246
pYES-DEST52
Maize WS/DGAT
H1246
45
Figure 5: Western blot; WSs and WS/DGATs expressed in yeast strain
H1246. Vector: pYES-DEST52; 6X his-tag antibody. Protein were extracted from
0, 6 and 24 hours after these strains were cultivated in galactose medium.
46
A
Wax ester
Empty vector
Maize WS/DGAT
Soybean WS/DGAT
Moss WS
Maize WS
Soybean WS
At5g55380
At5g55340
Standards
B
C
Alkane
Wax ester
Alkane
Wax ester
TAG
FFA
Alcohol
Sterol
Maize WS/DGAT
Soybean WS/DGAT
Moss WS
Maize WS
Soybean WS
At5g55380
At5g55340
Empty vector
Maize WS/DGAT
Soybean WS/DGAT
Moss WS
Maize WS
Soybean WS
At5g55380
At5g55340
Empty vector
Standards
Standards
TAG
FFA
Alcohol
Sterol
Figure 6: TLC analysis of neutral lipids synthesized by recombinant yeast
H1246 strain carrying WS or WS/DGAT. All the yeast strain were grown in
induction medium, with feeding of: A: 50 nM fatty acids and primary alcohol
mixtures; B: 50 nM fatty acids and benzyl alcohol and phenylethyl alcohol; C: 50
nM fatty acids and 0.2% ethanol. Fatty acid and primary alcohol mixture contain
chain length of 13:0, 15:0, 17:0 and 19:0 carbons.
47
At5g55340
80
ALC 13:0
70
ALC 15:0
uM per 100mg CDW
60
ALC 17:0
50
ALC 19:0
40
30
20
ALC 19:0
ALC 17:0
ALC 15:0
10
0
FA 13:0
30
uM per 100mg CDW
25
FA 15:0
ALC 13:0
FA 17:0
FA 19:0
Saturated Vs. Unsaturated
20
15
10
5
0
Ester, FA 14:0,
16:0
Ester, FA 14:1,
16:0
Ester, FA 14:0,
16:1
Ester, FA 14:1,
16:1
Figure 7: Wax esters synthesized by At5g55340 in yeast H1246 transgenic strain
from feeding experiments. Above: saturated substrates of C13:0, C15:0, C17:0 and
C19:0 fatty acids and primary alcohols were fed in combinations. Below: C14:0 and
C14:1 fatty acids and C16:0 and C16:1 primary alcohols were fed in combinations.
48
Maize WS
14
ALC 13:0
uM per 100mg CDW
12
ALC 15:0
10
ALC 17:0
8
ALC 19:0
6
4
ALC…
ALC…
ALC…
2
0
FA 13:0
FA 15:0
ALC…
FA 17:0
FA 19:0
6
uM per 100mg CDW
Saturated Vs. Unsaturated
4
2
0
Ester, FA 14:0,
16:0
Ester, FA 14:0,
16:1
Ester, FA 14:1,
16:0
Ester, FA 14:1,
16:1
Figure 8: Wax esters synthesized by maize WS in yeast H1246 transgenic strain
from feeding experiments. Above: saturated substrates of C13:0, C15:0, C17:0 and
C19:0 fatty acids and primary alcohols were fed in combinations. Below: C14:0 and
C14:1 fatty acids and C16:0 and C16:1 primary alcohols were fed in combinations.
49
7
uM per 100mg CDW
6
Maize WS FAs&Ethanol
5
4
3
2
1
0
uM per 100mg CDW
FA 13:0 ethyl esterFA 15:0 ethyl esterFA 17:0 ethyl esterFA 19:0 ethyl ester
50
45
40
35
30
25
20
15
10
5
0
Saturated Vs. Unsaturated
Ester, FA 14:0, Ethyl
Ester, FA 14:1, Ethyl
Figure 9: Ethyl esters synthesized by maize WS in yeast H1246
transgenic strain from feeding experiments. Above: 0.2% ethanol and fatty acids
with C13:0, C15:0, C17:0 and C19:0 chain. Below: 0.2% ethanol and fatty acids with
C14:0, C14:1.
50
0.09
uM per 100mg CDW
0.08
Maize WS Benzyl ALC&FA
0.07
0.06
0.05
0.04
0.03
0.02
0.01
0
Ester, FA 13:0, Benzyl ALC
1.6
uM per 100mg CDW
1.4
Ester, FA 15:0, Benzyl ALC
Saturated Vs. Unsaturated
1.2
1
0.8
0.6
0.4
0.2
0
Ester, FA 14:0, Benzyl ALC
Ester, FA 14:1, Benzyl ALC
Figure 10: Wax esters synthesized by maize WS in yeast H1246
transgenic strain from feeding experiments. Fatty acids and benzyl alcohol were
fed in combinations.
51
REFERENCES
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment
search tool. Journal of molecular biology 215: 403-410
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ
(1997) Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic acids research 25: 3389-3402
Barney BM, Wahlen BD, Garner E, Wei JS, Seefeldt LC (2012) Differences in
Substrate Specificities of Five Bacterial Wax Ester Synthases. Applied and
Environmental Microbiology 78: 5734-5745
Beisson F, Koo AJK, Ruuska S, Schwender J, Pollard M, Thelen JJ, Paddock
T, Salas JJ, Savage L, Milcamps A, Mhaske VB, Cho YH, Ohlrogge JB
(2003) Arabidopsis genes involved in acyl lipid metabolism. A 2003 census
of the candidates, a study of the distribution of expressed sequence tags in
organs, and a Web-based database. Plant Physiology 132: 681-697
Beopoulos A, Nicaud J-M, Gaillardin C (2011) An overview of lipid metabolism in
yeasts and its impact on biotechnological processes. Applied microbiology
and biotechnology 90: 1193-1206
Bligh EG, Dyer WJ (1959) A rapid method of total lipid extraction and purification.
Canadian journal of biochemistry and physiology 37: 911-917
Carver TL, Gurr SJ (2008) 12 Filamentous fungi on plant surfaces. Annual Plant
Reviews, Biology of the Plant Cuticle 23: 368
Chen Q, Steinhauer L, Hammerlindl J, Keller W, Zou J (2007) Biosynthesis of
phytosterol esters: identification of a sterol o-acyltransferase in Arabidopsis.
Plant Physiol 145: 974-984
Cheng JB, Russell DW (2004) Mammalian wax biosynthesis. II. Expression cloning
of wax synthase cDNAs encoding a member of the acyltransferase enzyme
family. J Biol Chem 279: 37798-37807
Costaglioli P, Joubes J, Garcia C, Stef M, Arveiler B, Lessire R, Garbay B (2005)
Profiling candidate genes involved in wax biosynthesis in Arabidopsis
52
thaliana by microarray analysis. Biochim Biophys Acta 1734: 247-258
Crisp S, Eaton R, Tinsley H (1984) Scheme for the identification of sperm whale
oil and its products in commercial formulations and in leather articles. Analyst
109: 1497-1502
Eigenbrode SD (2004) The effects of plant epicuticular waxy blooms on attachment
and effectiveness of predatory insects. Arthropod Struct Dev 33: 91-102
Emanuelsson O, Brunak S, von Heijne G, Nielsen H (2007) Locating proteins in
the cell using TargetP, SignalP and related tools. Nat Protoc 2: 953-971
Hofmann K (2000) A superfamily of membrane-bound O-acyltransferases with
implications for wnt signaling. Trends Biochem Sci 25: 111-112
Jenks MA, Tuttle HA, Eigenbrode SD, Feldmann KA (1995) Leaf Epicuticular
Waxes of the Eceriferum Mutants in Arabidopsis. Plant Physiol 108: 369-377
Jetter R, Kunst L (2008) Plant surface lipid biosynthetic pathways and their utility
for metabolic engineering of waxes and hydrocarbon biofuels. Plant Journal
54: 670-683
Kalscheuer R, Steinbuchel A (2003) A novel bifunctional wax ester synthase/acylCoA:diacylglycerol acyltransferase mediates wax ester and triacylglycerol
biosynthesis in Acinetobacter calcoaceticus ADP1. J Biol Chem 278: 80758082
Klypinaa N, Hanson SF (2008) Arabidopsis thaliana wax synthase gene
homologues show diverse expression patterns that suggest a specialized
role for these genes in reproductive organs. Plant Science 175: 312-320
Kolattukudy PE (1976) Chemistry and biochemistry of natural waxes. Elsevier
Scientific Publishing Company
Krauss P, Markstadter C, Riederer M (1997) Attenuation of UV radiation by plant
cuticles from woody species. Plant, Cell & Environment 20: 1079 - 1085
Kunst L, Samuels AL (2003) Biosynthesis and secretion of plant cuticular wax.
53
Prog Lipid Res 42: 51-80
Landy A (1989) Dynamic, structural, and regulatory aspects of lambda site-specific
recombination. Annual review of biochemistry 58: 913-941
Lardizabal KD, Metz JG, Sakamoto T, Hutton WC, Pollard MR, Lassner MW
(2000) Purification of a jojoba embryo wax synthase, cloning of its cDNA, and
production of high levels of wax in seeds of transgenic arabidopsis. Plant
Physiol 122: 645-655
Leveau JH (2008) 11 Microbial communities in the phyllosphere. Annual Plant
Reviews, Biology of the Plant Cuticle 23: 334
Li F, Wu X, Lam P, Bird D, Zheng H, Samuels L, Jetter R, Kunst L (2008)
Identification of the wax ester synthase/acyl-coenzyme A: diacylglycerol
acyltransferase WSD1 required for stem wax ester biosynthesis in
Arabidopsis. Plant Physiol 148: 97-107
Lolle SJ, Hsu W, Pruitt RE (1998) Genetic analysis of organ fusion in Arabidopsis
thaliana. Genetics 149: 607-619
Müller C (2008) 13 Plant–Insect interactions on cuticular surfaces. Annual Plant
Reviews, Biology of the Plant Cuticle 23: 398
Martin A, Synge R (1941) A new form of chromatogram employing two liquid
phases: A theory of chromatography. 2. Application to the microdetermination of the higher monoamino-acids in proteins. Biochemical
Journal 35: 1358
Matsuda F, Furusawa C, Kondo T, Ishii J, Shimizu H, Kondo A (2011)
Engineering strategy of yeast metabolism for higher alcohol production.
