Download Studies on host-virus interaction for viral hemorrhagic septicemia

The University of Toledo
The University of Toledo Digital Repository
Theses and Dissertations
2012
Studies on host-virus interaction for viral
hemorrhagic septicemia virus (VHSv)
Adam J. Pore
The University of Toledo
Follow this and additional works at: http://utdr.utoledo.edu/theses-dissertations
Recommended Citation
Pore, Adam J., "Studies on host-virus interaction for viral hemorrhagic septicemia virus (VHSv)" (2012). Theses and Dissertations.
Paper 404.
This Thesis is brought to you for free and open access by The University of Toledo Digital Repository. It has been accepted for inclusion in Theses and
Dissertations by an authorized administrator of The University of Toledo Digital Repository. For more information, please see the repository's About
page.
A Thesis
entitled
Studies on Host-Virus interaction for Viral Hemorrhagic Septicemia Virus (VHSv)
by
Adam J. Pore
Submitted to the Graduate Faculty as partial fulfillment of the requirements for the
Master of Science Degree in Cellular and Molecular Biology
________________________________________
Dr. Douglas Leaman, Committee Chair
________________________________________
Dr. Patricia Komuniecki, Dean
College of Graduate Studies
The University of Toledo
August 2012
An Abstract of
Studies on Host-Virus Interaction for Viral Hemorrhagic Septicemia Virus
by
Adam J. Pore
Submitted to the Graduate Faculty in partial fulfillment of the requirements for the
Master of Science Degree in Cellular and Molecular Biology
The University of Toledo
August 2012
Viral hemorrhagic septicemia virus (VHSv), a member of the family Rhabdoviridae, is a
highly contagious fish virus responsible for large-scale fish die-offs worldwide. A new
strain of VHSv, designated IVb, has recently spread to the Great Lakes threatening the
tourism, sports fishing and fishery industries of the region. Research on virus-host
interactions in VHSv infected fish has been mostly limited to population and ecological
based studies while the molecular basis of the disease remains widely uncharacterized.
To study virus-host interactions on a molecular level, we cloned four of the six VHSv
genes including the matrix (m), nucleocaspid (n), non-virion (nv), and phosphoprotein (p)
genes. Of primary interest, the M protein encoded by VHSv seems to share similar
characteristics with the matrix protein of a related rhabdovirus. Comparable to the wellstudied rhabdovirus vesicular stomatitis virus (VSV) M protein, ectopically expressed
VHSv M inhibits promoter activity of both an interferon stimulated response element
containing promoter and a constitutively active simian vacuolating virus 40 (SV40)
promoter in Epithelioma Papulosum Cyprini (EPC) cells. Interestingly, real-time PCR
iii
data suggest mRNA levels remain steady, while protein levels decrease. Together, these
data may suggest a similar interaction found in VSV between the M protein and the
RAE1-NUP98 complex preventing nuclear export of mRNA. Furthermore, as seen in
related rhabdoviruses, we have cell rounding after ectopic expression of the M protein for
greater than 48h. Annexin V staining suggests these morphological changes in the cells
are due to the induction of apoptosis. Together, these observations suggest two novel
functions for the VHSv M protein.
Future work will focus on determining the
mechanisms utilized by VHSvM to inhibit transcription and induce apoptosis.
Additionally, we identified the VHSv phosphoprotein as an inhibitor of both IFN
gene activation and IFN-mediated activation of ISGs.
The well-studied rabies
rhabdovirus phosphoprotein inhibits phosphorylation of IRF3 to prevent transcription of
IFN genes and also binds the ISGF3 transcription factor to prevent upregulation of ISGs.
Our results suggest the VHSv P protein may utilize similar mechanisms to block antiviral responses.
Together, we present here two proteins expressed by VHSv that inhibit innate
immune responses in EPC cells.
These data could help with the development of
appropriate therapeutic interventions.
iv
This thesis is dedicated to my loving parents and supportive friends.
"Walking with a friend in the dark is better than walking alone in the light."
--Helen Keller
v
Acknowledgements
First and foremost, I’d like to recognize and thank my advisor, Dr. Douglas
Leaman.
His guidance, support, patience and knowledge were paramount to my
education and the completion of my thesis project.
His advice taught me to think
constructively and critically, thereby allowing me to formulate appropriate experiments
and ideas for the success of my project. I would also like to thank Robert Rominski. As
an undergrad in our lab his assistance in my project was more than I could have asked
for. Likewise, I’d also like to thank Tyler Williams for his help with this project and for
his continued work on unanswered topics. Furthermore, I am more than appreciative of
all the support given to me by the other members of the Leaman lab. In particular, I
acknowledge Kuldeep Sudini, who frequently helped me organize ideas and generate new
ones. He is a fountain of knowledge that helped me learn many things.
I would also like to thank the department of Biological Sciences who provided me
with a firm foundation of scientific knowledge. The faculty is beyond amazing. I
specifically would like to thank my committee members, Dr. Brian Ahsburner, Dr.
Malathi Krishnamurthy and Dr. Carol Stepien, all of whom have given me great ideas
throughout my project. Lastly, but most certainly not least, I’d like to thank my parents
vi
and friends who have supported me more than they will ever know. Without them, none
of this would have been possible.
vii
Contents
Abstract ............................................................................................................................. iii
Aknowledgements ............................................................................................................ vi
Contents .......................................................................................................................... viii
List of Figures ................................................................................................................... xi
List of Tables ................................................................................................................... xii
List of Abbreviations ..................................................................................................... xiii
1. Introduction ................................................................................................................... 1
1.1 General Introduction ............................................................................................... 1
1.2 Viral Hemorrhagic Septicemia ............................................................................... 2
1.2.1 VHS Etiology and History ............................................................................ 2
1.3 Viral Hemorrhagic Septicemia virus ...................................................................... 3
1.3.1 Nomenclature and Classification .................................................................. 3
1.3.2 VHSv Structure and Replication ................................................................... 6
1.4 Host Innate Immune System ................................................................................. 11
1.4.1 Innate Immune Response to Viral Infection ............................................... 11
1.5 Viral Evasion of the Innate Immune System ........................................................ 16
1.5.1 Viral Mechanisms to Evade the Innate Immune System ........................... 16
viii
1.5.2 VHSv Evasion of Fish Innate Immune Response ...................................... 17
2. Materials and Methods ............................................................................................... 18
2.1 Cell lines and culture conditions ........................................................................... 18
2.2 Plasmids ................................................................................................................ 18
2.3 VHSv stocks and infection.................................................................................... 19
2.4 Cloning and PCR .................................................................................................. 19
2.5 Transfection .......................................................................................................... 23
2.6 Confocal Microscopy and Immunofluorescence .................................................. 23
2.7 Subcellular Fractionation ...................................................................................... 24
2.8 Luciferase assays/β-gal assays .............................................................................. 24
2.9 Immunoblotting..................................................................................................... 25
2.10 Annexin V staining ............................................................................................. 26
2.11 Real-time PCR .................................................................................................... 28
2.12 Viral Protection/IFN-production assays ............................................................. 28
3. Results .......................................................................................................................... 29
3.1 VHSv inhibits the innate immune response .......................................................... 29
3.1.1 VHSv inhibits IFN activity ........................................................................ 29
3.1.2 VHSv products modulate the innate immune response ............................. 33
3.2 The VHSv Matrix Protein ..................................................................................... 37
3.2.1 VHSv Matrix protein induce apoptosis...................................................... 37
ix
3.2.2 M localizes to the nuclear membrane and cytoplasm ................................ 40
3.2.3 M inhibits the production of function proteins .......................................... 43
3.3 The VHSv Phosphoprotein ................................................................................... 47
3.3.1 VHSv P inhibits IFN signaling .................................................................. 47
4. Discussion..................................................................................................................... 51
4.1 The VHSv Matrix Protein ..................................................................................... 52
4.2 The VHSv Phosphoprotein ................................................................................... 56
4.3 Future Goals and Experiments .............................................................................. 59
4.3.1 Other VHSv proteins.................................................................................. 59
4.3.2 Comparison of VHSv and related rhabdovirus strains .............................. 59
4.3.3 Recombinant viruses .................................................................................. 60
4.4 Overall summary ....................................................................................................60
References ........................................................................................................................ 62
