Download Amino acid sequence identity between the HA1 of influenza A

Journal o f General Virology (1992), 73, 1159-1165.
Printed in Great Britain
1159
Amino acid sequence identity between the HA1 of influenza A (H3N2)
viruses grown in mammalian and primary chick kidney cells
Jacqueline M. Katz* and Robert G. Webster
Department of Virology and Molecular Biology, St Jude Children's Research Hospital, 332 North Lauderdale,
P.O. Box 318, Memphis, Tennessee 38101, U.S.A.
Primary isolation of type A influenza (H3N2) virus in
mammalian Madin Darby canine kidney (MDCK) cells
results in a virus with haemagglutinin (HA) identical to
that of the virus replicating in the infected individual,
whereas similar isolation of virus in the embryonated
egg results in the selection of variants with amino acid
substitutions in the globular head region of the H A
molecule. To determine whether other mammalian and
avian host cells routinely used in laboratory isolation of
influenza viruses also impose a selective pressure on the
replicating virus population, the HA of viruses isolated
in several different primary or continuous mammalian
cells or avian cells has been characterized. The HAs of
H3N2 viruses isolated in monkey kidney LLC-MK2
and primary guinea-pig kidney cell culture were
antigenicaUy identical to M D C K cell-grown virus
isolated from the same patient. The deduced amino
acid sequence over the region of HA1 encoding
residues implicated in host cell-mediated sequence
variation revealed that the HA sequences of viruses
isolated and passaged in these mammalian cell types,
and in a human lung continuous cell line (MRC-5),
were identical to that of the virus present in the infected
individual. In addition, isolation of virus in avian
primary chick kidney (CK) cells yielded a predominant
virus with HA identical to that of mammalian cellgrown virus and the virus present in the original clinical
material. However, passage of CK cell-grown virus in
chicken embryos (eggs) resulted in the predominance
of viruses with amino acid substitutions in HA, a
minority of which resulted in antigenic variation. Since
CK cell culture is used in the development of live
attenuated influenza vaccines, the sequence identity
between CK cell-grown virus and the virus present in
the infected individual is reassuring. Nevertheless,
subsequent passage of virus strains in eggs, necessary
for vaccine production, must be monitored closely.
Introduction
pocket of the HA molecule explaining why, in addition
to their presumptive selective advantage for the virus in
eggs, these substitutions may also result in concomitant
antigenic changes if they occur in antigenically relevant
sites. Typically, two or three distinct egg-grown influenza viruses can be isolated from a single infected
individual (Katz & Webster, 1988; Wang et al., 1989) or
from the progeny of plaque-picked MDCK cell-grown
virus subsequently passaged in eggs (Robertson et al.,
1987). The predominant egg-grown virus isolated by
limiting dilution of original clinical material in eggs is
usually antigenically similar to MDCK cell-grown
viruses from the same source, but nevertheless possesses
one or more amino acid substitutions in HA1, whereas
minor variants are both antigenically and molecularly
distinct from virus isolated in MDCK cells.
In addition to mammalian MDCK cells and embryonated eggs, a number of different mammalian and avian
primary or continuous cell culture systems are currently
used for the primary isolation of influenza viruses from
Use of polymerase chain reaction (PCR) technology to
amplify the genome of very low amounts of influenza
virus present in clinical samples has, for the first time,
enabled the direct sequence analysis of human influenza
viruses without their prior growth in embryonated eggs
or cultured cells. For both type A H3N2 and type B
influenza viruses, such analyses have provided the first
direct evidence that viruses grown in the mammalian
Madin Darby canine kidney (MDCK) cell line possess
haemagglutinin (HA) identical in amino acid sequence
to that of the virus present in the original clinical sample.
On the other hand, viruses isolated from the same
patients but grown in embryonated eggs possess amino
acid substitutions in the HA molecule not seen in viruses
present in the original samples (Katz et al., 1990;
Robertson et al., 1990).
The changes which occur in the HA of egg-grown type
A and B viruses are located around the receptor-binding
0001-0740 © 1992 SGM
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 20:35:15
1160
J. M. Katz and R. G. Webster
clinical isolates in laboratories world-wide. These include rhesus monkey and baboon kidney cells, human
MRC-5 cells and avian primary chick kidney (CK) cells
(Frank et al., 1979; Oxford et al., 1983; Maassab et al.,
1985; Lathey et al., 1986). In most cases, the embryonated egg is used for further passage and the growth of
large quantities of virus for serological or molecular
analyses. However it has not been determined whether
replication of influenza virus in these other host cell
systems, like the egg, results in the selection of antigenic
and structural variants of HA or whether, like MDCK
cells, they provide a non-selective system for the isolation
of the virus identical to that replicating in the respiratory
tract of infected individuals.