Microbial Cell Factories 10
Neumann E, Kakorin S, Tsoneva I, Nikolova B, Tomov T (1996) Calciummediated DNA adsorption to yeast cells and kinetics of cell transformation by
electroporation. Biophysical journal 71: 868-877
Nielsen J (2009) Systems biology of lipid metabolism: From yeast to human. Febs
Letters 583: 3905-3913
54
Oelkers P, Cromley D, Padamsee M, Billheimer JT, Sturley SL (2002) The DGA1
gene determines a second triglyceride synthetic pathway in yeast. Journal of
Biological Chemistry 277: 8877-8881
Pfüindel EE, Agati G, Cerovic Z (2006) optical properties of plant surface. Annual
Plant Reviews 23: 216-249
Riederer M, Schreiber L (2001) Protecting against water loss: analysis of the
barrier properties of plant cuticles. J Exp Bot 52: 2023-2032
Saitou N, Nei M (1987) The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Molecular biology and evolution 4: 406425
Sandager L, Gustavsson MH, Ståhl U, Dahlqvist A, Wiberg E, Banas A, Lenman
M, Ronne H, Stymne S (2002) Storage Lipid Synthesis Is Non-essential in
Yeast. Journal of Biological Chemistry 277: 6478-6482
Shi S, Valle-Rodriguez JO, Khoomrung S, Siewers V, Nielsen J (2012)
Functional expression and characterization of five wax ester synthases in
Saccharomyces cerevisiae and their utility for biodiesel production.
Biotechnology for Biofuels 5: 7
Sieber P, Schorderet M, Ryser U, Buchala A, Kolattukudy P, Metraux JP,
Nawrath C (2000) Transgenic Arabidopsis plants expressing a fungal
cutinase show alterations in the structure and properties of the cuticle and
postgenital organ fusions. Plant Cell 12: 721-738
Solovchenko A, Merzlyak M (2003) Optical properties and contribution of cuticle
to UV protection in plants: experiments with apple fruit. Photochem Photobiol
Sci 2: 861-866
Stöveken T, Kalscheuer R, Malkus U, Reichelt R, Steinbuchel A (2005) The wax
ester synthase/acyl coenzyme A:diacylglycerol acyltransferase from
Acinetobacter sp. strain ADP1: characterization of a novel type of
acyltransferase. J Bacteriol 187: 1369-1376
Stoveken T, Steinbuchel A (2008) Bacterial acyltransferases as an alternative for
lipase-catalyzed acylation for the production of oleochemicals and fuels.
Angewandte Chemie-International Edition 47: 3688-3694
55
Taki T, Kasama T, Handa S, Ishikawa D (1994) A simple and quantitative
purification of glycosphingolipids and phospholipids by thin-layer
chromatography blotting. Analytical biochemistry 223: 232-238
Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary
genetics analysis (MEGA) software version 4.0. Molecular biology and
evolution 24: 1596-1599
Teerawanichpan P, Qiu X (2010) Fatty acyl-CoA reductase and wax synthase from
Euglena gracilis in the biosynthesis of medium-chain wax esters. Lipids 45:
263-273
Tehlivets O, Scheuringer K, Kohlwein SD (2007) Fatty acid synthesis and
elongation in yeast. Biochimica Et Biophysica Acta-Molecular and Cell
Biology of Lipids 1771: 255-270
56
CHAPTER III. ECTOPIC EXPRESSION OF WAX
PRODUCING GENES IN TRANSGENIC ARABIDOPSIS
SEEDS
In preparation for submission to the Journal of Plant physiology
Daolin Cheng1, Ling Li2, Eve Wurtele2 and Basil J. Nikolau1
1Roy
J. Carver Department of Biochemistry, Biophysics and Molecular Biology,
Iowa State University, Ames, IA 50011
2Department
of Molecular, Cellular and Developmental Biology, Iowa State
University, Ames, IA 50011
ABSTRACT
Two classes of enzyme catalyze the final reaction in the wax ester
biosynthetic pathway, the jojoba-like wax synthase (WS) and the bifunctional wax
ester synthase/acyl-CoA: diacylglycerol acyltransferase (WS/DGAT). In this study,
we chose 6 WSs and 3 WS/DGATs from Arabidopsis, soybean, maize and a moss
and expressed them in seeds of Arabidopsis Col-0. These transgenic events were
coupled with the co-expression of the jojoba 3-ketoacyl-CoA synthase (KCS) and
the jojoba fatty acid reductase (FAR). All three transgenes were under the control of
the regulatory sequence of the seed-specific Glycinin promoter. The presence of
mRNA of
these transformed
cDNAs was
confirmed by RT-PCR.
Gas
chromatographic analysis of transgenic seeds indicated that jojoba KCS and FAR
generated a substrate pool that contains very long chain fatty acids and long chain
primary fatty alcohols. The Arabidopsis transgenic line ectopically expressing the
At5g55380 WS produced wax esters in the seed oil.
57
Introduction
Wax esters are an important industrial commodity and have been
considered as having potential as next generation biofuels and biolubricants.
Traditionally, wax esters harnessed primarily from marine organisms have been
used in the lubricant, food, pharmaceutical and cosmetic industries. For example, a
grown whale can easily contain about 2000 liters of the spermaceti oil within its skull
that consists mainly of oleyl-oleate ester (Spencer and Tallent, 1973). This oil was
widely used as an excellent lubricant in all sorts of machinery, from fine mechanics
such as watches, to transmission fluids in modern vehicles. Whaling, as the most
efficient means to access large quantities of high quality wax esters directly caused
the extinction of many whale species. Whale hunting was banned worldwide in the
1980s in order to conserve whale species. In replacement, jojoba oil was considered
a best alternative to whale oil. The seed oil of jojoba contains 97% of C38 to C44
wax esters (Miwa, 1971). However, even after decades of breeding, jojoba is still
not suitable for large-scale cultivation. Thus, the quest to search for large scale
biological sources for wax esters is still not completed.
Wax esters are also found in surface lipids of aerial tissues of terrestrial
plants. Together with other plant surface lipids, they create a barrier between the
plant and the environment. This layer controls non-stomatal water loss (Riederer
and Schreiber, 2001), protects from UV radiation (Krauss et al., 1997; Solovchenko
and Merzlyak, 2003; Pfüindel et al., 2006), keeps surfaces from attaching particles
including dust, pollen and pathogen spores, and regulates plant interaction with
insects, bacterial and fungal pathogens (Eigenbrode, 2004; Carver and Gurr, 2008;
58
Leveau, 2008; Müller, 2008). The cuticle can also prevent organ fusion during plant
development (Lolle et al., 1998; Sieber et al., 2000). Although the concentration of
wax esters in plant surface lipids are very low, understanding their synthetic pathway
can provide valuable knowledge including the substrate preference, and efficiency
of the enzymes that assemble these lipids. This information can play a key role in
generating a genetically modified crop for wax ester production.
The final step of wax ester biosynthetic pathway is catalyzed by an enzyme,
which transfers the acyl group from an acyl-CoA to a fatty acyl alcohol. There are
three unrelated families of wax synthases found in higher plants, mammals and
bacteria (Jetter and Kunst, 2008). The jojoba-like wax synthase (WS) family, the first
identified plant wax synthase was from jojoba embryo. The jojoba enzyme uses a
wide range of saturated and unsaturated acyl-CoAs with a chain length from 14
carbons to 24 carbons, with 20:1 being the preferred substrate, and exhibits highest
activity with C18:1 alcohol (Lardizabal et al., 2000). Later, a second member of this
WS family was identified from Euglena. It can utilize fatty acids from C12:0, C14:0,
C16:0 and C16:1-9, with C14:0 being the most favored fatty acid substrate; and the
preferred primary alcohols substrates are C12:0, C14:0, C16:0 and C16:1-9 with C16:1-9
alcohol being the best substrate (Teerawanichpan and Qiu, 2010).
The second family type of WS was first identified in Acinetobacter
calcoaceticus, and is the bifunctional WS/DGAT (wax ester synthase/acyl-CoA :
diacylglycerol acyltransferase) family. Enzymes in this family exhibit both WS and
DGAT activity, thus can utilize both primary alcohols and more complex alcohols
(DAG) as substrates. The Acinetobacter WS/DGAT enzyme shows a preference for
59
C14 and C16 acyl-CoA substrates together with C14 to C18 primary alcohols when
acting as WS (Kalscheuer and Steinbuchel, 2003; Stöveken et al., 2005). A second
identified WS/DGAT type enzyme is the WSD1 gene of Arabidopsis, and it is capable
of using C18, C24 and C28 alcohols and C16 fatty acid to produce wax esters (Li et
al., 2008). The third wax ester producing enzyme family, is the mammalian wax
synthase, and it was first identified from mice (Cheng and Russell, 2004). This
mammalian WS family of enzymes has the highest activity with acyl-CoAs of
between C12 and C16 and primary alcohols shorter than 20 carbons (Cheng and
Russell, 2004). There are no obvious plant orthologs in this mammalian WS family
(Li et al., 2008).
Besides our interest of exploring the basic knowledge about wax ester
biosynthetic pathway, this study also provides precious experiences of engineering
a genetically modified plant to produce wax esters. This is also the critical step for
generating genetically modified crops. An agronomically suitable oil crop, grown in
large scale, can significantly lower the high price of wax esters in the market right
now. The price is the major factor that limits the use of wax esters to high profit
applications, such as cosmetic and pharmaceutical industries. With wax esters at
an affordable cost, large scale industrial applications such as biofuels and
biodegradable lubricants will become possible. We anticipate that some of these
transgenes will be useful in the commercial level wax ester production in the future.
Materials and methods
Plant materials
60
Arabidopsis thaliana ecotype Columbia (Col-0) was used for transgenic
expressions. Seeds were planted on MS medium then stratified for 24 hours. After
two weeks, seedlings were transferred to LC1 soil mix (Sungro Horticulture,
Agawam, MA). Plants were grown under continuous white fluorescent light at 22°C.
Vector construction and Arabidopsis transformation
A binary vector carrying 3 genes: 1) jojoba 3-ketoacyl CoA synthase, which
is involved in fatty acid elongation of monounsaturated fatty acids; 2) jojoba fatty
acyl-CoA reductase, which is involved in the formation of fatty alcohols; and 3) jojoba
wax synthase, was obtained from the Dr. Ed Cahoon (University of Nebraska–
Lincoln). The plant marker gene – DsRed that was in this vector was replaced with
the hygromycin resistant gene. The jojoba wax synthase gene was removed by
restriction enzyme digestion. The resulting vector was named pKF, which was used
as a control vector. Six WS and 3 WS/DGAT genes (Table ) were cloned into this
vector. These gene sequences were chemically synthesized by GenScript
(Piscataway, New Jersey). They resulting vectors were named pKFW1 to pKFW9
respectively. All genes in this vector (3-ketoacyl CoA synthase, fatty acyl-CoA
reductase and the wax synthesis gene) were under the control of seed specific,
Glycinin promoter (Ding et al., 2006).
Ten plant binary vectors were introduced into Agrobacterium tumefaciens
strain c58C1 via electroporation. These Agrobacterium strains were used to
transform Arabidopsis using a floral dip method (Clough and Bent, 1998). Siliques,
rosette leaves and seeds from confirmed individual transgenic Arabidopsis lines
61
were collected for genetic and biochemical analysis.