x
List of Figures
1. Distribution of VHSv strains in the northern hemisphere .............................................5
2. Genome and virion structure for VHSv ........................................................................8
3. Rhabdovirus replication cycle .......................................................................................9
4. Type I IFN response to viral pathogens ......................................................................14
5. VHSv inhibits IFN activity .........................................................................................31
6. VHSv gene products modulate IFN reponses .............................................................35
7. VHSvM induces apoptosis ..........................................................................................38
8. VHSvM localized to the nucleus and cytoplasm ........................................................41
9. VHSvM inhibits steps following transcription ...........................................................45
10. VHSvP inhibits IFN signaling ....................................................................................49
11. VSV M inhibits nuclear export of mRNA ..................................................................55
12. RV P prevents both IFN activation and ISG activation ..............................................58
xi
List of Tables
1. Cloning primers .............................................................................................................21
2. Expression primers ........................................................................................................22
xii
List of Abbreviations
ATCC ............................................................................. American Type Culture Collection
CARD ........................................................... Caspase Activation and Recruitment Domain
CPE ............................................................................................................. cytopathic effect
DAPI ..................................................................................... 4',6-diamidino-2-phenylindole
dNTP ................................................................................ deoxyribonucleotide triphosphate
dsRNA............................................................................... double stranded ribonucleic acid
DTT ................................................................................................................... dithiothreitol
EDTA .................................................................................. ethylenediaminetetraacetic acid
EPC .................................................................................... Epithelioma Papulosum Cyprini
FBS ..........................................................................................................fetal bovine syrum
g................................................................................................................. glycoprotein gene
G............................................................................................................ glycoprotein protein
h.....................................................................................................................................hours
HCV ........................................................................................................... Hepatitis C virus
IFN ......................................................................................................................... interferon
IHNV..................................................................... Infectious Hematopoietic Necrosis virus
IRF ............................................................................................. interferon regulatory factor
ISG ...............................................................................................interferon stimulated gene
ISGF3 ............................................................................. interferon-stimulated gene factor 3
JAK ................................................................................................................Janus Kinase 1
l .................................................................................................................. Polymerase gene
L ..............................................................................................................Polymerase protein
m......................................................................................................................... Matrix gene
M .................................................................................................................... Matrix protein
MAVs ................................................................................ mitochondrial antiviral signaling
xiii
MDA5 ............................................................. Melanoma differentiation-associated gene-5
MEM ......................................................................................... minimum essential medium
min ......................................................................................................................... minute(s)
n.............................................................................................................. Nucleoprotein gene
N......................................................................................................... Nucleoprotein protein
nv ................................................................................................................. Non-virion gene
NV ........................................................................................................... Non-virion protein
OIE ..............................................................World Organization for Animal Health (trans.)
p............................................................................................................ Phosphoprotein gene
P ................................................................................................................... Phosphoprotein
PAMP....................................................................... pathogen associated molecular pattern
PBS .............................................................................................. Phosphate buffered saline
PCR ..............................................................................................polymerase chain reaction
PPD ................................................................................................... paraphenylenediamine
PRR ........................................................................................... pattern recognition receptor
RIG-I ...................................................................................... retinoic acid inducible gene 1
RLH......................................................................................................... RIG-I-like helicase
RV ..................................................................................................................... Rabies Virus
SDS-PAGE ............................. sodium dodecyl sulfate polyacrylamide gel electrophoresis
SHRV .............................................................................................. Snakehead Rhabdovirus
ssRNA ................................................................................ single-stranded ribonucleic acid
STATs ...................................................... signal transducers and activators of transcription
TBST ...................................................................................... tris-buffered saline Tween-20
TEMED ..................................................................................... tetramethylethylenediamine
Tyk2 ......................................................................................................... Tyrosine Kinase 2
VHS...................................................................................... Viral Hemorrhagic Septicemia
VHSv........................................................................... Viral Hemorrhagic Septicemia virus
VSV.............................................................................................. Vesicular Stomatitis virus
xiv
Chapter 1
Introduction
1.1 General introduction
As the global human population continues to grow exponentially, demand for
food has become a significant societal problem. Demand for seafood is increasingly
being met through expansion in the number of aquaculture facilities and fisheries
worldwide. However, with the increase of these facilities and global trading of fish there
is also an increased risk of introducing aquatic pathogens to new regions, thereby posing
a serious threat to an important food source (Peeler & Taylor, 2011). One such pathogen,
Viral Hemorrhagic Septicemia virus (VHSv), has rapidly spread throughout the northern
hemisphere in the last 50 years (Bain et al., 2010; Jonstrup et al., 2009). In an attempt to
limit the spread of VHSv it has been listed as a reportable disease by the World
Organization for Animal Health (OIE). VHSv has now been identified in the Great
Lakes where it is an emerging threat to the region (VHSv Expert Panel, 2010).
1
1.2 Viral Hemorrhagic Septicemia
1.2.1 VHS etiology and history
Viral hemorrhagic septicemia (VHS), also known as Egtved disease, was initially
identified in rainbow trout (Salmo gairdnerri) in 1938 (Schäperclaus, 1938), re-emerging
in Denmark in the early 1950s (Jensen, 1965; Schäperclaus, 1938).
From that point,
VHS spread rapidly throughout European fisheries, resulting in significant losses to
regional industries (Smail, 1999; Wolf, 1988). The disease initially is characterized by its
visible symptoms including: lack of appetite, abnormal behavior, hemorrhaging of gills
and internal organs, discoloration, and disassociation from other fish (Rasmussen, 1965).
Subsequent research on fish afflicted with VHS concluded that symptoms and
susceptibility to the disease were significantly dependent on the species and
environmental temperatures (Hawley & Garver, 2008; R. Kim & Faisal, 2010). The
species most severely impacted in Europe were within the family Salmonidae (Ghittino,
1965; Jorgensen, 1982). However, over 70 species have been identified with VHSv
infection, representing both salmonoid and non-salmonoid species (Brudeseth &
Evensen, 2002; Jonstrup et al., 2009; W. Kim et al., 2009; T. R. Meyers, Short, & Lipson,
1999; Skall, Olesen, & Mellergaard, 2005). The disease is most prevalent during the fall
and spring spawning season when water temperatures range from 9-12°C (Winton &
Einer-Jensen, 2002).
Inoculation of healthy naïve fish with bacteria- and fungus-free filtrate from
diseased fish resulted in transfer of the disease, strongly implicating viral pathogenesis
for VHS (Jensen, 1965; Schäperclaus, 1938). Transmission of the virus between fish
occurs mainly via contact with mucus excretions, urine and semen from infected fish.
2
Therefore, proximity of fish increases transmission rate of the disease, contributing to its
spread during spawning seasons and increasing its risk in aquaculture where fish are
typically grown in a large population to tank size ratio (Winton & Einer-Jensen, 2002).
Once infected, some fish remain asymptomatic for the disease but are carriers of the
virus, making it difficult to track and/or control VHSv distribution in the wild
(Hershberger et al., 2010; R. K. Kim & Faisal, 2010).