This question is of particular importance for virus
isolated in primary CK cell culture, since this host cell
system is used in the preparation of cold-adapted master
virus strains and their reassortant viruses containing the
HA and neuraminidase of relevant epidemic strains
(Maassab et al., 1985). Such viruses are under trial as live
attenuated influenza vaccines (Wright et al., 1982;
Murphy & Clements, 1989). Because potential reference
and vaccine strains of virus may also be initially isolated
in mammalian cells of different species, it is important to
establish whether these mammalian cells behave like
MDCK cells in their ability to provide a non-selective
growth environment for human influenza viruses.
The aim of this study, therefore, was to establish at
both the antigenic and molecular levels whether the
isolation of human type A H3N2 influenza viruses in
different mammalian cell types or in primary CK cells
leads to the amplification of variant influenza viruses
selected on the basis of their enhanced capacity for
growth in a particular host ceil. The molecular basis of
variation in the HA of viruses isolated in these different
host cell types will provide the necessary insight to
evaluate current virus isolation procedures and may also
provide the basis for establishing a protocol for virus
isolation which will minimize the risk of selecting host
cell-selected variants from epidemic field strains of
influenza viruses.
Methods
Virus isolation in different host cell types. Throat wash samples from
patients with clinical symptoms of influenza were collected in PBS to
which 5% BSA was added subsequently. Samples were stored in
aliquots at - 70 °C until use. Growth of virus in MDCK cell culture in
the presence of 1 ~tg/ml TPCK trypsin or in the amniotic and/or
allantoic cavity of embryonated eggs has been described previously
(Katz & Webster, 1988). Typically, influenza viruses were obtained
from MDCK cells infected with a 10-2 to 10-4 dilution of the original
clinical sample. In contrast, primary isolation of viruses in eggs was
achieved at dilutions of throat wash material of 10° to 10-1.
A/Mem/14/85 viruses were also isolated from the throat wash material
in the mammalian and avian cell types outlined in Table 1. LLC-MK2
Table 1. Different host cells used for the growth of type A
influenza H3N2 viruses
Host cell
Species and organ of origin
Mammalian
MDCK
LLC-MK2
MRC-5
WI-38
GPK
Canine kidney
Rhesus monkey kidney
Human foetal lung
Human embryonic lung
Guinea-pig kidney
Epithelial
Epithelial
Fibroblast-like
Fibroblast-like
Primary epithelial
cell culture
Embryonated chicken egg
(10-11 day old)
Chicken kidney (1 day old)
Amniotic and allantoic
cavities
Primary epithelial
cell culture
Avian
Egg
CK
Cell type
cells were obtained from the laboratory of Dr Allen Portner of this
Department. MRC-5 cells were the generous gift of Dr L. Potash,
Program Resources Incorporated, McLean, Va., U.S.A. Primary
guinea-pig kidney (GPK) cells were purchased from Whittaker MA
Bioproducts. Influenza virus was grown in the presence of 0.5 ktg/ktl
TPCK trypsin in these mammalian cell cultures. Primary CK cells
were prepared from newly hatched chicks as described (Maassab et al.,
1985). Cells were cultured in DMEM containing D-valine to inhibit "
fibroblast cell growth and 10% heat-inactivated foetal calf serum, ~
penicillin, streptomycin and L-glutamine. Influenza viruses cultivated
in mammalian cells other than MDCK cells and in the primary CK
cells were isolated in culture wells infected with undiluted or a 10-1
dilution of original throat wash material. Viruses cloned in CK cells
were isolated at 10-3.5 to 10-*'s dilution of CK cell culture supernatant.
Subsequent passage of CK cell-grown viruses in the allantoic cavity of
eggs was performed at the highest dilution of CK cell supernatant (10°
to 10-2 ) resulting in growth of virus in eggs.
Antigenic analyses. Haemagglutination titration and haemagglutination inhibition (HI) tests were performed in microtitre plates using '
0.5 % chicken erythrocytes. Mouse ascitic fluids were used as the source
of monoclonal antibodies (MAbs) to the H3 HA of egg-grown
A/Bangkok/1/79 (B49-4, B45-5, B88-1) and A/Mem/12/85 (E 12-1, E 122) viruses, and MDCK cell-grown A/Mere/12/85 (M 12-3) virus. These
antibodies have been used in other studies and are known to detect
differences in host cell variants of H3N2 viruses (Katz et al., 1988;
Wang et al., 1989). The preparation of MAbs has been described
previously by Kida et al. (1982).