Reverse transcript PCR
Siliques at the mid-green stage (Mansfield and Briarty, 1991; Siloto et al.,
2006) were collected, and RNA was extracted using RNeasy RNA extraction kit
(Qiagen, Valencia, CA). The integrity of the isolated RNA was evaluated by agarose
gel electrophoresis. The RNA preparation was treated with DNase I (Invitrogen,
Carsbad, CA) to digest genomic DNA contamination. RNA samples were then used
for first strand cDNA synthesis with oligo (dT)20 primers and SuperScript III First
Strand Synthesis
System for RT-PCR (Invitrogen, Carsbad, CA), while same
samples were treated identically only the reverse transcriptase was replaced with
distilled water. The products from the first strand synthesis were then amplified by
gene-specific primers (Table 2) designed for each of the wax synthase transgene
sequences. Genomic DNA extract from rosette leaves from the same individual
Arabidopsis plant was also amplified by same primers as a positive control.
Seed lipid extraction
For seed oil extraction (Heilmann et al., 2012), 5 mg of desiccated
Arabidopsis seeds were homogenized using a glass homogenizer in 1ml chloroform
and 1 ml methanol. Docosyl dodecanoate (C34H68O2) was added as internal
standard when the samples were going to be analyzed by GC/MS. The
homogenates were then transferred to a glass tube with Teflon lined screw cap, and
shaken for 20 minutes. Then 1.3 ml of hexane and 700 ul diethyl ether (2 ml in total)
was added, and the mixture was shaken for 20 minutes. The mixture was
62
centrifuged for 5 minutes at 450g, and the insoluble pellet on the bottom of the tube
was discarded. The solvent was collected and evaporated under nitrogen gas and
the oil was dissolved in 1 ml chloroform.
Thin layer chromatography
Lipid extracts from Arabidopsis seeds were dissolved in hexane, and the
lipid solution was spotted on silica gel TLC plate (Sigma-Aldrich, St. Louis, MO). The
plate was developed with the solvent hexane:diethyl ether:acetic acid (90:7.5:1, v/v)
(Li et al., 2008). TLC reference standards (alkane: C22H46, sterol ester: cholesterol
dodecanoate, wax esters: Docosyl dodecanoate (C34H68O2), triacylglycerol: canola
oil, free fatty acids: palmitic acid, primary alcohols: octadecanol, and sterols:
ergosterol) were dissolved in hexane (0.5 mg/ml each). The TLC plate was air dried
after development, and then sprayed with primuline solution (5 mg in 100 ml of
acetone/water, 80/20, v/v) from a Sigma glass sprayer. The plate can be visualized
under UV light.
GC/MS analysis
For GC analysis, 1-µl lipid samples were injected into Agilent Technologies
Model 6890 Gas Chromatograph equipped with a Agilent 19091S-433 column
(30.0m x 250 um x 0.25 um), coupled to a Model 5973 Mass Selective Detector
capable of electrical ionization (EI). The temperature programs used in this study
were 50 °C for 1 minute, then 25 °C per minute to 200 °C, then 200 °C for 2 minute,
then 10 °C per minute to 280 stay for 2 minutes, then 20 °C per minute to 320 stay
for 20 minutes.
63
GUS activity analysis
The organ and tissue specific expression pattern of the At5g55380 gene was
assessed using transgenic plants that carried a reporter genes (GFP-GUS) fused to
different promoter elements from At5g55380. Three different constructs were
generated (Figure 5) in which different promoter fragments were fused to a chimeric
GFP-GUS gene in the expression transformation vector, pBGWFS7 (Karimi et al.,
2002). Two of these constructs fused 1.55-kb or 0.28-kb of genomic DNA
immediately upstream of the “ATG” translational start codon of the At5g55380 gene
to the GFP-GUS chimeric gene, to generate WaxSp1, and WasSp2 constructs. In
the third construct (WaxSp1tar), the GFP-GUS chimeric gene was fused to the 3’end of the At5g55380 gene.
Results:
Expression of WS and WS/DGAT in transgenic Arabidopsis.
We chose to investigate 9 genes originally isolated from Arabidopsis,
soybean, maize and moss. 6 are from the WS family and 3 are from the bifunctional
WS/DGAT family. To ensure expression would be optimized, the codon usage of the
moss WS and WS/DGAT genes were modified for Arabidopsis expression.
Arabidopsis WS homologs were also redesigned to a different DNA sequences, so
we can design RT-PCR primers unique to each transgene (Table 2).
The 10 plasmids constructed for plant transformation all carried the jojoba
3-ketoacyl-CoA synthase (KCS) and the jojoba fatty acid reductase (FAR) under the
control of Glycinin regulatory sequences. Jojoba KCS was chosen because it can
64
elongate fatty acyl CoA up to 24 carbons (Lassner et al., 1996), and these acylCoAs can be reduced by jojoba FAR to generate primary long chain alcohols (Metz
et al., 2000). One plasmid (pKF) that did not carry any wax biosynthesis gene was
used as a negative control. The other 9 plasmids, named pKFW1 to pKFW9, all
contain one WS or WS/DGAT gene sequence also under the control of Glycinin
regulatory sequences. Glycinin is a soybean (G. max) promoter which specifically
regulates the expression of transgenes in embryos of transgenic plants (Sims and
Goldberg, 1989; Ding et al., 2006).
All 10 plasmids were introduced into Agrobacteria tumefaciens, and
subsequently used to transform Arabidopsis. The seed progenies from the
transformation event were identified as the T1 generation. For each transgenic line
each batch of these T1 seeds were germinated on Hygromycin selective MS plates,
and several individuals were identified, and confirmed by PCR genotyping with gene
specific primers for KCS, FAR, WS and WS/DGAT. The T1 plants were grown to
maturity, and T2 seeds were harvested. RNA was extracted from siliques of T2
plants, and T3 seeds were collected and used for oil content analysis.
RT-PCR was performed on RNA isolated from developing T3 seeds to
determine the expression of transgenes using primers specific to each transgenes.
Gene specific primers (Table 2) were designed to recognize unique sequences for
each the transgene, and the specificity of these primer pairs was tested using wild
type Arabidopsis to make sure that they would not show false positive results due
to unspecific primer binding (data not shown).
65
RNA was extracted from Arabidopsis siliques at early and middle maturation
stages, reverse transcribed using the poly-A tail as the primer site, and the resulting
cDNA was used as the template for PCR. Duplicate reactions without reverse
transcribed RNA samples were used as controls for genomic DNA contamination.
The Arabidopsis Actin-2 gene (At3g18780), which is constitutively expressed in
every organ, served as an ideal positive control for RT-PCR (Czechowski et al.,
2005). Individual transgenic Arabidopsis plants were tested from each transgenic
line.
We tested at least 4 individual plants for each transgene resulted in same
band intensity, and one set of results are given in Figure 1. No PCR products were
observed in any of the non-reverse transcribed treatments indicating that none of
the RNA preparations contained genomic DNA contamination. Actin-2 mRNA was
detected in all reverse transcribed samples showing that all the reverse transcription
reactions were successful. Genomic DNA samples all showed the existence of
transgenes in all samples analyzed. RT-PCR analysis detected the mRNA for every
transgene assayed, with the exception of the moss WS/DGAT showed no positive
results indicating undetectable gene expression. Although, the RT-PCR analysis
we conducted is not quantitative, the variation of the band intensity differences
suggest different expression levels even though the transcription of all transgene
were under the regulation of the same promoter.
Seed oil analysis
Mature seeds collected from T2 were extracted with an organic solvent, and
TLC was used separated the lipid classes. The TLC plates were sprayed with
66
premulin, and visualized under UV light. Seed oils from transgenic lines expressing
the Arabidopsis At5g55380 (pKFW3) contained a significant amount of lipid class
that co-migrated with the wax ester standard (Figure 2).
The lipids from all the 10 transgenic lines were also analyzed by GC/MS.
Samples from transgenic lines expressing only KCS and FAR have novel GC peaks
that were identified as elongated fatty acids C20:0 and C24:0 and primary alcohols
(Figure 3), which are not present in wild type Col-0 Arabidopsis. These primary
alcohols are monounsaturated and of 20, 22, and 24 carbon atoms in lengths. In the
transgenic lines expressing At5g55380, besides these novel elongated fatty acids
and primary alcohols, wax esters were also been identified (Figure 4). These wax
esters consist of 16 and 18 carbon fatty acids esterified with long chain unsaturated
primary alcohol.
Organ and tissue specific expression of At5g55380
The organ and tissue specific expression of At5g55380 was investigated in
transgenic Arabidopsis plants carrying a GUS transgene whose expression was
driven by a 1-kb promoter fragment from At5g55380. The expression patterns
obtained from the resulting three sets of transgenic plants were near identical, thus
only the observations from the waxSp2 construct are shown (Figure 6). In young
seedlings, GUS expression, driven by the promoter of At5g55380 gene was
expressed in cotyledons and leaves, and although expression is detectable in
mesophyll cells of these organs, expression appears to be concentrated in the
vasculature (Figure 6AD). Just before bolting, expression was stronger in the older
leaves than in young expanding leaves, but it was not expressed in the shoot
67
meristem (Figure 6B). Strong expression was seen in the opened flower (Figure 6F),
and within these flowers it was concentrated in the sepals and pedicles (F&G).
Strong expression was also seen in the roots of young seedlings (10-day old plants);
particularly in the primary roots (Figure 6H). Within the root system expression was
particularly enhanced at the initiation of the lateral roots, and in the root vasculature,
but not in root tip (Figure 6I).
Discussions
Wax esters are assembled by the reaction between an acyl-CoA and a fatty
alcohol, a pathway that exists in bacteria, plants and animals (Lardizabal et al., 2000;
Ishige et al., 2003; Cheng and Russell, 2004; Stöveken et al., 2005). The final
reaction in this pathway is catalyzed by wax synthase, which belongs to the
membrane-bound O-acyl transferase (MBOAT) super family (Matsuda et al., 2008;
Shindou et al., 2009). As an important constituent of the surface lipids of terrestrial
plants, there is limited knowledge about wax synthases from plants. The first wax
synthase was identified and characterized from jojoba, which stores wax ester as
major lipid in its seed oil (Lardizabal et al., 2000). By sequence similarity to the
jojoba WS sequence, 12 jojoba-like WS homologs have been annotated in the
Arabidopsis genome. To date however, none of them has been identified as a WS,
and indeed, one of them, At3g51970 has been characterized as a sterol Oacyltransferase (Chen et al., 2007). More recently, another member of the MBOAT
super family, a WS/DGAT has been reported to be responsible for wax ester
synthesis in Arabidopsis stem (Li et al., 2008), which appears to be the only enzyme
characterized as responsible for wax ester biosynthesis in terrestrial plants.