1.3 Viral hemorrhagic septicemia virus
1.3.1 Nomenclature and classification
VHSv was first isolated in 1962 from infected rainbow trout raised in a fishery in
Denmark (Einer-Jensen, 2004).
Despite its rapid spread across Europe, it was not
identified on other continents until 1988 when it was isolated from Atlantic salmon on the
west coast of the United States (Brunson, True, & Yancey, 1989; Hopper, 1989). Since
then, VHSv has been found throughout the Northern Hemisphere, including the Great
Lakes region (Elsayed et al., 2006; Studer & Janies, 2011). Geographic location and
genomic sequence similarities have been utilized to classify VHSv into four primary
strains, I-IV (Fig. 1). Subsequent genetic differences found among new isolates of these
strains have been used to classify variants into individual substrains (signified by lower
case letters following the strain number). Strains I-III are endemic to Europe with type I
being the most diverse, infecting both marine and freshwater fishes (Benmansour et al.,
1997; Thiéry et al., 2002). With the exception of KRRV-9602 (type Ib) that was isolated
3
in Japan, the European strains have not been identified elsewhere (Nishizawa et al.,
2002). The type IV strain is separated into two substrains. Type IVa was isolated in
Japan and the western coast of the United States (T. Meyers & Winton, 1995; Nishizawa
et al., 2002). The most recent emergence of VHSv is the IVb substrain, identified in the
Great Lakes region in 2003 (Ammayappan & Vakharia, 2009; R. Kim & Faisal, 2010).
This new substrain is highly virulent and has become endemic to the region, posing a
significant risk to the sports fishing and aquaculture industries (Bain et al., 2010).
4
Figure 1: Distribution of VHSv strains in the Northern Hemisphere.
Circles
represent general areas where infections have been found for the individual strains. VHSv
genotypes I, II, and III are found primarily in Europe although strain III was found in
Japan.
Type IVa is found in Japan and northwestern North America. Type IVb is
endemic to the Great Lakes region in North America.
5
1.3.2 VHSv structure and replication
Viral genome sequence information and electron microscopy led to classification
of VHSv as a member of the Rhabdoviridae family of negative sense, single-stranded
RNA viruses. Consistent with other rhabdoviruses, the VHSv genome encodes for five
structural proteins including the nucleoprotein (N), phosphoprotein (P), matrix (M)
protein, glycoprotein (G), and polymerase (L) protein (Fig. 2) (McAllister & Wagner,
1975; Tze, Mundt, & Mettenleiter, 1999). The virus also encodes for a non-virion (NV)
protein identified only in fish rhabdoviruses, thereby further classifying VHSv to the
genus Novirhabdovirus (Schütze et al., 1996).
While VHSv replication is poorly characterized, it is likely similar to other
rhabdoviruses. For these viruses to propagate, they must first gain access to host cellular
machinery by entering a cell (Cureton et al., 2009). The glycoprotein binds to a surface
receptor (potentially phosphotidyl serine) allowing viral endocytosis into the cell
(Plemper, 2011). Cellular lysosomes fuse with the endosome thereby reducing the pH
within the vesicle and triggering fusion between the glycoprotein and the vesicle
membrane resulting in the release of the core nucleocaspid into the cytoplasm (Colman &
Lawrence, 2003).
Once the N protein disassociates from the negative sense genomic RNA, positive
sense mRNA transcripts can be encoded by a viral RNA-directed RNA polymerase
encoded by the L gene (Howard, 1989). The L protein, upon activation by the P protein
and host factors, binds to the leader segment of the virus and begins transcription. Due to
polymerase slippage following the polyadenylation signal and the inter segment regions
6
between coding regions on the viral genome, the polymerase is sometimes unable to
proceed from one gene to the next (Ivanov et al., 2011). This results in a gradient in
which 3’ most genes are transcribed at a higher copy number than those at the 5’ end.
This gradient has a significant effect on the budding of new viral virions (Assenberg et
al., 2010). Later in the replication cycle, the L protein switches from mRNA synthesis to
replicating full length positive sense copies of the viral genome from which new negative
stranded genomes are synthesized.
Once a sufficient quantity of the N protein is
processed to coat the viral genome, further transcription is halted (Ivanov et al., 2011).
Thus, the virus creates a feedback loop to regulate the amount of virions produced versus
the amount of transcription (Fig. 3).
The glycoprotein (G protein) is produced in the endoplasmic reticulum and
packaged as transmembrane proteins in vesicles for transport to the cell surface. Once
these vesicles fuse to the cell surface, the M protein interacts with the inner portion of the
G protein (Colman & Lawrence, 2003). This provides the initial scaffolding for the viral
budding. As N protein associates with the viral RNA it also binds to M creating a
zippering effect. This forms a bullet shaped virion with a ribonuclear core (H R Jayakar,
Jeetendra, & Whitt, 2004).
Lastly, host cellular factors recruited by M during the
budding process are thought to mediate viral release from the cellular membrane (Fig. 3)
(H R Jayakar, Murti, & Whitt, 2000).
7
Figure 2: Genome and virion structure for VHSv.
VHSv is a bullet shaped
rhabdovirus containing a negative sense single stranded RNA genome that encodes for 6
transcripts. G (green) is a transmembrane protein that forms “spike-like” projections on
the viral surface allowing it to interact with cell receptors and fuse with cell membranes
as well as interacting with the internal M protein (yellow). The N protein (red) interacts
with the M protein and the RNA. This provides a helix-like packing for the viral RNA
and helps to form the shape of the structure. Furthermore, the L protein (cyan) and P
protein (blue) are associated with the N protein in the middle of the core. The NV protein
(orange) is not present in the viral structure.
8
Figure 3: Rhabdovirus Replication Cycle: Once gaining entry to the cell (step 1) the
virus requires host mechanics to replicate. The virus interacts with cell surface receptors
and is endocytosed into the cell (step 2). Lysososomes fuse to the endosome carrying the
virus, initiating acidification of the vesicle (step 3). This triggers a conformational
change in the viral glycoprotein allowing it to fuse with the membrane and escape into
the cytoplasm (step 4). The negative sense single stranded RNA genome is transcribed
directly into mRNA, however due to slippage during polyadenylation, the polymerase
protein sometimes falls off and has to re-initiate leading to a gradient where 5’ mRNA is
expressed greater than 3’ (steps 5 and 6). The viral mRNA is translated using host
machinery (step 7).
When enough nucleoprotein is translated, it binds to the viral
9
genome causing the polymerase protein to switch from transcription to replication (steps
8a and 9a). The glycoprotein is shuttled to the cell surface in cellular endosome (step 8b)
and the matrix protein interacts with its inner half (step 9b).
The viral genome is
organized into a coil by the interaction between the matrix protein and the nucleoprotein
(step 10). Lastly, the virus is released from the cell into the extracellular space.
10
1.4 Host innate immune system
1.4.1 Innate immune response to viral infection
To combat viral infections eukaryotes have evolved complex innate immune
response networks. Integral to detecting viral infections are pattern recognition receptors
(PRRs) that include the cytoplasmic viral detection receptors retinoic acid inducible gene
I (RIG-I) and melanoma differentiation-associated gene-5 (MDA5), commonly referred
to together as “RIG-I-like helicases (RLHs)” (Kato et al., 2006). RLHs contain helicase
domains that are capable of “sensing” viral pathogen-associated molecular patterns
(PAMPs), particularly dsRNA and uncapped ssRNA.
The interaction causes a
conformational change in the RLH exposing a Caspase Activation and Recruitment
Domain (CARD) allowing it to signal to the downstream adaptor protein, Mitochondrial
AntiViral-Signaling (MAVS) protein (also known as VISA/IPS-1/Cardiff) (Loo & Gale,
2011).