P C R gene amplification and direct sequencing. Amplification of the
HA1 coding region of the HA gene of influenza viruses grown in
different mammalian or avian host cells was achieved using primers
M8 (5' TTCGCCCAAAAACTTCCCGG 3') and M5 (5' ATG A T G T G C C G G A T T A T G C C 3') which are complementary to
virion RNA nucleotides 72 to 91 and 376 to 395, respectively, and
primer M6 (5' C C T G G G A C A T G C C C C A T A T G 3') complementary
to plus-strand DNA nucleotides 998 to 979. Primers M8 and M5 were
used for both DNA synthesis and amplification by PCR. The methods
used for cDNA synthesis, PCR amplification and subsequent
purification of amplification products have been described previously
(Saiki et al., 1988; Katz et al., 1990). Depending on the primers used,
D N A products of either 623 (M5 and M6) or 930 (M8 and M6)
nucleotides in length were amplified. Purified DNA products were
sequenced by the dideoxynucleotide chain-termination method (Sanger
et al., 1977) using modified T7 DNA polymerase (US Biochemical) and
nested oligonucleotide primers which had been end-labelled with
[y-32p]ATP in the presence of T4 polynucleotide kinase (Bethesda
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 20:35:15
H3N2 influenza grown in different host cells
Research Laboratories). A total of seven nested primers, five priming
for positive sense DNA and two priming for negative sense DNA, were
used to determine overlapping sequences of the DNA products
obtained from multiple independent amplification reactions. The
templates for PCR reactions were eDNA synthesized from viral RNA
extracted either from undiluted tissue culture supernatants or dilutions
(10-1 to 10-2) of allantoic fluid to ensure that similar amounts of tissue
culture-grown and egg-grown viruses were used for amplification of the
HA gene.
Results
Antigenic and sequence analyses of A/ Mem/14/85 viruses
from original clinical samples isolated in different
mammalian and avian host cells
To c o m p a r e the H A s o f H 3 N 2 virus isolated from the
same clinical material by culture in cells f r o m different
m a m m a l i a n and avian species, an antigenic analysis was
performed by H I assay on virus f r o m a single clinical
sample (A/Mem/14/85) isolated in some o f the cell types
listed in Table 1. T h e A / M e m / 1 4 / 8 5 virus original
patient sample and viruses isolated from it were chosen
for study because the H A sequence o f the p r e d o m i n a n t
virus species replicating in this patient has been
determined previously (Katz et al., 1990).
Viruses isolated and passaged in C K cells are usually
passaged in the allantoic cavity of eggs prior to their
antigenic characterization because virus titres in culture
supernatants are often too low for use in antigenic
analysis. Therefore, the antigenic analyses o f C K cellgrown viruses described in this study have also been
performed on C K cell-grown viruses passaged once by
limiting dilution in the allantoic cavity o f eggs. The H I
reactivity o f three M A b s , representative of a larger
panel, for viruses grown in three different m a m m a l i a n
cell types (LLC-MK2, M D C K and G P K ) are shown in
Table 2. The H A molecules o f viruses isolated f r o m each
o f these cell types were antigenically identical. The virus
grown in p r i m a r y C K cells and then passaged once in
eggs was antigenically similar to the m a m m a l i a n cellgrown viruses, as was the p r e d o m i n a n t egg-grown virus
isolated by limiting dilution (clone 14-1-1). However,
antigenic variation was observed a m o n g egg-grown
viruses isolated from this patient as demonstrated by the
failure of egg-grown clone 14-2-4 to react with M A b
M12-3. The H A titre o f A / M e m / 1 4 / 8 5 virus grown only
in the M R C - 5 m a m m a l i a n cell line was too low to enable
antigenic analysis by H I assay.
W e have demonstrated previously that the M D C K
cell-grown virus isolated f r o m this individual is identical
in a m i n o acid sequence over a critical region o f H A 1 to
the virus present in the original clinical material and
distinct from the sequence in the viruses isolated in eggs
(Katz et al., 1990). To determine whether isolation o f the
virus present in the original clinical sample by growth in
1161
Table 2. Antigenic phenotype of A/Mem/14/85 (H3N2)
viruses isolated and passaged in different mammalian
and avian host cells
HI titre to virus grown in
Mammalian cell*
Eggt
CK-egg:~
MAb
MDCK
LLCMK2
GPK
Clone Clone
14-1-1 14-2-4
B49/4
M12-3
E12-2
6400§
12800
6400
6400
12800
12800
3200
3200
12800
800
1600
800
1600
<100
3200
3200
3200
3200
* Viruses were isolated and passaged at low dilution in one of the
three mammalian cell types shown.
t Viruses were isolated by limiting dilution in the amniotie cavity
and were then passaged in the allantoic cavity of eggs. Clone 14-1-1
represents the most frequently isolated egg-grown virus of original
throat wash material whereas clone 14-2-4is representative of the virus
obtained after low dilution passage of the original clinical isolate
(Wang et al., 1990).