68
In this study we have successfully expressed both WS and WS/DGAT genes
in Arabidopsis ecotype Col-0 seeds. Using the soybean glycinin promoter sequence
(Sims and Goldberg, 1989; Ding et al., 2006) we have specifically ectopically coexpressed a 3-gene pathway in transgenic Arabidopsis seeds. In addition to the wax
ester producing genes, the three reaction pathway included a gene for elongating
fatty acids (KCS), and a gene for reducing fatty acyl-CoAs to fatty alcohols (FAR)
(Lassner et al., 1996; Metz et al., 2000).
Platforms
for
characterizing
wax
synthase
can
be
divided
into
microorganisms and oilseed plants. Microorganisms can be easily manipulated and
usually with a simple and well-known background, such as yeast. And substrates
can be fed into the medium to get rid of the influence from endogenous lipids.
However, microorganisms like yeast also have their own shortcomings. Because
wax synthases are all plant proteins with multiple transmembrane domains, the
protein expression can be difficult. Within a few successful attempts, previous study
found the substrate specificity was not the same as the same enzyme expressed in
oil seed. On the other hand, oil seed plants have no concerns about the gene
expression. The lipids accumulate during in oil seed development can provide a
large potential substrate pool for wax synthase. Arabidopsis seed has been
frequently used for study lipid metabolic processes. Arabidopsis seeds usually
stores lipids mostly as triacylglycerol. During the synthesis of triacylglycerol, an
enormous pool of fatty acids is present in the embryo. Expressing wax synthase in
developing oil seed would take advantage of the substrate pool in the seed.
However, in order to synthesize wax esters in the seed, fatty acyl CoAs produced
69
by Arabidopsis may not be of sufficient chain length. Not only may Arabidopsis lack
of diversity of fatty acyl CoAs, but these seeds also lack the primary alcohols that
would be needed for wax ester biosynthesis. To make fatty acyl CoA and primary
alcohols available in Arabidopsis seeds, jojoba KCS and FAR were transformed
under the control of seed specific promoter. GC analysis showed new fatty acid and
primary alcohol peaks, which were specifically identified from their mass spectra.
The lipid profile showed 20 carbon and 24 carbon fatty acids; 20:1, 22:1 and 24:1
primary alcohols, which is consistent with previous studies of these two enzymes
(Lassner et al., 1996; Metz et al., 2000).
The transgenic lines of Arabidopsis Col-0 were confirmed by PCR using
gene specific primers on genomic DNA prepared form rosette leaves. To further
confirm that these genes have been transcribe in Arabidopsis seeds, siliques from
early and middle maturation were collected for RNA extraction. The RT-PCR results
revealed jojoba KCS, FAR and 8 out of 9 WS or WS/DGAT genes have been
successfully transcribed; the only one without detectable mRNA present was moss
WS/DGAT. Individual plants from independent transformation events showed
consistency, indicating the glycinin regulatory sequence has met our expectation
and minimum variation among different gene insert locations.
In this study, Arabidopsis transgenic line carrying At5g55380 was able to
accumulate significant amounts of wax ester in its seed oil. Further GC analysis
revealed the occurrence of C36, C38, and C40 esters. These wax esters consist of
saturated and unsaturated 16 or 18 carbon fatty acyl moieties, esterified to
unsaturated primary alcohols with chain length from 20 to 24 carbons.
These
70
findings indicate that the WS encoded by At5g55380 prefers to esterify C16:0, C18:0,
C18:1 and C18:2 fatty acyl CoA, with C20:1, C22:1 and C24:1 primary alcohols.
We have also studied the expression of At5g55380 in Arabidopsis, using
promoter::GUS gene fusion method. We found this gene is expressed among all
tissue types, even in the root vasculature. Previously similar conclusions were
drawn from RT-PCR studies (Klypinaa and Hanson, 2008), with the exception that
they did not check expression in roots.
Wax esters have been widely used in foods, cosmetic, perfume and
pharmaceutical industries. More recently more attention has been focused on their
potential as biorenewable biofuel and bio-lubricant. However, because of limited
sources of natural wax esters, these molecules have a high price, which severely
restricts applications to high value products. This study demonstrates an approach
of modifying oil seeds to generate genetically modified plants to produce wax ester
in the seed oil. This approach can be transplanted to an oil seed crop, and wax
esters can be produced in large quantities to provide an economically viable source
of these molecules for applications.
71
Figures and tables:
Table 1: List of genes chosen for ectopic expression in transgenic
Arabidopsis seeds.
Name
Specie
Accession ID
At5g55320
Arabidopsis thaliana
At5g55320
At5g55340
Arabidopsis thaliana
At5g55340
At5g55380
Arabidopsis thaliana
At5g55380
Soybean WS
Glycine max
ACU22750.1
Maize WS
Zea mays
NP_001147171.1
Moss WS
Physcomitrella patens
subsp. patens
XP_001765175.1
Glycine max
ACU20370.1
Physcomitrella patens
subsp. patens
XP001780431.1
Zea mays
ACN31544.1
Soybean
WS/DGAT
Moss
WS/DGAT
Maize
WS/DGAT
72
Table 2: PCR primers used for RT-PCR
Genes
Forward primer (5’ to 3’)
Reverse primer(5’ to 3’)
Jojoba KCS
ATCTCCAATGCCCTCTTCCT
ATCTCCAATGCCCTCTTCCT
Jojoba FAR
AAGGGGACATTCCGCTTACT
CCTTGAACCATTGGCAGAAT
At5g55320
TGTTCCCATTGCCTTCAAAT
TCATGTGCAACACCAGAGGT
At5g55340
TTCGCAGTTTTGTTGCATTT
ACAAACACCATGCAAAACGA
At5g55380
ACAAACACCATGCAAAACGA
CATTTGTTTCGCATGTTTGC
Soybean WS
CATTTGTTTCGCATGTTTGC
CGAACATAGCACCATCTGGA
Maize WS
CGAACATAGCACCATCTGGA
CATCGTTGTTAACGCTGCAT
Moss WS
CATCGTTGTTAACGCTGCAT
ATGCATCAAAGGTGGGAAAA
Soybean
WS/DGAT
ATGCATCAAAGGTGGGAAAA
TGATGGTGAAGTTGGTGCAT
Moss
WS/DGAT
TGATGGTGAAGTTGGTGCAT
TGAACGGTAGCCAACAACAA
Maize
WS/DGAT
TGAACGGTAGCCAACAACAA
GCCTTTGATCGCTTTCTACG
A. thaliana
Actin-2
GGCTCCTCTTAACCCAAAGG
GGGCATCTGAATCTCTCAGC
73
Control
At5g55320
At5g55340
At5g55380
Soybean WS
Maize WS
Moss WS
Soybean WS/DGAT
Moss WS/DGAT
Maize WS/DGAT
a
b
Actin-2
c
a
b
KCS
c
a
b
FAR
c
a
b
c
GSP
Figure 1: Expression of transformed genes in A. thaliana seeds. Gene
names are indicated at right, control is Col-0 line with KCS and FAR but no WS or
WS/DGAT. Genes examined are labeled at the bottom, GSP: gene specific primers.
RT-PCR (lane a), minus RT control (lane b), and genomic DNA as positive control
(lane c), products of these three PCR reactions are shown. The actin-2 gene was
used as a positive control for RT-PCR efficiency.
74
Alkane
Wax ester
TAG
FFA
Alcohol
Sterol
Maize WS/DGAT
Moss WS/DGAT
Soybean WS/DGAT
Moss WS
Maize WS
Standard
Soybean WS
At5g55380
At5g55340
At5g55320
Control
Standard
Figure 2: TLC analysis of seed oil from transgenic Arabidopsis lines.
Arabidopsis lines transformed with which wax ester producing gene were marked
at the bottom of the TLC plate. Control: Col-0 line with KCS and FAR but no WS or
WS/DGAT.
10
11
12
13
FA 18:
2
FA 16:
0
14
FA 20:
0
ALC 20:
1
15
16
Retention Time(Min)
FA 18:
0
ALC 22:
1
17
18
19
ALC 24: 1
FA 24: 0
Figure 3: Fatty acids and primary alcohols produced in Arabidopsis Col-0 transgenic line carrying jojoba
0.0E+00
5.0E+05
1.0E+06
1.5E+06
2.0E+06
2.5E+06
3.0E+06
3.5E+06
KCS and jojoba FAR.
Abundance
4.0E+06
20
75
1.90E+06
2.40E+06
2.90E+06
28
30
Icosenyl(C20:1) hexadecanoate(C16),
C36 wax ester
32
Retention Time
34
Unknown
Docosenyl(C22:1) hexadecanoate(C16),
C38 wax ester
Icosenyl(C20:1) octadecadienoate(C18:2),
C38 wax ester
36
38
40
Tetracosenyl(C24:1)
hexadecaenoate(C16:0),
C40 wax ester
Docosenyl(C22:1) octadecanoate(C18:0),
C40 wax ester
jojoba FAR. Red line represents Col-0 line with KCS and FAR transformed.
Figure 4: Wax esters synthesized in Arabidopsis Col-0 transgenic line carrying At5g55380, jojoba KCS and
4.00E+05
9.00E+05
1.40E+06
Abundance
Docosenyl(C22:1) octadecaenoate(C18:1),
C40 wax ester
76
77
Figure 5: Constructs of At5g55380::GUS transgene. Three sets of
transgenic lines were generated (WaxSp1, WaxSp2, and WaxSp1tar), which fused
a GFP-GUS chimeric gene to different portions of the At5g55380 gene. The
lengths and position of the fragments cloned into the constructs were: WaxSp1,
1551-bp upstream from position -1; WaxSp2, 280-bp upstream from position -1.
WaxSp1tar, the promoter region plus the At5g55380 ORF. GUS activity assays for
all three were very similar, and only data from the WaxSp2 transgenic lines are
shown here.
78
Figure 6: At5g55380 GUS staining results. The expression of the
At5g55380 gene visualized by GUS activity stains in young seedlings (A), in plants
just before bolting (B), isolated cotyledon (C), isolated young leaf (D), flowers and
buds (E and F), and roots (G, H, I). pd = pedicle, sp = sepal, sty = style, rv = root
vasculature. Scale: red bar: 1mm blue bar: 0.1mm
79
REFERENCES
Carver TL, Gurr SJ (2008) 12 Filamentous fungi on plant surfaces. Annual Plant
Reviews, Biology of the Plant Cuticle 23: 368
Chen Q, Steinhauer L, Hammerlindl J, Keller W, Zou J (2007) Biosynthesis of
phytosterol esters: identification of a sterol o-acyltransferase in Arabidopsis.