The cascade activates transcription factors including Interferon-Regulatory
Factors (IRFs) resulting in transcriptional activation of responsive genes, type I IFNs in
particular (Fig. 2) (Marié, Durbin, & Levy, 1998; Taniguchi et al., 2001). This “first
phase” of the innate immune response occurs primarily in infected cells, and many of the
above signaling components have been identified in, and/or cloned, in fish as well as
humans, mice and other organisms. For example, a putative precursor to the RLH genes
has been cloned from Japanese flounder and a MAVS/IPS-1ortholog has been cloned
from several fish species (Chang et al., 2011; Simora et al., 2010). Over expression of
these proteins in cultured cells results in a decreased viral titer following infection,
11
suggesting that the antiviral roles they play in mammals originated in earlier vertebrates,
such as fishes (Biacchesi et al., 2009; Stein et al., 2007).
As mentioned, up-regulation of cytokines, IFNs in particular, is a critical aspect of
the cellular innate immune signaling pathways. In mammals three distinct families of
IFN have been identified, designated type I (IFN-α, -β, -ω, -τ, -δ, -ε etc), II (IFNγ) and III
(IFNλ) IFNs (Borden et al., 2007). Type I and III IFNs have similar antiviral functions in
humans and mice but have differing gene structures; type I IFNs are encoded from
intronless genes, while IFNλ has introns (Fox, Sheppard, & O’Hara, 2009; Krause &
Pestka, 2005). Interestingly, the two putative primordial type I IFNs that have been
identified in fishes exhibit intron/exon structures most similar to IFNλ, but share higher
overall coding sequence similarity with type I IFNs (Zou et al., 2007). True IFNλ
orthologs have not been identified in fish, suggesting that these IFNs may have later
evolved in mammals (Fox et al., 2009; Robertsen, 2006).
Once type I IFNs are
transcribed and translated, their protein products are processed and secreted from the cell
into the surrounding tissues and to circulation. IFNs bind to high affinity cell surface
receptors on neighboring or distal cells and activate JAK1 and TYK2 tyrosine kinases
leading to the phosphorylation of STAT1 and STAT2. STAT1 and STAT2 dimerize and
then complex with IRF9 to form the multimeric transcription factor complex IFNstimulated gene factor 3 (ISGF3).
After translocation to the nucleus, ISGF3
transcriptionally upregulates hundreds of IFN-stimulated genes (ISGs) (Li et al., 1998).
The protein products of these genes work in concert to induce physiological changes that
lead to an antiviral state for the cell (Horvath & Darnell, 1996). As with the components
of the virus detection pathway, components of the “second phase” of the innate immune
12
response (Fig. 2), including IFN receptors, JAKs, STATs, IRFs and many ISGs have
been observed and cloned from multiple fish species (Hegedus et al., 2009; Sun et al.,
2010; Yu et al., 2010). One well characterized ISG, the mx1 gene, has been identified in
fish and is potently upregulated in response to virus (Tafalla et al., 2008).
Taken
together, the presence and activity of the main components of the innate immune antiviral
response pathways suggest it has been conserved throughout vertebrate evolution and is
functional in fish.
13
“Phase 1”
“Phase 2”
Figure 4: Type I IFN response to viral pathogens. Viral transcripts in the cytoplasm
following viral endocytosis can be recognized by Rig-I like receptor (RLR) helicase
domains. Binding of viral RNA products cause the receptors to unfold and expose a
Caspase Activation and Recruitment domain (CARD). This allows the RLRs to interact
with MAVS which in turn activates a signaling cascade leading to the phosphorylation of
IRF3. Phosphorylated IRF3 dimerizes and translocates to the nucleus where it binds to
the promoter of interferon genes and activates their transcription.
Once IFNs are
processed they are secreted from the cell and can subsequently bind to near or more distal
cells via the type I IFN receptor (IFNAR). Activation of the IFN receptor complex leads
to autophosphorylation of JAK1 and TYK2 followed by their phosphorylation of STAT1
14
and STAT2. Phosphorylated STAT1 and STAT2 dimerize and then complex with IRF9
to form a complex known as ISGF3. This transcription factor complex is capable of
activating hundreds of genes that mediate establishment of an antiviral state.
15
1.5 Viral evasion of the innate immune system
1.5.1 Viral mechanisms to evade the innate immune system
For viruses to survive and propagate they must somehow mitigate or evade the
host innate immune response (Rieder, 2009). In some cases they have simply evolved
mechanisms to replicate rapidly enough to outpace the innate response, or to mask their
PAMPs to avoid detection (Liu & Gale, 2010; Warfield et al., 2004). However, most
have developed means of perturbing signaling within either the PAMP detection (PRR)
signaling cascades, or the IFN response pathways (Bowie & Unterholzner, 2008). In
particular, latent viruses such as Hepatitis C virus (HCV) inhibit multiple steps in the
RIG-I signaling pathway in order to prevent IFN production that would otherwise help to
clear the infection. However, HCV also blocks IFN signaling by sequestering STATs and
upregulating phosphatases and other proteins (SOCS) that suppress or prevent STAT
activation (Breiman et al., 2005). Mechanisms such as these are common among most
viruses studied, including Rhabdoviruses (Rieder, 2009). For example, Rabies Virus
(RV) P protein has been proposed to hinder both IFN production and ISG activation. RV
P prevents IRF3 phosphorylation, thus preventing IRF3 dimerization and translocation to
the nucleus. While this inhibits type I IFN transcription, it is insufficient to completely
block production of IFN (Brzozka, Finke, & Conzelmann, 2006). Therefore, RV P also
inhibits JAK-STAT mediated signaling following IFN receptor interaction by binding to
phospho-STAT1 and preventing the ISGF3 complex from entering the nucleus and
activating ISGs (Brzozka, Finke, & Conzelmann, 2006). Another Rhabdovirus, vesicular
stomatitis virus (VSV), relies instead on the actions of its matrix (M) protein, which shuts
down host cell gene expression and induces cellular apoptosis (Kopecky & Lyles, 2003;
16
Waibler et al., 2007). Although the mechanism is not yet completely elucidated, VSV M
has been implicated in inhibiting nuclear export of mRNA's by interacting with the
nucleoprotein nup98 and the export factor Rae1.
This process efficiently stops
production of either IFNs or ISGs, but does so at a cost - the VSV M protein also initiates
apoptosis in infected cells (Faria et al., 2005). Thus, unlike HCV or RV that remain
present in the infected host for extended periods of time, VSV must replicate quickly to
circumvent the apoptotic cell death initiated upon its infection.
1.5.2: VHSv evasion of fish innate immune response
The continued propagation, virulence, and lethality of VHSv suggest that it has
developed at least one mechanism to evade the innate immune response in fishes. We
hope to elucidate the mechanisms and proteins responsible for dodging these vital
pathways.
Furthermore, in these investigations we would like to gain a better
understanding of how the fish innate immune system works and how it is similar to those
previously studied in mammals.
17
Chapter 2
Materials and Methods:
2.1 Cell lines and culture conditions
Epithelionma papulosum cyprini (EPC) cells were purchased from the American
Type Culture Collection (ATCC) (Rockville, MD). The cells were grown in minimum
essential medium (MEM) (Fisher) supplemented with 10% fetal bovine serum (FBS) and
1% penicillin/streptomycin at 22º C in a 5% CO2 enriched environment. Typically, cells
were passaged 1:3 using trypsin-EDTA to disperse cells from culture plates. Cells were
regularly checked for mycloplasma infection by staining with DAPI (Fisher) and
observing under the epi-fluorescent microscope (Olympus IX81) at 40x.
2.2 Plasmids
The expression vectors for EPC MAVs and EPC IFN were kindly provided by Dr.