:~CK-egg virus was isolated and passaged once in CK cells and then
passaged once in the allantoic cavity of eggs.
§ HI titres represent the reciprocal of the highest dilution of antibody
inhibiting 4 HA units of virus.
Table 3. Comparison of HA 1 amino acid sequences of
A/Mem/14/85 (H3N2) viruses grown in different
mammalian and avian host cells
Amino acid at HA1 residue number*
Source of
virust
Original throat wash
MDCK
LLC-MK2
MRC-5
GPK
Egg
(clone 14-1-1)
(clone 14-2-4)
CK
CK-egg
145
246
248
Asn
Asn
Asn
Asn
Asn
Asn
Asn
Ash
Asn
Asn
Thr
Thr
Thr
Thr
Thr
Asn
Lys
Asn
Ash
Asn
Asn
Asn
Asn
Iie:~
Thr
Thr
lle~
* The deduced amino acid sequence of HA1 residues 120 to 300 was
determined. Only residues where substitutions occurred and/or which
contributed to the glycosylation site at 246 to 248 are shown.
t Viruses were isolated directly from the original throat wash
material or by primary growth and passage in one of these host cell
types. CK-egg virus was isolated and passaged once in CK cells and
was then passaged once in the allantoic cavity of eggs.
:~Denotes loss of potential glycosylation site.
these other cell types resulted in sequence changes in the
H A molecule, purified P C R amplification products o f
the gene segment encoding m o s t o f H A 1 were sequenced
directly to deduce the a m i n o acid sequence o f residues
120 to 300 in H A 1 o f the p r e d o m i n a n t virus replicating in
a particular host cell. This region o f H A encompasses the
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 20:35:15
1162
J. M. Katz and R. G. Webster
Table 4. H I reactivity of A/Mem/6/86 viruses cloned in eggs, CK or MDCK cells*
Host cell used to isolate (and passage) virus clone
CK (egg)t
MDCK
Egg
MAb
6.1E
9.1E
ll. IE
18.1E
E8.2
El2.1
E20.1
M10.1
B45-5
B88-1
El2-1
M 12-3
12800
< ~/
<
<
12800
<
6400
<
3200
3200
<
3200
800
1600
<
800
3200
200
100
3200
3200
<
12800
<
1600
1600
<
<
1600
6400
<
6400
* The antigenic characterization of egg- and MDCK cell-grown A/Mem/6/86 clones has been
described previously (Katz & Webster, 1988).
t Viruses were isolated and then cloned twice in primary CK cell culture followed by a single
passage in the allantoic cavity of eggs.
:~ <, Titre of less than 100.
receptor-binding site and antigenic sites on the globular
head of H A l and includes all of the amino acid residues
known to be affected by host cell-mediated selection of
A/Mem/14/85 variants and most other H 3 N 2 viruses.
Amino acid residues in H A 2 have not been implicated in
host cell-mediated selection of variant viruses. For
comparison, the previously determined sequence of
M D C K ceil-grown and egg-grown virus, and the virus
present in the original throat wash (Katz et al., 1990) are
given in Table 3 along with the new sequence information for viruses grown in other host cell types. The H A
molecules of viruses isolated and passaged once or twice
in each of the different m a m m a l i a n cell types tested were
identical in amino acid sequence to that of the virus
present in the original throat wash material. Similarly
the H A of virus isolated by passage of the throat wash
sample in primary C K cells was identical in amino acid
sequence over the region analysed to those of m a m malian cell-grown viruses and to that of the virus present in
the clinical sample. However, a single passage of the C K
cell-grown virus in eggs resulted in the isolation of virus
with an amino acid sequence in the H A identical to that
of the predominant virus isolated by passage in eggs
exclusively (clone 14-1-1). A single nucleotide substitution resulted in an amino acid substitution at residue
248 in HA1 ( T h r - I l e ) and the loss of the N-linked glycosylation site at residues 246 to 248 of HA1 (Asn-SerT h r - * A s n - S e r - ~ . This substitution appeared to be
antigenically silent as determined by the panel of MAbs
used since both the egg-grown virus (clone 14-1-1) and
the C K cell-grown virus passaged in eggs were antigenically identical to the m a m m a l i a n cell-grown viruses. This
substitution in H A l was stable, since virus passaged a
second and third time in the allantoic cavity of eggs
retained this substitution (data not shown). These results
indicate that none of the m a m m a l i a n or avian cell culture
types tested selected viruses with variation in the H A
molecule. However, a single passage in eggs of C K cell-
grown virus amplified a variant virus population typical
of the most frequently isolated egg-grown virus recovered from this patient sample.