Plant Physiol 145: 974-984
Cheng JB, Russell DW (2004) Mammalian wax biosynthesis. II. Expression cloning
of wax synthase cDNAs encoding a member of the acyltransferase enzyme
family. J Biol Chem 279: 37798-37807
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant J 16: 735-743
Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible W-R (2005) Genomewide identification and testing of superior reference genes for transcript
normalization in Arabidopsis. Plant Physiology 139: 5-17
Ding S-H, Huang L-Y, Wang Y-D, Sun H-C, Xiang Z-H (2006) High-level
expression of basic fibroblast growth factor in transgenic soybean seeds and
characterization of its biological activity. Biotechnology letters 28: 869-875
Eigenbrode SD (2004) The effects of plant epicuticular waxy blooms on attachment
and effectiveness of predatory insects. Arthropod Struct Dev 33: 91-102
Heilmann M, Iven T, Ahmann K, Hornung E, Stymne S, Feussner I (2012)
Production of wax esters in plant seed oils by oleosomal co-targeting of
biosynthetic enzymes. Journal of Lipid Research
Ishige T, Tani A, Sakai Y, Kato N (2003) Wax ester production by bacteria. Curr
Opin Microbiol 6: 244-250
Jetter R, Kunst L (2008) Plant surface lipid biosynthetic pathways and their utility
for metabolic engineering of waxes and hydrocarbon biofuels. Plant Journal
54: 670-683
80
Kalscheuer R, Steinbuchel A (2003) A novel bifunctional wax ester synthase/acylCoA:diacylglycerol acyltransferase mediates wax ester and triacylglycerol
biosynthesis in Acinetobacter calcoaceticus ADP1. J Biol Chem 278: 80758082
Karimi M, Inzé D, Depicker A (2002) GATEWAY™ vectors for< i>
Agrobacterium</i>-mediated plant transformation. Trends in plant science 7:
193-195
Klypinaa N, Hanson SF (2008) Arabidopsis thaliana wax synthase gene
homologues show diverse expression patterns that suggest a specialized
role for these genes in reproductive organs. Plant Science 175: 312-320
Krauss P, Markstadter C, Riederer M (1997) Attenuation of UV radiation by plant
cuticles from woody species. Plant, Cell & Environment 20: 1079 - 1085
Lardizabal KD, Metz JG, Sakamoto T, Hutton WC, Pollard MR, Lassner MW
(2000) Purification of a jojoba embryo wax synthase, cloning of its cDNA, and
production of high levels of wax in seeds of transgenic arabidopsis. Plant
Physiol 122: 645-655
Lassner MW, Lardizabal K, Metz JG (1996) A jojoba beta-Ketoacyl-CoA synthase
cDNA complements the canola fatty acid elongation mutation in transgenic
plants. Plant Cell 8: 281-292
Leveau JH (2008) 11 Microbial communities in the phyllosphere. Annual Plant
Reviews, Biology of the Plant Cuticle 23: 334
Li F, Wu X, Lam P, Bird D, Zheng H, Samuels L, Jetter R, Kunst L (2008)
Identification of the wax ester synthase/acyl-coenzyme A: diacylglycerol
acyltransferase WSD1 required for stem wax ester biosynthesis in
Arabidopsis. Plant Physiol 148: 97-107
Lolle SJ, Hsu W, Pruitt RE (1998) Genetic analysis of organ fusion in Arabidopsis
thaliana. Genetics 149: 607-619
Müller C (2008) 13 Plant–Insect interactions on cuticular surfaces. Annual Plant
Reviews, Biology of the Plant Cuticle 23: 398
81
Mansfield S, Briarty L (1991) Early embryogenesis in Arabidopsis thaliana. II. The
developing embryo. Canadian journal of botany 69: 461-476
Matsuda S, Inoue T, Lee HC, Kono N, Tanaka F, Gengyo‐Ando K, Mitani S, Arai
H (2008) Member of the membrane‐bound O‐acyltransferase (MBOAT)
family encodes a lysophospholipid acyltransferase with broad substrate
specificity. Genes to Cells 13: 879-888
Metz JG, Pollard MR, Anderson L, Hayes TR, Lassner MW (2000) Purification of
a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA
in high erucic acid rapeseed. Plant Physiol 122: 635-644
Miwa TK (1971) Jojoba oil wax esters and derived fatty acids and alcohols: gas
chromatographic analyses. Journal of the American Oil Chemists' Society 48:
259-264
Pfüindel EE, Agati G, Cerovic Z (2006) optical properties of plant surface. Annual
Plant Reviews 23: 216-249
Riederer M, Schreiber L (2001) Protecting against water loss: analysis of the
barrier properties of plant cuticles. J Exp Bot 52: 2023-2032
Shindou H, Eto M, Morimoto R, Shimizu T (2009) Identification of membrane Oacyltransferase family motifs. Biochem Biophys Res Commun 383: 320-325
Sieber P, Schorderet M, Ryser U, Buchala A, Kolattukudy P, Metraux JP,
Nawrath C (2000) Transgenic Arabidopsis plants expressing a fungal
cutinase show alterations in the structure and properties of the cuticle and
postgenital organ fusions. Plant Cell 12: 721-738
Siloto RMP, Findlay K, Lopez-Villalobos A, Yeung EC, Nykiforuk CL, Moloney
MM (2006) The accumulation of oleosins determines the size of seed
oilbodies in Arabidopsis. The Plant Cell Online 18: 1961-1974
Sims TL, Goldberg RB (1989) The glycinin Gy1 gene from soybean. Nucleic acids
research 17: 4386
Solovchenko A, Merzlyak M (2003) Optical properties and contribution of cuticle
82
to UV protection in plants: experiments with apple fruit. Photochem Photobiol
Sci 2: 861-866
Spencer G, Tallent W (1973) Sperm whale oil analysis by gas chromatography and
mass spectrometry. Journal of the American Oil Chemists Society 50: 202206
Stöveken T, Kalscheuer R, Malkus U, Reichelt R, Steinbuchel A (2005) The wax
ester synthase/acyl coenzyme A:diacylglycerol acyltransferase from
Acinetobacter sp. strain ADP1: characterization of a novel type of
acyltransferase. J Bacteriol 187: 1369-1376
Teerawanichpan P, Qiu X (2010) Fatty acyl-CoA reductase and wax synthase from
Euglena gracilis in the biosynthesis of medium-chain wax esters. Lipids 45:
263-273
83
CHAPTER IV. MUTATIONAL ANALYSIS OF JOJOBA-LIKE
WAX ESTER SYNTHASE IN ARABIDOPSIS
In preparation for submission to the Journal of BMC Plant Biology
Daolin Cheng1, Marna D. Yandeau-Nelson1, Yuqin Jin1 and Basil J. Nikolau1
1Roy
J. Carver Department of Biochemistry, Biophysics and Molecular Biology,
Iowa State University, Ames, IA 50011
ABSTRACT
The Arabidopsis genome carries twelve homologs of genes encoding
jojoba-like wax ester synthase. Reverse genetic approaches facilitate the
characterization of the physiological functions of such multi-gene families, a process
that is greatly enabled in Arabidopsis by the availability sequence-indexed, T-DNA
mutagenized lines. In this paper, two T-DNA insertion lines (SALK_060303 and
RATM54-0095-1_H) that carried mutations in the jojoba-like wax synthase gene,
At5g55380 were characterized. We showed that the short root-length phenotype
observed in SALK_060303 allele was due to mutation approximately 18 cM away
from the At5g55380 locus. The genetic segregation studies enabled the separation
of the short root-length-phenotype allele from the SALK_060303 allele in At5g55380.
Biochemical characterization of the wax esters in the segregated SALK_060303 line,
and of the RATM54-0095-1_H line established that these mutations did not affect
the wax ester chemotype, suggesting that At5g55380 is redundant in the ability of
Arabidopsis to produce wax esters.
84
Introduction
As will all terrestrial plants, aerial organs of Arabidopsis are covered by the
cuticle, a hydrophobic layer coating the epidermis of the plant body. The
commonality of all cuticles is that they consist of two types of highly lipophilic
materials—cutin and surface lipids. Cutin is a polymer consisting mainly of ω- and
mid-chain hydroxyl and epoxy C16 and C18 fatty acids, and glycerol (Heredia, 2003;
Nawrath, 2006; Stark and Tian, 2008). The surface lipids are outside and embedded
in the cutin layer and can be extracted by organic solvents. The surface lipid is a
complex of straight-chain C20 to C60 aliphatic molecules and may include secondary
metabolites such as triterpenoids, phenylpropanoids and flavonoids (Jetter et al.,
2006).
Surface lipids are thought to prevent nonstomatal water loss, and is
therefore one of the key adaptation in the evolution of terrestrial plants (Raven and
Edwards, 2004). Surface lipids are exposed to the environment as the outermost
frontier of plant organs, therefore it is critical in how a plant interacts with its
environment including plant-insect interactions, preventing germination of
pathogenic microbes, and causing shedding of water droplets and dust particles as
well as spores (Riederer and Muller, 2008). Surface lipids and cutin are also
involved in cell-cell interactions, such as mediating pollen stigma contact and
preventing post-genital organ fusion (Tanaka and Machida, 2008).
Wax esters are a component of the plant’s cuticular lipids, and their exact
composition varies from species to species, and even within a single species there
85
are variations among different surfaces of a plant. For example, Arabidopsis leaf
and stem surfaces contain 0.1% to 0.2% and 0.7% to 2.9% of wax esters,
respectively (Jenks et al., 1995), whereas this number could be as high as 85% in
leaf wax of the carnauba palm, Copernicia cerifera (Kolattukudy, 1976). Wax esters
in the same organism are usually a mixture of different carbon chain lengths,
consisting of different chain lengths of a carboxylic acid and alcohol. The physical
and chemical properties of wax esters are determined by the component fatty acid
and primary alcohol moieties.
The final step of wax ester biosynthetic pathway is catalyzed by wax
synthase, which transfers the acyl group from an acyl-CoA to a fatty acyl alcohol.
There are three unrelated families of wax synthases found in higher plants,
mammals and bacteria (Jetter and Kunst, 2008). The jojoba-like WS family, the first
identified plant wax synthase was isolated from jojoba embryos. The jojoba enzyme
uses a wide range of saturated and unsaturated acyl-CoAs with a chain length from
14 carbons to 24 carbons, with 20:1 being the preferred substrate, and exhibits
highest activity with C18:1 alcohol (Lardizabal et al., 2000). Later, a second member
of this WS family was identified from Euglena. It can utilize fatty acids from 12:0,
14:0, 16:0 and 16:1-9, with 14:0 being the most favored fatty acid substrate; and the
preferred primary alcohols substrates are 12:0, 14:0, 16:0 and 16:1-9 with 16:1-9Alc
(Teerawanichpan and Qiu, 2010). The second family type of WS was first identified
in
Acinetobacter
calcoaceticus,
and
is
the
WS/DGAT
(Acyl-Coenzyme
A:Diacylglycerol) family. Enzymes in this family exhibit both WS and DGAT activity,
thus can utilize both primary alcohols and more complex alcohols (DAG) as
86
substrates. The Acinetobacter WS/DGAT enzyme shows a preference for C14 and
C16 acyl-CoA substrates together with C14 to C18 primary alcohols when acting as
WS (Kalscheuer and Steinbuchel, 2003; Stöveken et al., 2005). A second
WS/DGAT type enzyme is the WSD1 gene of Arabidopsis, and it is capable of using
C18, C24 and C28 alcohols and C16 fatty acid to produce wax esters (Li et al.,
2008). The third WS family, is the mammalian wax synthase, and it was first
identified in mice (Cheng and Russell, 2004). This third WS family of enzymes, have
the highest activity with acyl-CoAs of between C12 and C16 in and primary alcohols
shorter than 20 carbons (Cheng and Russell, 2004). There are no obvious plant
orthologs in this third WS family (Li et al., 2008). In general, WSs naturally accept
acyl groups with carbon chain length of C16 or C18 and primary alcohols with
carbon chain length ranging from C12 to C20 (Shi et al., 2012). Reported activities
of WSs with short chain alcohols are low (Stoveken and Steinbuchel, 2008).