Michel Brémont (French National Institute for Agricultural Research [INRA], Jouy-enJosas Cedex, France). The IFITM-1-luciferase and human IFN-luciferase constructs and
CMV-lacZ, and CMV-GFP expression vectors previously were cloned in our lab.
Plasmids expressing the VHSv coding sequence are described in detail in the cloning
section of the Materials and Methods.
18
2.3 VHSv stocks and infection
Stocks of the VHSv IVb strain initially were obtained from Dr. James Winton
(USGS, Seattle, WA.). The virus was propagated by infecting a monolayer of EPC cells
in serum free media at a low MOI for an h and then incubating them at 22º C in complete
media containing 10% serum until complete cytopathicity was reached (typically 4872h). Media was collected and dead cells and debris were cleared by centrifugation.
Stocks were serially diluted 1:3 on a 96 well plate of confluent EPC cells to determine
relative viral concentration.
2.4 Cloning and PCR
Primers used to clone VHS IVb genes were designed from the full-length
genomic sequence of the MI03GL isolate (GQ385941). The primers used to clone the
VHSv genes are listed in table 1 along with annealing temperatures and extension times.
EPC cells were infected with VHSv for no more than two days and were then collected in
TRIzol. RNA was isolated using TRIzol per manufacturer’s protocol (Invitrogen, San
Diego, CA). Two µg of the RNA was reverse transcribed using M-MLV RT (Promega)
as previously described (Sambrook, Fritsch, & Maniatis, 1989). Briefly, two µg of RNA
was mixed with 100ng of random hexamer primers and the volume was taken to 7 µl
with water. The solution was incubated at 70°C for 5 min. The tube was briefly cooled
before adding the M-MLV-RT mixture (5µl M-MLV 5x Reaction Buffer, 5ul dNTPs
(Invitrogen), Recombinant RNasin Ribonuclease Inhibitor (Invitrogen), M-MLV RT
(Promega), and water to 25µl). The samples were mixed gently and then incubated at
42°C for 1 h. PCR was completed with the primer sets, annealing temperatures and
19
elongation times found in Tables 1 and 2. All PCR programs began with a 5 min
denaturation step at 95°C. Each cycle included a 30 second 95°C denaturation step, an
annealing step with temperature dependent on the primers used, and a 72°C
extension/elongation step with time dependent on the size of template and final product.
While VHSvM, NV, G, and N required only one set of primers, VHSvP was
cloned by first obtaining a larger section of the virus, sequencing it, then preparing
appropriate primers to subclone the coding sequence into pcDNA3.1(-)-myc/his A. All
fragments were cloned into pcDNA 3.1 (-) myc/his A (Invitrogen), pGEM-t easy
(Promega), or p3xFLAG-CMV-14 (Sigma).
EPC MX1 primers were designed previously (M. S. Kim & Kim, 2011). The
mRNA seuquence used to design the luciferase primers was found on genbank (U47295).
20
21
VHSvNnew_EcoRI.se CAGAATTCATGGAAGGAGGAATC
VHSvNnew_KpnI.as GTGGTACCATCAGAGTCCTCG
VHSvG.se_EcoRI
VHSvG.as_KpnI
VHSvN-myc/his
VHSvG-myc/his
ACGAATTCATGGAATGGAATACTT
GTGGTACCGACCATCTGGCT
GCTCAATGGGACAGGAATGA
CTATCTTGAAGCTTGTGATCAG
CAGAATTCATGACTGATATTGAGAT
GTGGTACCCTCTAACTTGTCCA
NforP.se
Mforp.as
VHSvP.se
VHSvP.as
VHSvP-myc/his
CTGAATTCATGGCTCTTTCAAAAG
TATCTAGACCGGGGTCGGAC
ACGAATTCATGGCTCTATTCAAAAG
ACGGTACCCCGGGGTCGGACAGAG
Sequence (5'-3')
ACGAATTCATGACGACCCAGTCGGCAC
ACGGTACCTGGGGGAGATTCGGAGCCA
Mflag.se_EcoRI
Mflag.as_Xbai
VHSvM.se
VHSvM.as
Primer Name
VHSvNV-myc/his VHSvNV.se
VHSvNV.as
VHSvM-flag
VHSvM-myc/his
Gene Cloned
each 25μl PCR reaction.
EcoRI
KpnI
EcoRI
KpnI
EcoRI
KpnI
EcoRI
KpnI
EcoRI
XbaI
EcoRI
KpnI
53
54
53
52
57
55
55
Restiction Annealing
Site
Temp (°C)
2:30
2:30
1:30
2:00
1:30
1:30
1:30
Extension
Time
(Minutes)
at a 1µg/µl stock concentration. 0.5µl of a 100ng/µl working dilution was used for each primer in
ordered from Invitrogen at 25N scale. Lyophilized primers were resuspended in nuclease-free water
annealing temperature and extension times. All primers are listed in 5’ to 3’ orientation and were
Table 1: Cloning Primers. The primers used to clone VHSv genes are listed together with their
22
Luciferase.se
Lucuferase.as
EPC_MX1.se
EPC_MX1.as
MX1
Primer Name
Luciferase
Target
ATTACCTGGTTGTGGTGCCATGC
TACCACTGTCCCTTCAGTGCCTTT
TCAAAGAGGCGAACTGTGTG
GGTGTTGAGCAAGATGGAT
Sequence (5' - 3')
(U47295). EPC MX1 primers were previously designed.
52
52
Annealing
Temp (°C)
30
30
Extension
Time
(Minutes)
expression of genes. Luciferase primers were designed from a sequence hosted on genbank
Table 2: Expression Primers. These primers are used in RT-PCR to measure the general
2.5 Transfection
Transfections were performed using Polyjet reagent (Signagen) according to the
manufacturer’s instructions. Tranfections were performed in SF MEM, which was
changed to complete medium 3h after transfection. Plasmid amounts were as specified in
presented figures (Figs 6B, 9, 10).
2.6 Confocal microscopy and immunofluorescence
Cells were plated on glass cover slips treated with poly-L lysine and transiently
transfected the next day at a density ~10%. The following day the media was removed
and the cells were rinsed with PBS. The cells were fixed with 4% paraformaldehyde for
15 min at room temperature and washed 3 times with PBS for 5 min to ensure the
complete removal of the fixing agent. The fixed cells were blocked for 1 h at room
temperature (1x PBS, 5% normal goat serum, and .3% Triton X-100). While blocking,
fresh antibody dilution buffer was prepared (1x PBS, 1% BSA, .3% triton X-100) and the
primary antibody was added. The blocking solution was aspirated and the primary
antibody solution was added. Cells were incubated overnight at 4°C. The next day the
cells were rinsed in PBS 3 times for 5 min. The antibody dilution buffer containing the
secondary antibody conjugated with FITC was added to the cells. The cells were allowed
to incubate 1.5 h at room temperature in the dark. The coverslips were removed from the
plate and mounted to slides with mounting media (glycerol and 1% PPD), sealed with
nail polish and stored at 4 C. Prepared slides were imaged with a confocal microscope
(Olympus IX81) at 100X the same or the following day.