Antigenic and sequence analyses of viruses isolated in CK
cells and passaged in eggs
The above results indicate that viruses isolated from
clinical material and those cultivated from this source in
C K cells are structurally identical in the region of HA1
examined, but that a subsequent single passage in eggs
results in the selection of a virus population possessing an
amino acid sequence change which distinguishes this
virus from that present in the sample material as well as
virus from this source grown in m a m m a l i a n cells. In this
case, the change in amino acid sequence did not result in
any apparent alteration in the antigenicity of the H A of
this C K cell- and egg-grown virus.
However, since the use of C K cell-grown virus as a live
attenuated vaccine depends on its passage in eggs,
we further examined the extent of antigenic and amino
acid sequence heterogeneity which m a y exist in viruses
isolated in C K cells and passaged subsequently in eggs.
We have previously shown that the heterogeneity in H A
of egg-grown influenza viruses isolated from different
infected individuals can also be demonstrated in multiple
clones from a single individual. Therefore we chose to
examine multiple clones isolated in primary C K cells at
limiting dilution of the original throat wash sample
which were then passaged once in eggs. Since M D C K
cell-grown and egg-grown clones of A/Mem/6/86 virus
have been characterized previously (Katz & Webster,
1988), this virus was chosen for the analyses of viruses
cloned in primary C K cells. The H I reactivity of viruses
with four discriminating MAbs, representative of a
larger panel used, are shown in Table 4. Of seven clones
isolated in C K cells and passaged in eggs, five (71%)
were antigenically similar to the virus grown in M D C K
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 20:35:15
H3N2 influenza grown in different host cells
1163
Table 5. Comparison of amino acid sequences in HA1 of A/Mem/6/86 viruses grown
in MDCK cells, CK cells and/or eggs*
Nucleotides and am i no acid at HA1 residue no.
Host cell used
to isolate (or
Clone
passage) virus
no.
138
145
156
193
229
238
M10.1
GCT
Ala
-t
AAC
Asn
-
GAA
Glu
-
-
AAA:~
AGA
Arg
GGA
Gly
-
AAA
Lys
-
-
AAC
Ash
AAA
Lys
-
MDCK
Egg
E8.2
El2.1
-
Lys
E20.1
-
AAA
Lys
.
-
.
.
CK
C K (egg)
9.1
9.1E
.
-
CK
C K (egg)
CK
11.1
II.1E
18.1
.
.
.
.
.
.
.
.
C K (egg)
18.1E
.
.
.
.
.
.
.
ACT
Thr
.
.
CK
C K (egg P1)
C K (egg P2)
Uncloned
Uncloned
Uncloned
.
.
.
.
AAA
Lys
.
.
-
-
.
.
.
.
.
.
-
.
.
.
.
.
.
AGA
Arg
AGA
Arg
.
.
.
.
.
.
.
* Virus clones 9.1, 11.1 and 18.1 were isolated and cloned once by limiting dilution of the
original throat wash material in p r i m a r y C K cells. These clones were subsequently passaged once in
eggs ( 9 . r E , l l . t E and t 8 . l E ) .
t -, No change in sequence from M D C K cell-grown virus.
:~ The amino acid residue at H A 1 156 of egg-grown E 12.1 virus was incorrectly reported as Glu in
a previous communication (Katz & Webster, 1988). In the course of this study it was determined
that this virus had an amino acid substitution of Glu-~Lys at residue 156.
cells, one virus clone (9.1E) was antigenically identical
to a variant isolated by passage in eggs alone (El2.1),
and the remaining virus clone (6.1E) was not only
antigenicaUy distinct from all of the CK-egg-grown
viruses and MDCK cell-grown virus, but also from any
of the variants isolated after growth exclusively in eggs.
These results indicate that antigenic variants can arise
following passage of CK cell-grown virus in eggs, but
that the most frequently isolated virus clone is antigenically identical to mammalian MDCK cell-grown viruses
isolated from the same source.
To determine the amino acid sequence diversity in the
HA of these viruses, the region of the HA gene encoding
HA1 was amplified and sequenced for three
A/Mem/6/86 virus clones grown in CK cells before
(clones 9.1, 11.1 and 18.1) and after (clones 9.1E, 11.1E
and 18.1E) a single passage in eggs. These sequences
were compared with those of the predominant (uncloned) CK cell-grown A/Mem/6/86 virus before and
after one or two passages in eggs. Differences in the
deduced amino acid sequences in HA1 are given in Table
5 and are also compared with previously determined
sequences of an MDCK cell-grown clone and virus
clones isolated and passaged exclusively in eggs (Katz &
Webster, 1988). The predominant (uncloned)
A/Mem/6/86 virus grown in CK cells was identical in
HA1 sequence to MDCK cell-grown virus. Two of the
three clones isolated in CK cell culture (9.1 and 11.1)
also shared this sequence in HA1. However, the third
CK cell-grown clone (18.1) had an amino acid substitution at residue 238 (Lys--,Arg). This substitution has not
been observed in any other A/Mem/6/86 virus grown
either in MDCK cells, CK cells or eggs.