Even through Arabidopsis has as many as 12 jojoba-like WS homologs and
11 WS/DGAT homologs, only one gene from WS/DGAT family has been identified
as wax synthase. For the jojoba-like WS family, the only one homolog identified was
a sterol O-acyltransferase (Chen et al., 2007). In this paper, we will discuss the
mutant study we have done to understand wax ester biosynthetic pathway in
Arabidopsis, specifically the role of At5g55380 in forming the wax esters of the
cuticular lipids.
87
Materials and methods
Plant material and growth conditions
T-DNA insertion mutant lines SALK_060303 and RATM54-0095-1_H were
obtained from the ABRC (www.arabidopsis.org) (Alonso et al., 2003). Seeds were
planted on MS plate then stratified for 24 hours. After two weeks, seedlings were
transferred to LC1 soil mix (Sungro Horticulture, Agawam, MA). Plants were grown
under continuous white fluorescent light at 22°C.
Root phenotype analysis
Seeds were aligned on MS plates and germinated, while the plates were
maintained vertically in a growth room with continuous fluorescent light at 22°C.
Root length of Arabidopsis seedlings were measured from images taken regularly
from MS plates. Software ImageJ (http://rsbweb.nih.gov) was used to measure each
root length in image pixles, which was then converted into mm using a referece
object length.
DNA isolation and PCR genotyping
Genomic DNA was prepared from rosette leaves. 1-2 leaves stored frozen
in a 1.5 ml centrifuge tube were homogenized in the same tube in the presence of
500 ul shorty buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA), and the extract was
clarified
by centrifugation at 15,300 g for 5 minutes. One volume of chilled
isopropanol was added to the supernatant and DNA was recovered by centrifugation
at ca. 15,300 g for 10 minutes. The pellet was washed with 0.5 ml 70% (v/v) ethanol
88
at room temperature, followed by a one minute centrifugation. The pellet was then
dried and dissolved in 50 ul distilled water.
Specific primers were designed and synthesized for genotyping. For allele
SALK_060303:
left boarder PCR primers:
380ATG: 5’-ATGGAAGAAAAGTTTAGAAACTTAATCG-3’,
LBa1: 5’-TGGTTCACGTAGTGGGCCATCG-3’;
right board primers:
Out80Re: 5’-TTTGGCAGAGTTTGTTTTATTTT-3’,
RB2-SALK: 5’-GACAGGTCGGTCTTGACAAAA-3’.
For allele RATM54-0095-1_H:
left board primers:
LP-801H: 5’-GACAAATCCAGACAAACGACG-3’,
Ds5-2a: 5’-TCCGTTCCGTTTTCGTTTTTTAC-3’;
right board primers:
RP-801H: 5’-CATGGCTTGCAAACTTTAAGC-3’,
Ds3-2a: 5’-CCGGATCGTATCGGTTTTCG-3’.
Lipid metabolite analysis
The Arabidopsis lipids were extracted using a modified method previous
described (Bligh and Dyer, 1959). Leaves, flowers, siliques and stem were collected
then lyophilized for lipid extraction. To extract lipids, 2 ml of near boiling methanol
(60°C) was added to each sample, it was vortexed and immediately incubated at
89
60°C for 1 min. After cooling to room temperature, 1 ml of chloroform was added to
the sample, and mixed by vortexing for 30 seconds. Following the addition of 800
ul of ddH2O the sample was further vortexed for 5 minutes. An additional 1 ml of
chloroform was added, and again vortexed for 30 seconds. After a final addition of
1 ml of ddH2O and vortexing for 30 seconds the mixture was filtered through a 0.45
um PTFE filter. The two phases were separated by centrifugation at 5000g for 4 min,
and the lower chloroform layer was recovered and evaporated to dryness using a
stream of nitrogen gas.
GC/MS analysis
For GC analysis, one microliter lipid samples were injected into Agilent
Technologies Model 6890 Gas Chromatograph equipped with a Agilent 19091S-433
column (30.0m x 250 um x 0.25 um), coupled to a Model 5973 Mass Selective
Detector capable of electrical ionization (EI). The temperature programs used in this
study were 50 °C for 1 minute, then 25 °C per minute to 200 °C, then 200 °C for 2
minute, then 10 °C per minute to 280 stay for 2 minutes, then 20 °C per minute to
320 stay for 20 minutes.
Results and discussion
Insertion location of SALK_060303 and RATM54-0095-1_H alleles
The insertion sites of the T-DNA of in both alleles were identified by
sequencing the PCR product generated from genomic DNA using specific primers
for At5g55380 and both boarders of the T-DNA insert (Figure 1). At5g55380 has
only one exon and no introns. In the SALK_060303 allele the T-DNA element is
90
inserted at between nucleotide position 1000 of the At5g55380 ORF, and this
insertion event deleted 42 nucleotides. Seventeen of the deleted nucleotides are
located within the computer-predicted 3’ non-coding region of the gene and the
remaining 25 are located immediately upstream of the stop codon. In RATM540095-1_H, the T-DNA element is inserted between nucleotide position 565 and 592
of the ORF, and thus deletes 27 nucleotides of the ORF.
Growth phenotypes associated with SALK_060303 and RATM54-00951_H
To ascertain the effect of the SALK_060303 allele on the growth morphology
of Arabidopsis, sterile seeds homozygous for SALK_060303 and their wild type
siblings were plated together on Murashige and Skoog solid media, and the growth
of the two genotypes were compared (Figure 2). The mutant has narrower leaves
and is less tolerant of drought situation. Mutant seedlings also have shorter main
roots, with less secondary roots as compared to their wild type siblings and wild type
columbia-0 seedlings. RATM54-0095-1_H allele was also compared with its wild
type Nossen siblings. In contrast to the SALK_060303, no noticeable difference in
growth and development was observed in RATM54-0095-1_H homozygous plants.
Confirm correlation between T-DNA insertion and morphological
phenotype
A genetic allelism test was conducted to evaluate whether the apparent
phenotype associated with the SALK_060303 allele, was due to the insertion of the
T-DNA in At5g55380. Mutant homozygous plants from both T-DNA insertion lines
91
were intercrossed, and in parallel a control cross was conducted between Col-0 and
Nossen wild types generated from sibling lines of the mutants. The morphological
phenotype that was scored in the progeny was the short-root length of Arabidopsis
seedling, and the segregation of the T-DNA insertion alleles was genotyped by PCR
using specific designed primers described above. The root length of the mutants
and their wild type siblings are shown in Figure 3. The roots of RATM54-0095-1_H
allele in the Nossen background showed no significant difference as compared to
the wild-type siblings, while the roots of SALK_060303 mutants are significantly
shorter than the Col-0 wild-type. Also, plants carrying both alleles (obtained by
intercrossing SALK_060303 and RATM54-0095-1_H) were compared to seedlings
from the Nossen and Col-0 wild type cross, and no significant differences in root
length were found.
Locating mutation causing the short-root length phenotype
To further identify the mutation that caused the morphological short-root
length (r) phenotype associated with the SALK_060303 allele, progeny seeds from
a heterozygotes for T-DNA insertion (Ww) and morphological phenotype (Rr)
(identified by offspring segregation) were planted, and a total of 104 such plants
were evaluated. The T-DNA insertion was genotyped by PCR and short-root length
phenotype was also recorded. These 104 plants can be categorized into 6 groups:
WWR_ : WwR_ : wwR_ : WWrr : Wwrr : wwrr. When only the T-DNA insertion or
morphological phenotype is considered separately, they should both segregate at a
ratio of 1:2:1 or 3:1. Statistical analysis (chi-square test) of the ratio of the T-DNA
insertion (Table 1) and short-root length (r) phenotype (Table 2) among the
92
evaluated 104 progeny, showed a p-value > 0.05; thus both failed to reject the null
hypothesis that it agrees with the Mendelian segregation for a recessive alleles.
If T-DNA insertion and the mutation causing the short-root length phenotype
are not linked, they should also obey Mendel’s Law of Independent Assortment;
namely the expected ratio of WWR_ : WwR_ : wwR_ : WWrr : Wwrr : wwrr should
equal to 3:6:3:1:2:1 (Polynomial expansion of (1:2:1)(3:1)). The p-value of the chisquare test is <<0.005, suggesting the mutation causing phenotype is linked with
the T-DNA insertion (Table 3).
The linkage between the SALK_060303 T-DNA insertion and the mutation
can be calculated using many approaches. In this case, using offspring of selfed
heterozygous plants, the linkage can be calculated by sum of complementary
classes method, weighted mean method, product method, method of maximum
likelihood and method of maximum χ2 (Fisher and Balmukand, 1928). The distance
between SALK_060303 T-DNA insertion in At5g55380 and the mutation causing the
short-root length phenotype is listed in Table 4; the best estimate of the linkage is
around 18 centiMorgans.
Chemotype of At5g55380 mutants of Arabidopsis
From the segregation genetic crosses we were able to recover via
recombination a line that carried the SALK_060303 T-DNA insertion but did not
carry the short-root length phenotype trait. This new segregated SALK_060303 line
(DAT-18) was analyzed for wax esters. The total lipid was extracted and analyzed
by GC/MS (Figure 4). Lipid profiles from the DAT-18 line (homozygous for the
93
SALK_060303 allele, the sibling DAT-9 line (heterozygous for the SALK_060303
allele), and DAT-4 wild type sibling are shown in Figure 4; there are no new or
missing peaks among these profiles.
Summary of reverse genetics study
This reverse genetic study failed to demonstrate that At5g55380 is required
for in vivo wax ester biosynthesis in Arabidopsis. There are several potential
explanations for this observation. One possibility is that At5g55380 does not encode
for a wax synthase. But the findings presented in Chapter 3 of this thesis, the ectopic
expression of this gene in Arabidopsis seeds, clearly establish that At5g55380
encodes a wax synthase.
Clearly, the explanation lies elsewhere. The most likely explanation is that
At5g55380 is redundant in the production of wax esters.
This is apparent
considering that At5g55380 is one of 12 such genes in the Arabidopsis genome.