23
2.7 Subcellular fractionation
Three 10cm plates were transfected with VHSvM-myc/his expression plasmid
then fractionated into nuclear, cytoplasmic, mitochondrial and nuclear membrane
extracts. The following day, cells were scraped from the plate and resuspended in 5
volumes of mitochondrial isolation buffer (220 mM mannitol, 68 mM sucrose, 10 mM
HEPES pH 7.4, 10 mM KCl, 1 mM EGTA, 1 mM EDTA, 1 mM MgCl2). Cells were
incubated for 5 min on ice and then dounce homogenized. Homogenate was centrifuged
for 10 min at 1000g. The supernatant was further centrifuged for 10 min at 10,000g
yielding a mitochondrial pellet and cytoplasmic fraction (supernatant). The pellet was
resuspended with RIPA lysis buffer (150 mM NaCl, 1% NP-40, 0.5% sodium
deoxycholate, 0.1% SDS, 50 mM Tris pH 8.0, 1 mM PMS) and incubated on ice for 15
min. Finally, the lysate was centrifuged at 10,000g for 10 min to yield the nucleoplasm
and nuclear membrane extracts. Both final pellet fractions were washed three times with
the buffer used in the previous step. Lysates were run on a 15% SDS-Page gel and
transferred to PVDF. VHSvM-myc/his was detected with 1:1000 Myc antibody (Cell
signaling). Details on the immunoblotting procedure can be found in the Materials and
Methods.
2.8 Luciferase assays/β-gal assays
EPC cells were transfected at 70% confluency with a luciferase promoter
construct, a CMV-LacZ expression vector, and VHSv protein expression vectors. The
assay was performed 24-48 h following the transfection. Media was removed and cells
detached from the plate with Versene (1% EDTA in PBS), scraped, and then washed with
24
PBS. The cells were carefully pelleted then lysed with 115µl Reporter Lysis 5x Buffer
(Promega) for 5 min on ice. Samples were subsequently centrifuged at 12,000g for 10
min to clear the lysate. 50µl of each sample was added to a well on a clear 96 well plate
along with 50 µl of the β-gal buffer (3.2µl β-mercaptoethanol, 200µl ortho-Nitrophenylβ-galactoside (ONPG), and 1ml of β-gal buffer [8.5g Na₂HPO₄, 4.75g NaH₂PO₄, 10ml
1M KCl, and .246g MgSO₄; Q.S. to 1L]). The mixture was incubated in a clear plate at
37°C until samples became light yellow. The absorbance was read at 414nm on a
SpectraMax plate reader. The second half of the cellular lysate was placed into an
opaque white plate. ATP (2.5ml ATP buffer, 25µl DTT and 50µl 100mM ATP) and
luciferin (500µl luciferin, 250µl Glycyl-glycine, 25µl DTT and 1.75ml water) solutions
were made separately and then mixed quickly before adding 50µl to each sample in a
white 96 well plate.
The plate was read rapidly (100ms integration period) for
luminescence on a SpectraMax plate reader. When possible, the luciferase values were
normalized to the corresponding values from the β-gal assay. To do this, the luciferase
values were divided by their respective β-gal absorbances. To obtain a fold induction
relative to the negative control, the values were individual normalized (divivided) by the
value for the negative control.
2.9 Immunoblotting
Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was
used to detect protein expression of cloned VHSv proteins tagged with a myc or flag
epitopes. Either 15% (2.5ml 4x buffer, 3.75ml 40% acrylamide, 0.1ml 10% APS, 0.01ml
TEMED, 3.64ml H₂O) or 12.5% (2.5ml 4x buffer, 3.125ml 40% acrylamide, 0.1ml 10%
25
APS, 0.01ml TEMED, 4.265ml H₂O) separating gels were prepared. In both cases, the
separating gel was topped with a 4% stacking gel (1.25ml 4x buffer, 0.625ml 40%
acrylamide, 0.05ml 10% APS, 0.005ml TEMED, 3.07ml H₂O). Lysates were loaded
with 4x SDS buffer including bromophenol blue dye. Gels were run at a constant 20
volts in running buffer (25 mM Tris base, 192 mM glycine, and 6.94 mM SDS). Proteins
were transferred to Immobilon-P Polyvinylidene Fluoride (PVDF) membrane using a
Bio-Rad Trans-Blot SD Semi-Dry Electrophoretic Transfer Cell after being soaked in
transfer buffer (25 mM Tris base, 192 mM glycine and 20% methanol) 35-40 min at
constant 20 volts. Blots were blocked in 5% non-fat milk (Kroger’s instant non-fat dry
milk) in TBST for 1 h/ and incubated in primary antibody (diluted in 1% BSA in TBST)
overnight at 4°C. The next day, membranes were washed 3 times in TBST and then
incubated with secondary antibody conjugated with HRP in 5% non-fat milk in TBST for
one h.
Blots were washed in TBST three more times before adding Enhanced
Chemilumenscence reagent as described by the manufacturer (Pierce). The blots were
developed using a Kodak Image Station 4000R pro for 5-10 min.
2.10 AnnexinV staining
An Annexin V-FITC Fluorescence Microscopy kit (BD Pharmingen) was used to
stain transfected or untransfected cells following the manufacturer’s directions. Briefly,
cells were washed twice with PBS and then once more with Annexin V Binding buffer.
Cells were stained with Annexin V-FITC solution diluted 1:10 in the binding buffer for
15 min at room temperature. Cells were washed again with 1x binding buffer and then
26
counterstained with DAPI. Cells were observed at 200x under phase contrast, DAPI, and
FITC filters on an Olympus IX81 microscope.
2.11 Real-time PCR
Quantitative real-time PCR was performed with the SsoFast Evagreen
Supermix master mix (Biorad). The mastermix was diluted from 2x to 1x in each
20µl reaction. Each reaction consisted of 1µl cDNA, 10µl SsoFast Supermix, 50ng
sense primer, 50ng antisense primer, and 8µl of nuclease free water. Samples were
loaded into a clear 96 well PCR plate (Biorad) and placed into an Eppendorf
Mastercycler® ep Realplex Thermal Cycler. After an initial 5 min denaturation step
at 95°C, 40 cycles of 30 seconds at 95°C and 60 seconds at 62°C were carried out.
The thermocycler was set to read fluorescence at the end of each 62°C step (the end
of the elongation phase). Samples were normalized to the fish β-actin housekeeping
gene.
2.12 Viral-protection assay/IFN-production assay
To quantify IFN activity is in media following treatment or infection, conditioned
media was collected and serially diluted on confluent EPC cells on a 96 well plate.
Serving as controls, the top and bottom rows were left untreated with media. Twentyfour to forty-eight h following the dilution, the 96 well plate was infected with VHSv IVb
(MOI = 1) with the exception of the bottom row as a negative control. Cells were
monitored until the cells that were both untreated and infected showed complete
cytopathicity. Cells were washed with PBS, fixed with methanol, and then stained with
27
crystal violet. Results were interpreted by identifying the 50% killing point (IC50) for
each condition.
28
Chapter 3
Results
3.1 VHSv inhibits the innate immune response
3.1.1 VHSv inhibits interferon activity
As previously presented, activation of the IFN receptor leads to the expression of
hundreds of ISGs that work in concert to induce an anti-viral state in cells. Therefore,
pre-treating cells prior to infection should subsequently protect them from the virus.
Furthermore, if a virus is incapable of inhibiting the innate response, one would expect
treatment following infection to also suppress viral replication and inhibit cytopathic
effect (CPE). To determine if VHSv could inhibit protection conferred by treatment with
fish interferon (fIFN), we performed a time-course experiment in which Epithelioma
Papulosum Cyprini (EPC) fish cells were left uninfected or were infected pre- or posttreatment with fIFN (Fig. 5A). As expected, fIFN treatment 24 h prior to infection
completely protected the cells from viral CPE. However, cells treated with the same dose
of IFN 16 or 24 h post virus infection (but prior to any signs of CPE) were not protected
(Fig. 5A). These results suggested that a factor or factors introduced by VHSv infection
29
inhibited IFN’s ability to establish an antiviral state. To determine if VHSv had any
direct impact on IFN signaling, we transiently transfected a luciferase construct driven by
the IFITM1 ISG promoter into EPC cells and left the cells uninfected or infected them
for 24 or 48 h (Fig. 5B). The cells then were treated with IFN 6 h prior to preparation of
the cell lysates and luciferase assay.