After a single passage in eggs, clone 9.1E had acquired
a single base mutation resulting in an amino acid
substitution at residue 156 (Glu-~Lys). This substitution
at position 156 was also observed in the variant (El2.1)
isolated directly in eggs which displayed an antigenic
phenotype identical to that of 9.1E (Table 4) and
therefore explained the altered antigenic phenotype in
both these viruses. Clone 18.1 after passage in eggs
retained the unique amino acid substitution at position
238 and had not acquired any other changes in HA1.
Clone l l. IE which was antigenicaUy identical to
MDCK cell-grown virus also did not acquire any
sequence change in HA1 as a result of one passage in
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 20:35:15
1164
J. M . Katz and R. G. Webster
eggs (HA1 residues 1 to 300 were sequenced to confirm
this). Similar results were obtained when the uncloned
CK cell-grown virus was passaged once in eggs.
However, after a second passage in eggs, the virus
acquired an amino acid substitution at position 138 of
HA1, indicating that virus with an HA1 sequence
identical to MDCK cell- or CK cell-grown virus was not
stable in eggs. In support of this, after a second passage
in eggs, the HA titre of virus had increased 30-fold. The
substitution at residue 138, however, did not result in any
antigenic change in the HA (data not shown).
These results indicate that amino acid substitutions in
HA1 that result in antigenic change occur only in a
minority (two of seven) of viruses isolated in CK cells
and then passaged in eggs. The predominant CK-egggrown virus, although it may have possessed sequence
changes in HA1, was nevertheless antigenically identical
to mammalian cell-grown virus.
Discussion
This study has shown that cultivation of type A H3N2
influenza viruses from original clinical material in
mammalian cell lines other than in MDCK cells results
in the isolation of a predominant virus species with HA 1
that is antigenically and structurally indistinguishable
from that of MDCK cell-grown virus. These results
reflect the structural similarity between influenza viruses
grown in vitro in mammalian cell culture systems and the
virus resulting from the replication in the respiratory
epithelium of infected humans. This establishes the
MDCK cell line frequently used for in vitro cultivation of
influenza viruses as a valid representative of mammalian
cell types as far as the isolation of influenza virus is
concerned. Of the mammalian cell types used in the
study, MDCK cells provided the most sensitive host cell
system for the primary isolation of virus and best yields
in subsequent passage of the viruses.
With only one exception, primary CK cells like the
different mammalian cell lines tested, supported the
replication of virus with HA identical in amino acid
sequence to that of virus isolated directly from infected
individuals. Clone 18.1 had a unique amino acid
substitution at HA1 residue 238. This residue is not
located in an antigenic site, nor is it in close proximity to
amino acid residues involved in receptor binding. The
isolation of this clone may reflect a low level of
heterogeneity in the virus population present in the
original clinical specimen (Robertson et al., 1991).
Nevertheless, the finding that CK cells represent an
avian cell type that does not select influenza viruses with
structural changes in the HA is reassuring considering
the use of CK cells for the cold-adaptation of master
strains of virus and generation of reassortant viruses in
the preparation of live attenuated vaccines (Maassab,
1967; Cox et al., 1979).
Only upon subsequent passage of virus in the allantoic
cavity of eggs do variants with amino acid sequence
changes in HA1 predominate. This difference between
the isolation of influenza viruses in 1-day-old avian CK
cell culture and in the allantoic cavity of 10- or 11-day-old
embryonated eggs, may be a result of the heterogeneous
cell types which are infected following inoculation of the
allantoic cavity of eggs. Although the endodermal cells of
the chorioallantoic membrane are primarily infected
following intra-allantoic inoculation, virus may also
replicate in cells of the amniotic membrane or the
embryo's respiratory tract. It is possible that one or more
of these cell types provides the selective environment for
the replication of variant viruses in eggs not provided by
the more homogeneous and differentiated population of
cells making up primary CK cell culture. The fact that
subsequent passage of cloned CK cell-grown virus in
eggs results in the expansion of a viral population with
sequence changes in the HA is not unexpected and also
occurs when mammalian cell-grown viruses are passaged
in eggs, as seen in earlier antigenic analyses (Katz et aL,
1987) and sequence analyses (Robertson et al., 1987) of
MDCK cell-grown viruses passaged further in eggs.