Although genetic studies in Arabidopsis have identified over 30 genes (cer mutants)
that are needed for surface lipid deposition, none of them to date have been in the
12 jojoba-like wax synthase genes. The fact that wax esters are only a small portion
of surface lipid constituent is the probable explanation as changes in wax ester
accumulation can be easily missed in the visual screen used to identify the cer
mutants.
Therefore as demonstrated in this thesis, characterization of wax synthase
paralogs in Arabidopsis will require a combination of a reverse genetic approach,
coupled with a heterologous expression system, either in yeast or Arabidopsis seed.
94
Figures and tables:
RATM54-0095-1_H
5’UTR
ATG
SALK_060303
TGA
3’UTR
1.026kb
Figure 1: T-DNA insertion of two At5g55380 knock-out mutants.
95
A
B
Mutant
Wt
C
D
12 DAP
Mutant
Wt siblings
6 DAP
Mutant
Col-0
Figure 2: Effect of mutation in At5g55308 on growth morphology. The
growth morphology of sibling plants that were homozygous for the wild type or
SALK_060303 allele was compared at different stages of development. A: Wild
type and mutant seedlings transferred from plates; B: Plants at about 7 days after
flowering; C: Seedlings 12 DAP on MS plate; D: 6 DAP seedlings.
96
Figure 3: Root length of SALK(SALK_060303) and RIKEN(RATM540095-1_H) compared to their wildtype siblings. SALK/RIKEN was generated by
crossing SALK_060303 and RATM54-0095-1_H homozygotes; Col-0 and Nossen
were also crossed then used as control.
97
Table 1: Chi-square test of T-DNA insertion segregation of SALK_060303.
Observed
Expected
WW
33
26
Ww
50
52
ww
Total
21
104
26
104
Chi-square: 2.923
Drgree of freedom: 2
p-value: 0.2318792
98
Table
2:
Chi-square
test
of
morphological
SALK_060303 line.
Observed
Expected
R_
83
78
rr
Total
21
104
26
104
Chi-square: 1.282
Drgree of freedom: 1
p-value: 0.2575179
phenotype
segregation
in
99
Table 3: Chi-square test of independent assortment of T-DNA insertion and
phenotypic mutation.
Observed
Expected
WWR_
31
19.5
WwR_
44
39
wwR_
8
19.5
WWrr
2
6.5
Wwrr wwrr
6
13
13
6.5
Chi-square:
Degree of freedom:
p-value:
Total
104
104
27.59
5
0.0000437
100
Table 4: Linkage between T-DNA insertion and morphological mutation calculated
by different methods.
METHOD
Sum of complementary classes
Weight mean
Product
Maximum likelihood
Minimum X2
RECOMBINATION VALUE (CM)
17
23
19
18
18
101
Figure 4: GC analysis of lipids from SALK_060303 homozygote (DAT-18),
heterozygote (DAT-9) and wild type sibling (DAT-4).
102
REFERENCES
Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK,
Zimmerman J, Barajas P, Cheuk R (2003) Genome-wide insertional
mutagenesis of Arabidopsis thaliana. Science 301: 653-657
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment
search tool. Journal of molecular biology 215: 403-410
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ
(1997) Gapped BLAST and PSI-BLAST: a new generation of protein database
search programs. Nucleic acids research 25: 3389-3402
Baker E (1982) Chemistry and morphology of plant epicuticular waxes. Cutler, D, F,,
Alvin, K, L,, Price, C, E ed (s). The plant cuticle. Academic Press: London, etc:
139-165
Bargel H, Koch K, Cerman Z, Neinhuis C (2006) Structure-function relationships of the
plant cuticle and cuticular waxes - a smart material? Functional plant biology 33:
893-910
Barney BM, Wahlen BD, Garner E, Wei JS, Seefeldt LC (2012) Differences in
Substrate Specificities of Five Bacterial Wax Ester Synthases. Applied and
Environmental Microbiology 78: 5734-5745
Beisson F, Koo AJK, Ruuska S, Schwender J, Pollard M, Thelen JJ, Paddock T,
Salas JJ, Savage L, Milcamps A, Mhaske VB, Cho YH, Ohlrogge JB (2003)
Arabidopsis genes involved in acyl lipid metabolism. A 2003 census of the
candidates, a study of the distribution of expressed sequence tags in organs, and a
Web-based database. Plant Physiology 132: 681-697
Benzioni A, Van Boven M, Ramamoorthy S, Mills D (2006) Compositional changes in
seed and embryo axis of jojoba (Simmondsia chinensis) during germination and
seedling emergence. Industrial crops and products 23: 297-303
Beopoulos A, Nicaud J-M, Gaillardin C (2011) An overview of lipid metabolism in
yeasts and its impact on biotechnological processes. Applied microbiology and
biotechnology 90: 1193-1206
103
Bligh EG, Dyer WJ (1959) A rapid method of total lipid extraction and purification.
Canadian journal of biochemistry and physiology 37: 911-917
Budke J, Goffinet B, Jones C (2011) A hundred-year-old question: is the moss calyptra
covered by a cuticle? A case study of Funaria hygrometrica. Annals of botany 107:
1279-1286
Carver TL, Gurr SJ (2008) 12 Filamentous fungi on plant surfaces. Annual Plant
Reviews, Biology of the Plant Cuticle 23: 368
Chen Q, Steinhauer L, Hammerlindl J, Keller W, Zou J (2007) Biosynthesis of
phytosterol esters: identification of a sterol o-acyltransferase in Arabidopsis. Plant
Physiol 145: 974-984
Cheng JB, Russell DW (2004) Mammalian wax biosynthesis. II. Expression cloning of
wax synthase cDNAs encoding a member of the acyltransferase enzyme family. J
Biol Chem 279: 37798-37807
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant J 16: 735-743
Costaglioli P, Joubes J, Garcia C, Stef M, Arveiler B, Lessire R, Garbay B (2005)
Profiling candidate genes involved in wax biosynthesis in Arabidopsis thaliana by
microarray analysis. Biochim Biophys Acta 1734: 247-258
Crisp S, Eaton R, Tinsley H (1984) Scheme for the identification of sperm whale oil and
its products in commercial formulations and in leather articles. Analyst 109: 14971502
Crum H (2001) Structural diversity of bryophytes. Recherche 67: 02
Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible W-R (2005) Genome-wide
identification and testing of superior reference genes for transcript normalization in
Arabidopsis. Plant Physiology 139: 5-17
Ding S-H, Huang L-Y, Wang Y-D, Sun H-C, Xiang Z-H (2006) High-level expression
of basic fibroblast growth factor in transgenic soybean seeds and characterization
of its biological activity. Biotechnology letters 28: 869-875
104
Edwards D, Abbot GD, JA R (1996) Cuticles of early land plants. Plant cuticles: an
integrated functional approach: 1-31
Eigenbrode SD (2004) The effects of plant epicuticular waxy blooms on attachment and
effectiveness of predatory insects. Arthropod Struct Dev 33: 91-102
Emanuelsson O, Brunak S, von Heijne G, Nielsen H (2007) Locating proteins in the cell
using TargetP, SignalP and related tools. Nat Protoc 2: 953-971
Fisher R, Balmukand B (1928) The estimation of linkage from the offspring of selfed
heterozygotes. Journal of genetics 20: 79-92
Heilmann M, Iven T, Ahmann K, Hornung E, Stymne S, Feussner I (2012) Production
of wax esters in plant seed oils by oleosomal co-targeting of biosynthetic enzymes.
Journal of Lipid Research
Heredia A (2003) Biophysical and biochemical characteristics of cutin, a plant barrier
biopolymer. Biochimica Et Biophysica Acta-General Subjects 1620: 1-7
Hofmann K (2000) A superfamily of membrane-bound O-acyltransferases with
implications for wnt signaling. Trends Biochem Sci 25: 111-112
Ishige T, Tani A, Sakai Y, Kato N (2003) Wax ester production by bacteria. Curr Opin
Microbiol 6: 244-250
Jenks MA, Tuttle HA, Eigenbrode SD, Feldmann KA (1995) Leaf Epicuticular Waxes
of the Eceriferum Mutants in Arabidopsis. Plant Physiol 108: 369-377
Jetter R, Kunst L (2008) Plant surface lipid biosynthetic pathways and their utility for
metabolic engineering of waxes and hydrocarbon biofuels. Plant Journal 54: 670683
Jetter R, Kunst L, Samuels AL (2006) Compasition of plant cuticular waxes. Biology of
the Plant Cuticle, Annual Plant Review 23: 145-181
Kalscheuer R, Steinbuchel A (2003) A novel bifunctional wax ester synthase/acylCoA:diacylglycerol acyltransferase mediates wax ester and triacylglycerol
biosynthesis in Acinetobacter calcoaceticus ADP1. J Biol Chem 278: 8075-8082
105
Karimi M, Inzé D, Depicker A (2002) GATEWAY™ vectors for< i>
Agrobacterium</i>-mediated plant transformation. Trends in plant science 7: 193195
Klypinaa N, Hanson SF (2008) Arabidopsis thaliana wax synthase gene homologues
show diverse expression patterns that suggest a specialized role for these genes in
reproductive organs. Plant Science 175: 312-320
Koch K, Bhushan B, Barthlott W (2008) Diversity of structure, morphology and wetting
of plant surfaces. Soft matter 4: 1943-1963
Kolattukudy PE (1976) Chemistry and biochemistry of natural waxes. Elsevier Scientific
Publishing Company
Koornneef M, Hanhart C, Thiel F (1989) A genetic and phenotypic description of
eceriferum (cer) mutants in Arabidopsis thaliana. Journal of Heredity 80: 118-122
Krauss P, Markstadter C, Riederer M (1997) Attenuation of UV radiation by plant
cuticles from woody species. Plant, Cell & Environment 20: 1079 - 1085
Kunst L, Samuels AL (2003) Biosynthesis and secretion of plant cuticular wax. Prog
Lipid Res 42: 51-80
Lai C, Kunst L, Jetter R (2007) Composition of alkyl esters in the cuticular wax on
inflorescence stems of Arabidopsis thaliana cer mutants. Plant J 50: 189-196
Landy A (1989) Dynamic, structural, and regulatory aspects of lambda site-specific
recombination. Annual review of biochemistry 58: 913-941
Lardizabal KD, Metz JG, Sakamoto T, Hutton WC, Pollard MR, Lassner MW (2000)
Purification of a jojoba embryo wax synthase, cloning of its cDNA, and production
of high levels of wax in seeds of transgenic arabidopsis. Plant Physiol 122: 645655
Lassner MW, Lardizabal K, Metz JG (1996) A jojoba beta-Ketoacyl-CoA synthase
cDNA complements the canola fatty acid elongation mutation in transgenic plants.