Treatment with IFN following viral infection
resulted in lower IFITM1 promoter activity as compared to IFN treatment alone (Fig.
1B). Taken together, these data provide strong evidence for the existence of at least one
VHSv factor capable of inhibiting downstream signaling by interferon.
30
B
31
Figure 5 – VHSv inhibits IFN activity. A) EPC cells were treated with IFN pre- or
post-VHSv infection as indicated. Cells were imaged under phase contrast microscopy
(40x) 72 h post-infection. B) EPC cells were transfected with an IFITM1/luc construct
and β-galactosidase (-gal) expression vectors. The next day they were infected with
VHSv for 24 or 48 h or left uninfected. The indicated samples were treated with IFN for
6 h, after which cells were lysed in 5x reporter lysis buffer (Promega). Lysates were split
equally and used for a luciferase and -gal assays. Samples were normalized to the -gal
control and values expressed as a fold expression relative to untreated controls.
32
3.1.2 Individual VHSv proteins modulate innate immune responses
To identify the individual factors responsible for blocking innate immune
responses, we cloned individual VHSv genes into expression vectors. These constructs
were transfected alone or with fish MAVS (fMAVs) into EPC cells. Overexpression of
MAVS activated the downstream signaling pathway leading to the up-regulation of type I
IFNs. Therefore, the relative amount of IFN present in the media was indicative of the
activation of this pathway. Media from the transfected cells was harvested and serially
diluted on a 96 well plate containing naïve EPC cells. After 24 h, treated cells were
infected with VHSv (MOI = 1). After three days the cells were fixed and stained (Fig.
6A). In wells containing the media from cells transfected only with MAVS there was
significant protection, thus verifying IFN production. When combined with MAVs, the
viral genes P and M inhibited MAVs induced viral protection.
Although N and G
displayed some effect in this replicate, the observed inhibition was not consistent with
results from other experiments (data not shown). In contrast, transiently expressing the
nv gene moderately enhanced the activation of the pathway. These data were supported
by assaying the transcriptional activation of the IFITM1 ISG promoter (Fig. 6B).
The
expression vectors for the viral genes were transfected along with the IFITM1-luciferase
construct, with or without MAVS co-transfection. The production of luciferase from the
IFITM1 promoter was assayed by measuring cellular luciferase levels 24 h later. As
above, P showed some degree of inhibition, while M showed complete inhibition of
MAVS-induce ISG expression. Furthermore, this experiment also indicated both NV
augmentation of MAVS activity and induction of luciferase activity when expressed
33
alone. These data suggest that VHSv produces products that are capable of augmenting
the innate immune response.
34
1:3
35
Figure 6: VHSv gene products modulate IFN responses. A) Media harvested from
cells previously transfected with MAVS alone or MAVS plus Myc-tagged M, P, NV, N
or G was titered in 1:3 dilutions onto naïve EPC cells grown on a 96-well plate. After 48
h the cells were infected with VHSv (excluding the bottom row). The cells were fixed in
methanol and stained with crystal violet 72 h post infection. Transfected cells were also
analyzed by immunoblot analysis for viral protein expression, by using anti-Myc
antibody (note that M protein expression was low due to cellular apoptosis at that time
point). B) EPC cells were transfected with 0.3μg of an IFITM1\luc promoter construct
and 0.3 μg of a CMV-LacZ(β-gal) expression vector along with 0.2μg of the indicated
construct with or without MAVS (0.3μg).
The cells were harvested 48 h after
transfection and Luciferase and β-gal assays were performed. The graph represents the
fold induction of β-gal correct luminescence values relative to the negative control (±
standard deviation).
36
3.2 The VHSv Matrix protein
3.2.1 VHSv Matrix (M) protein induces apoptosis
The potent effect of the M protein on innate immune signaling prompted
additional studies on its potential actions. To assess the impact of the VHSv M protein
on cell viability, EPC cells were transiently transfected with M expression vectors.
During these experiments we observed morphological changes characteristic of
apoptosis, such as EPC cell rounding and nuclear blebbing 48 h following transfection,
and complete cell death after 72 h (Fig. 7, Phase Contrast). To determine if the death was
due to an apoptotic response to VHSv M protein, cells were stained with Annexin-V
FITC and DAPI. Cells infected with VHSv for 72 h and those transiently transfected
with M for 48 h stained positive for Annexin-V, while the uninfected controls and cells
transfected with an empty vector remained unstained (Fig. 7, Annexin-V). Furthermore,
the cells transfected with M or infected with VHSv also exhibited other hallmarks of
apoptosis, including nuclear condensation (Fig. 7, DAPI staining). These data taken
together suggest that the M protein is capable of inducing apoptosis when expressed in
isolation, and that this cellular apoptotic response was morphologically similar to that of
cells infected by VHSv.
37
38
Annexin VFITC
DAPI
Phase
Contrast
Control
VHSv (1:50)
pcDNA 3.1 (-)
VHSv
M
Figure 7: VHSv M induces apoptosis. EPC cells were either left untreated or infected
for 72 h, or were transiently transfected with an empty vector (pcDNA3.1) or an M
(0.3μg) expression vector as indicated and cultured for 48 h. Cells then were stained with
AnnexinV-FITC and DAPI and imaged on a fluorescent microscope. Phase contrast
pictures were taken to illustrate changes in morphology and cell density.
39
3.2.2 M Localizes to the Nuclear Membrane and Cytoplasm.
To help elucidate a potential mechanism for the anti-cellular action of the M
protein, we first sought to determine its specific location within the cell.
Initial
fractionation studies employing specific lysis buffers and centrifugation separated cells
into nuclear membrane, soluble nuclear, mitochondrial and cytoplasmic fractions. The
presence of the M protein in the specific compartments was assessed using Western blot
analysis. The fractionation studies indicated that the M protein localized to the nuclear
membrane and to the cytoplasm.
To confirm our initial observations, we used
immunofluorescence and confocal microscopy.
After fixation, cells previously
transfected with an M-flag fusion vector were permeabilized and incubated with a flag
antibody to detect the M protein. The primary antibody subsequently was detected by
incubation with a FITC conjugated secondary antibody. Cells also were counterstained
with propidium iodide to stain the nuclei. Consistent with the above fractionation results,
confocal microscopy suggested that the M protein associated with the nucleus, but also
was found in the cytoplasm.
40
A
NM = Nuclear Membrane
SN = Soluble Nuclear
M = Mitochondria
C = Cytoplasm
NM
SN
M
B
100x Confocal
Primary = Flag
Secondary = Goat anti rabbit-FITC
Counterstained with PI
41
C
Figure 8: M Localizes to the Nucleus and Cytoplasm. A) Cells transiently transfected
with VHSvM-myc/his were fractionated into nuclear membrane, soluble nuclear,
mitochondrial and cytoplasmic fractions using differential centrifugation and various
lysis buffers (listed in Materials and Methods section). Western blot analysis of the
fractions was conducted using an anti-Myc antibody. B) EPC cells were transfected with
VHSvM-Flag and fixed after 24 h. Fixed/permeabilized cells were incubated with an
anti-Flag primary antibody and then a Goat-anti-Rabbit secondary antibody conjugated
with FITC.
Cells were counterstained with propidium iodide and viewed using a
confocal microscope with a 100X objective.
42
3.2.3 M Inhibits the Production of Functional Proteins
As discussed previously, the VHSv M protein potently inhibited luciferase
production by the IFITM1 ISG promoter in response to MAVs overexpression (Fig. 5B).