For both A/Mem/14/85 and A/Mem/6/86 viruses, the
predominant virus after one passage of CK cell-grown
virus in eggs was antigenically similar to the virus grown
in mammalian cells. The frequency of isolation of this
antigenically non-variant virus in eggs was similar
whether the virus had been isolated from the original
patient sample either in primary CK cells (71 ~ as shown
in this study), or by limiting dilution of the original
sample inoculated directly into eggs (74~o; Wang et al.,
1989). This suggests that isolation of virus from a low
dilution of the original clinical material in either a
mammalian cell type or primary CK cells prior to their
adaptation in eggs may result in the predominance of an
egg-grown virus which is at least antigenically identical if
not structurally identical to the mammalian cell-grown
virus and the virus present in the infected individual. In
contrast, passage of the original clinical material at low
dilution in eggs often results in the predominance of a
faster growing minor antigenic variant.
The A / M e m / 1 4 / 8 5 CK-egg-grown virus possessed the
same substitution in HAl (248 Thr~Ile) observed in the
most frequently isolated egg-grown variant from this
patient (Wang et al., 1989; Katz et al., 1990) and resulted
in the loss of a potential glycosylation site at HA1
residues 246 to 248. Although residue 248 has not been
implicated directly in receptor binding, it is possible that
the loss of a carbohydrate moiety at this site may enhance
the binding of HA to sialic acid-bearing receptors.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 20:35:15
H 3 N 2 influenza grown in different host cells
Similarly, after one passage in eggs, the HA of CK cellgrown A/Mem/6/86 virus was antigenically identical to
the MDCK cell-grown virus. However, this egg-paRRaged virus was also identical in amino acid sequence to
its CK cell-grown and MDCK cell-grown counterparts.
Of the clones isolated from the original sample and
analysed in detail, only clone 11.1E represented this
antigenic and structural phenotype. However, upon a
second passage in eggs, the predominant virus acquired
an amino acid substitution at residue 138 in HA1. This
substitution did not lead to any antigenic alterations, as
could be detected by our panel of MAbs, but did result in
a higher titre of virus which was presumably better suited
to growth in eggs. The substitution of Ala~Thr at
position 138 has been previously observed in two 1985
H3N2 egg-grown variants (Wang et al., 1989). Residue
138 is generally conserved in human H3 HAs as it forms,
together with residues 134 to 137, the right side of the
receptor-binding pocket (WeiRet al., 1988). In contrast to
the selection of egg-grown viruses with a single amino
acid substitution in HA, Rajakumar et al. (1990) have
reported that limited passage in eggs of a type A (H 1N 1)
virus resulted in a high titred virus which retained its
sequence identity in HA 1 with that of the virus present in
the original clinical sample.
Based on these studies, the use of mammalian
epithelial-like cells or primary CK cell culture in the
primary isolation of human type A H3N2 viruses is
essential in order to isolate unaltered the predominant
virus species from the original clinical samples. Nevertheless, the effect of subsequent passage in eggs of the
HA of these viruses needs to be monitored at all times
since it has been shown that even a single amino acid
substitution in egg-grown antigenic variants can substantially reduce the protective efficacy of the virus when
used as an inactivated influenza vaccine (Katz &
Webster, 1989; Wood et al., 1989).
We thank Sarah Young for technical assistance and Dayna
Anderson for secretarial help. This work was supported by Public
Health Service Grant AI-20591 from the National Institute of Allergy
and Infectious Diseases, Cancer Center Support (CORE) Grant CA21765-10, and American Lebanese Syrian Associated Charities.
References
Cox, N. J., MAASSAB,H. F. & KENDAL, A. P. (1979). Comparative
studies of wild-type and cold-mutant (temperature-sensitive) influenza viruses: nonrandom reassortment of genes during preparation
of live virus vaccine candidates by recombination at 25 °C between
recent H3N2 and H1N 1 epidemic strains and cold-adapted A/Ann
Arbor/6/60. Virology 97, 190-194.
FRANK, A. L., COUCH,R. B., GmvvIs, C. A. & BAXTER,B. D. (1979).
Comparison of different tissue cultures for isolation and quantitation
of influenza and parainfluenza viruses. Journal of Clinical Microbiology 10, 32-36.
KATZ, J. M. & WEBSTER, R. G. (1988). Antigenic and structural
characterization of multiple subpopulations of H3N2 influenza virus
from an individual. Virology 165, 446-456.
1165
KATZ, J. M. & WEBSTER, R. G. (1989). Efficacy of inactivated
influenza A virus (H3N2) vaccines grown in mammalian cells or
embryonated eggs. Journal of Infectious Diseases 160, 191-198.
KATZ, J. M., NAEVE, C. W. & WEBSTER, R. G. (1987). Host cellmediated variation in H3N2 influenza viruses. Virology 156, 386395.
KATZ, J. M., WANG, M. & WEBSTER,R. G. (1990). Direct sequencing
of the HA gene of influenza (H3N2) virus in original clinical samples
reveal sequence identity with mammalian ceU-grown virus. Journal
of Virology 64, 1808-1811.