Plant Cell 8: 281-292
106
Leveau JH (2008) 11 Microbial communities in the phyllosphere. Annual Plant Reviews,
Biology of the Plant Cuticle 23: 334
Li F, Wu X, Lam P, Bird D, Zheng H, Samuels L, Jetter R, Kunst L (2008)
Identification of the wax ester synthase/acyl-coenzyme A: diacylglycerol
acyltransferase WSD1 required for stem wax ester biosynthesis in Arabidopsis.
Plant Physiol 148: 97-107
Lolle SJ, Hsu W, Pruitt RE (1998) Genetic analysis of organ fusion in Arabidopsis
thaliana. Genetics 149: 607-619
Müller C (2008) 13 Plant–Insect interactions on cuticular surfaces. Annual Plant Reviews,
Biology of the Plant Cuticle 23: 398
Mansfield S, Briarty L (1991) Early embryogenesis in Arabidopsis thaliana. II. The
developing embryo. Canadian journal of botany 69: 461-476
Martin A, Synge R (1941) A new form of chromatogram employing two liquid phases: A
theory of chromatography. 2. Application to the micro-determination of the higher
monoamino-acids in proteins. Biochemical Journal 35: 1358
Martin JT, Juniper BE (1970) The cuticles of plants. The cuticles of plants.
Matsuda F, Furusawa C, Kondo T, Ishii J, Shimizu H, Kondo A (2011) Engineering
strategy of yeast metabolism for higher alcohol production. Microbial Cell
Factories 10
Matsuda S, Inoue T, Lee HC, Kono N, Tanaka F, Gengyo‐Ando K, Mitani S, Arai H
(2008) Member of the membrane‐bound O‐acyltransferase (MBOAT) family
encodes a lysophospholipid acyltransferase with broad substrate specificity. Genes
to Cells 13: 879-888
Metz JG, Pollard MR, Anderson L, Hayes TR, Lassner MW (2000) Purification of a
jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in
high erucic acid rapeseed. Plant Physiol 122: 635-644
Miwa TK (1971) Jojoba oil wax esters and derived fatty acids and alcohols: gas
chromatographic analyses. Journal of the American Oil Chemists' Society 48: 259264
107
Nawrath C (2006) Unraveling the complex network of cuticular structure and function.
Current Opinion in Plant Biology 9: 281-287
Neumann E, Kakorin S, Tsoneva I, Nikolova B, Tomov T (1996) Calcium-mediated
DNA adsorption to yeast cells and kinetics of cell transformation by
electroporation. Biophysical journal 71: 868-877
Nielsen J (2009) Systems biology of lipid metabolism: From yeast to human. Febs Letters
583: 3905-3913
Oelkers P, Cromley D, Padamsee M, Billheimer JT, Sturley SL (2002) The DGA1
gene determines a second triglyceride synthetic pathway in yeast. Journal of
Biological Chemistry 277: 8877-8881
Pfüindel EE, Agati G, Cerovic Z (2006) optical properties of plant surface. Annual Plant
Reviews 23: 216-249
Post-Beittenmiller D (1998) The cloned eceriferum genes of Arabidopsis and the
corresponding glossy genes in maize. Plant Physiology and Biochemistry 36: 157166
Raven JA, Edwards D (2004) Physiological evolution of lower embryophytes:
adaptations to the terrestrial environment. The Evolution of Plant Physiology: From
Whole Plants to Ecosystems ed. Hemsley A, Poole I: 17-41
Riederer M, Muller C (2008) Annual Plant Reviews, Biology of the Plant Cuticle, Vol
23. Wiley. com
Riederer M, Schreiber L (1995) Waxes: the transport barriers of plant cuticles. In, Vol 6.
The Oily Press: Dundee, Scotland, pp 131-156
Riederer M, Schreiber L (2001) Protecting against water loss: analysis of the barrier
properties of plant cuticles. J Exp Bot 52: 2023-2032
Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Molecular biology and evolution 4: 406-425
108
Samuels L, Kunst L, Jetter R (2008) Sealing plant surfaces: cuticular wax formation by
epidermal cells. Annu Rev Plant Biol 59: 683-707
Sandager L, Gustavsson MH, Ståhl U, Dahlqvist A, Wiberg E, Banas A, Lenman M,
Ronne H, Stymne S (2002) Storage Lipid Synthesis Is Non-essential in Yeast.
Journal of Biological Chemistry 277: 6478-6482
Shaw AJ (2003) Structural Diversity of Bryophytes. The Bryologist 106: 343-343
Shi S, Valle-Rodriguez JO, Khoomrung S, Siewers V, Nielsen J (2012) Functional
expression and characterization of five wax ester synthases in Saccharomyces
cerevisiae and their utility for biodiesel production. Biotechnology for Biofuels 5:
7
Shindou H, Eto M, Morimoto R, Shimizu T (2009) Identification of membrane Oacyltransferase family motifs. Biochem Biophys Res Commun 383: 320-325
Sieber P, Schorderet M, Ryser U, Buchala A, Kolattukudy P, Metraux JP, Nawrath
C (2000) Transgenic Arabidopsis plants expressing a fungal cutinase show
alterations in the structure and properties of the cuticle and postgenital organ
fusions. Plant Cell 12: 721-738
Siloto RMP, Findlay K, Lopez-Villalobos A, Yeung EC, Nykiforuk CL, Moloney MM
(2006) The accumulation of oleosins determines the size of seed oilbodies in
Arabidopsis. The Plant Cell Online 18: 1961-1974
Sims TL, Goldberg RB (1989) The glycinin Gy1 gene from soybean. Nucleic acids
research 17: 4386
Solovchenko A, Merzlyak M (2003) Optical properties and contribution of cuticle to UV
protection in plants: experiments with apple fruit. Photochem Photobiol Sci 2: 861866
Spencer G, Tallent W (1973) Sperm whale oil analysis by gas chromatography and mass
spectrometry. Journal of the American Oil Chemists Society 50: 202-206
Stöveken T, Kalscheuer R, Malkus U, Reichelt R, Steinbuchel A (2005) The wax ester
synthase/acyl coenzyme A:diacylglycerol acyltransferase from Acinetobacter sp.
109
strain ADP1: characterization of a novel type of acyltransferase. J Bacteriol 187:
1369-1376
Stark RE, Tian S (2008) 3 The cutin biopolymer matrix. Annual Plant Reviews, Biology
of the Plant Cuticle 23: 126
Stoveken T, Steinbuchel A (2008) Bacterial acyltransferases as an alternative for lipasecatalyzed acylation for the production of oleochemicals and fuels. Angewandte
Chemie-International Edition 47: 3688-3694
Taki T, Kasama T, Handa S, Ishikawa D (1994) A simple and quantitative purification
of glycosphingolipids and phospholipids by thin-layer chromatography blotting.
Analytical biochemistry 223: 232-238
Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics
analysis (MEGA) software version 4.0. Molecular biology and evolution 24: 15961599
Tanaka H, Machida Y (2008) 10 The cuticle and cellular interactions. Annual Plant
Reviews, Biology of the Plant Cuticle 23: 312
Teerawanichpan P, Qiu X (2010) Fatty acyl-CoA reductase and wax synthase from
Euglena gracilis in the biosynthesis of medium-chain wax esters. Lipids 45: 263273
Tehlivets O, Scheuringer K, Kohlwein SD (2007) Fatty acid synthesis and elongation in
yeast. Biochimica Et Biophysica Acta-Molecular and Cell Biology of Lipids 1771:
255-270
110
CHAPTER V: GENERAL CONCLUSIONS
The goals of the work presented in this thesis are to expand the limited
knowledge on wax ester biosynthetic pathway, and to generate the technology
base for the future production of wax esters in microorganisms or seed crops as
biorenewable chemicals. To achieve these goals, we studied 9 wax ester
biosynthetic genes. Based on sequence homology, 6 of these genes were
classified as jojoba-like WS, and 3 were classified as bi-functional WS/DGAT
enzymes. These nine genes were tested by transgenic expression in yeast and
Arabidopsis platforms.
Expression in yeast resulted in the functional characterization of the
Arabidopsis At5g55340 WS gene and of a maize WS gene. The substrate
specificity of these two enzymes was characterized by supplying potential
substrates in the medium supporting the growth of the transgenic yeast. These
experiments revealed that the At5g55340-encoding WS utilizes fatty acid and
primary alcohols substrates with chain length of between 13 and 19 carbons. The
enzyme exhibits a substrate preference pattern in which the fatty acid and the
primary alcohol have similar chain length, and a preference for saturated rather
than unsaturated fatty acids and alcohols.
The maize WS that was also active in yeast displayed a different substrate
preference. This enzyme can use fatty acid substrates from 13 to 19 carbons, but
the primary alcohol substrate has to be shorter than 17 carbons in chain length.
This enzyme also favors unsaturated substrates. The maize WS is also capable of
111
synthesizing two biologically unusual esters, namely ethyl esters and benzyl ester.
The significance of this finding is that fatty acid ethyl esters have applications in
biofuels, as a biodiesel. The utility of benzyl esters would need additional
applications research as its chemo-physical properties are not well understood.
All the 9 candidate genes were also expressed in Arabidopsis seeds,
along with jojoba KCS and FAR, All three components were under the regulation
of the seed-specific Glycinin promoter. Analysis of the resulting seed oil revealed
that At5g55380 is capable of assembling wax esters using 16 and 18 carbon fatty
acid and C20:1, C22:1 and C24:1 primary alcohols.
The two expression platforms (yeast and seeds) were complementary in
functionally demonstrating the wax synthase activity of three gene products.
At5g55380, which was active in seeds, requires substrates that were not available
for the yeast feeding experiments, namely very long chain unsaturated primary
alcohols. In contrast, in the transgenic Arabidopsis lines carrying At5g55340 and
the maize WS (which were active in yeast) did not synthesize any wax ester in the
seed oil. This is probably because the KCS and FAR we chose were unable to
provide the appropriate chain length of the alcohol substrate. The At5g55340 WS
has low activity when the chain length of substrates is increased, and the shortest
primary alcohol found in the Arabidopsis lines carrying KCS and FAR was C20:1.
Similarly, the maize WS showed no activity in Arabidopsis seed for the same
reason since it can only utilize C13 and C15 alcohols in yeast.
These results indicate that yeast and plant expression systems cannot
replace each other, and are therefore complementary. One advantage of the yeast
112
expression platform is that we can manipulate the substrate pool as long as we
are able to obtain the substrates. The substrate pool can be expanded to short
alcohol, branched chain alcohol, aromatic alcohols, sterol and much more; this is
impossible for the plant system. However, plant expression system can also
provide substrates that are difficult to purchase. Moreover, by using different KCS
and FAR it may be possible to expand the substrate pools that can be provided in
seeds.
A reverse genetic study, using T-DNA insertion mutants was also
conducted, with the Arabidopsis gene At5g55380. Biochemical analysis of plant
lipids showed that the At5g55380 mutants did not differ from the wild type,
indicating that this gene is redundant in producing wax esters.