KIDA, H., BROWN,L. E. & WEBSTER,R. G. (1982). Biological activity
of monoclonal antibodies to operationally defined antigenic regions
on the hemagglutinin molecule of A/seal/Massachusetts[l[80
(H7N7) influenza virus. Virology 122, 38-47.
LATHEY,J. L., VANVORIS,L. P. & BELSHE,R. B. (1986). Superiority of
tissue-culture-grown antigens over egg-grown antigens for serologic
diagnosis of influenza B virus infections. Journal of Medical Virology
19, 155-159.
Mm~SSAB, H. F. (1967). Adaptation and growth characteristics of
influenza virus at 25 °C. Nature, London 213, 612-614.
MAASSAB,H. F., DEBORDE, D. C., DONABEDIAN,A. M. & SMITKA,
C. W. (1985). Development of cold-adapted "master" strains for type
B influenza virus vaccines. In Vaccines '85, pp. 327-332. Edited by
R. A. Lerner, R. M. Chanock & F. Brown. New York: Cold Spring
Harbor Laboratory.
MURPHY, B. R. & CLEMENTS,M. L. (1989). The systemic and mucosal
immune response of humans to influenza A virus. Current Topics in
Microbiology and Immunology 146, 107-116.
OXFORD,J. S., ABBO,H., CORCORAN,T., WEBSTER,R. G., SMITH,A. J.,
GRILLI, E. A. & SCmLD, G. C. (1983). Antigenic and biochemical
analysis of field isolates of influenza B virus: evidence for intra- and
inter-epidemic variation. Journal of General Virology 64, 2367-2377.
RAJAKUMAR,A., SWIERKOSZ,E. M. & SCHULZE,I. T. (1990). Sequence
of an influenza virus hemagglutinin determined directly from a
clinical sample. Proceedings of the National Academy of Sciences,
U.S.A. 87, 4154-4158.
ROBERTSON, J. S., BOOTMAN, J. S., NEWMAN, R., OXFORD, J. S.,
DANIELS,R. S., WEBSTER,R. G. & SCHILD,G. C. (1987). Structural
changes in the hemagglutinin which accompany egg adaptation of an
influenza A (H1N1) virus. Virology 160, 31-37.
ROBERTSON, J. S., BOOTMAN, J. S., NICOLSON, C., MAJOR, D.,
ROeERTSON, E. W. & WOOD, J. M. (1990). The hemagglutinin of
influenza B virus present in clinical material is a single species
identical to that of mammalian cell-grown virus. Virology 179, 35-40.
ROBERTSON, J. S., NICOLSON, C., BOOTMAN, J. S., MAJOR, D.,
ROBERTSON,E. W. & WOOD, J. M. (1991). Sequence analysis of the
haemagglutinin (HA) of influenza A (H1N1) viruses present in
clinical material and comparison with the HA of laboratory-derived
virus. Journal of General Virology 72, 2671-2677.
SAIKI, R. K., GELFAND,D. H., STOFFEL,S., SCHARF,S. J., HIGUCHI,R.,
HORN, G. T., MULLIS,K. B. & ERLICH,H. A. (1988). Primer-directed
enzymatic amplification of DNA with a thermostable DNA
polymerase. Science 239, 487-491.
SANGER,F., NICKLEN,S. & COULSON,A. R. (1977). DNA sequencing
with chain-terminating inhibitors. Proceedings of the National
Academy of Sciences, U.S.A. 74, 5463-5467.
WANG, M., KATZ, J. M. & WEBSTER, R. G. (1989). Extensive
heterogeneity in the hemagglutinin of egg-grown influenza viruses
from different patients. Virology 171, 275-279.
WEIS, W., BROWN, J. H., CUSACK,S., PAULSON,J. C., SKEHEL,J. J. &
WILEY, D. C. (1988). Structure of the influenza virus haemagglutinin
complexed with its receptor, sialic acid. Nature, London 333, 426431.
WOOD, J. M., OXFORD,J. S., DUNLEAVY,U., NEWMAN,R. W., MAJOR,
D. & ROBERTSON,J. S. (1989). Influenza A (H1N1) vaccine efficacy
in animal models is influenced by two amino acid substitutions in the
hemagglutinin molecule. Virology 171, 214-221.
WRIGHT, P. F., OKABE, N., MCKEE, K. T., JR, MAASSAB,H. F. &
KARZON, D. T. (1982). Cold-adapted recombinant influenza A virus
vaccines in seronegative young children. Journal of Infectious
Diseases 146, 71-79.
(Received 18 November 1991; Accepted 16 January 1992)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 06 May 2017 20:35:15