To further refine the site of the M protein’s effect on the IFN response, we directly
stimulated the cells with IFN to assess its impact on the IFN response pathway. Similar
to its effect on MAVS responses, M potently decreased IFN-induced luciferase
expression from the IFITM1 promoter in a dose-dependent manner (Fig. 9A).
Interestingly, we also observed a significant decrease in the expression of our β-gal
transfection control in the above experiments when M was co-expressed (data not
shown).
This suggested that the transcriptional inhibitory effect associated with M
expression may be more global.
To assess whether M was involved in general
transcriptional or translational machinery inhibition, we co-transfected the M protein with
a constituently active SV40 promoter luciferase construct.
As in the IFITM1/luc
experiments, we observed a marked inhibition of SV40 promoter activity even at the
lowest dose of M (Fig. 9B). To verify these results, an unrelated protein, ZNF313-myc
his was transiently co-transfected with or without M, and immunoblot analysis of
ZNF313 expression was performed after 48 h. ZNF313-myc/his protein expression again
was substantially inhibited at the lower doses of M, and completely abolished when that
was increased (Fig. 9C). Taken together, these data suggest that M inhibits a step(s) in
the cellular transcriptional or translational pathway.
43
To assess M’s impact on transcription, we monitored the amount of luciferase
mRNA produced by the SV40 luciferase construct in the presence or absence of M using
real-time PCR. Interestingly, the relative amount of luciferase mRNA remained the same
regardless of the amount of M expression vector transfected into the cells (Fig. 9D).
These initial experiments suggest that the M protein inhibited a post-transcriptional step
in the protein expression pathway.
44
45
Figure 9: VHSv M inhibits steps following transcription. A) EPC cells were cotransfected with the IFITM1/luc construct, fish IFN (fIFN) and pcDNA or 0.2-0.6μg M as
indicated. After 24h, activity of the luciferase construct was measured as previously
described. (± standard deviation) B) EPC cells were co-transfected with a SV40/luc
construct and pcDNA or 0.1-0.5μg M for 24 h and luciferase activity measured. Values
are expressed as fold induction obtained by dividing raw luminescence by the negative
control (± standard deviation). C) EPC cells were transfected with empty pcDNA,
VHSv M, or ZNF313 alone, or co-transfected with M and ZNF313 as indicated. Lysates
were collected after 24 h and immunoblots probed with anti-Myc and anti-Flag
polyclonal antibodies. D) Cells were transfected with the indicated plasmids and RNA
was isolated 24 h following transfection. Reverse-transcription coupled real-time PCR
was performed using luciferase primers, with actin mRNA serving as a control. It is
important to note that actin CT levels were constant and were not affected by the
expression of M in this experiment. Error bars represent the mean ± standard deviation.
46
3.3 The VHSv Phosphoprotein
3.3.1 VHSv P inhibits IFN signaling
As previously mentioned, our initial experiments suggested that, like M, VHSv P
protein also may negatively impact innate immune responses. Although the effect of
VHSv P on IFN production was less obvious than M (Fig. 6A), the effect of the P protein
on ISG regulation was quite substantial (Fig. 6B), suggesting a possible effect
downstream of IFN production. To further investigate the role of P in the IFN pathway, a
VHSv P expression plasmid was co-transfected with an IFITM1-luciferase construct and
a fish MAVs expression plasmid (Fig. 10A). P co-transfection led to a dose-dependent
inhibition of IFITM1-luciferase expression (Fig. 10A). In order to examine the first
phase of the IFN pathway, we transfected cells with an IFNβ-luciferase plasmid, MAVs
plasmid and increasing amounts of a P expression vector (Fig. 10B). As above, we
observed a dose-dependent inhibition of IFNβ-luciferase activation. The second phase of
the IFN response was evaluated by transfecting cells with the IFITM1-luciferase
construct along with increasing amounts of the P vector followed by treatment IFN (x.
10c). Interestingly, these experiments also resulted in an inhibition of ISG promoter
activation, although this inhibition was considerably more potent than what was seen in
the first phase. VHSv P thus seems to have a negative impact on both phases of the IFN
response. Consequently, the overall inhibitory effect on ISG production was robust. To
confirm this observation, we analyzed the effect of VHSv P on fish ISG MX1 mRNA
transcription following stimulation by IFN (Fig. 10D). Like our previous results, the
presence of P potently suppressed IFN-induced ISG transcription. Taken together, these
47
data suggest that P may negatively impact both phases of the IFN pathways, virus
induced IFN and IFN-induced gene expression.
However, the cumulative result is
reduced ISG activation.
In summary we determined two novel functions for the VHSv IVb P protein. We
showed here that the transient expression of the P protein in EPC cells is capable of
inhibiting the cellular innate immune response. Furthermore, we have shown that the P
protein can inhibit both the viral detection pathway and the IFN response pathway.
48
49
Figure 10: VHSv P inhibits IFN signaling. A) EPC cells were transfected with 0.3 μg
IFITM1-luciferase reporter plasmid, the indicated amounts of VHSv P expression
plasmid and 0.3 μg of a fish MAVs expression plasmid. After 24 h, cell lysates were
assessed for luciferase and values normalized to an internal β-gal control (± standard
deviation). B) Cells were transfected as in “A”, but with a human IFNβ-luciferase
construct instead of the IFITM1-luciferase vector. After 24 h, cell lysates were again
assessed for luciferase activity and values normalized to an internal β-gal control (±
standard deviation). C) Cells were transfected with IFITM1-luciferase reporter plasmid
and the indicated amounts of VHSvP. Six h following the transfection, cells were treated
with fIFN as indicated. 24 h following the treatment, lysates were assessed for luciferase
activity and values normalized to an internal β-gal control (± standard deviation). D)
Cells were transfected with VHSv P expression plasmid as indicated. Specified samples
were treated with fIFN 24 h after transfection and RNA isolated 12 h post IFN treatment.
MX1 and relative actin levels were assessed for each sample using real-time PCR. The
graph is plotted as the inverse of ΔΔCT (ΔΔCT * -1) (± standard deviation).
50
Chapter 4
Discussion
Ecological and economic studies have helped to explain how the spread of VHSv
can potentially impact important food and tourism industries (Smail, 1999). However,
despite the severity of this threat, little is known about the cellular and molecular details
of this disease. Information gained in this area could allow more targeted efforts in
development of appropriate vaccines and treatment methods. Such studies also should
reveal basic information on rhabdovirus mechanisms and evolution.
Over the last 50 years VHSv has continued to spread and adapt to new
environmental niches (Bain et al., 2010; Jonstrup et al., 2009). This suggests that the
virus has evolved at least one mechanism to survive the innate immune systems of
multiple fish species from diverse environments. This obvious, but important, possibility
was supported by experiments in our lab where cells treated with IFN following infection
were unable to clear viral infection (Fig. 5A). That observation indicated that the innate
immune system was prevented from functioning appropriately following viral infection.
Upon exploring this issue further, we identified at least two individual proteins produced
by the virus, the M protein and the P protein, that were capable of potently disrupting
51
innate immune response activation or function.
Interestingly, orthologs of the viral
antagonists found in our initial screen of VHSv genes also have been identified as
inhibitors of innate immune responses in other rhabdoviruses (Faul, Lyles, & Schnell,
2009; Rieder, 2009). As such, we chose to focus our initial experiments with this project
on the VHSv M and P proteins, with the goal of further characterizing their potential sites
of action and mechanisms.
4.1 The VHSv Matrix protein
The VSV M protein is the most understood and well-studied M ortholog within
the rhabdovirus family. As briefly mentioned in the introduction, the VSV M protein has
been implicated to inhibit host gene expression (M Ahmed & Lyles, 1998; Ferran &
Lucas-Lenard, 1997). Similarly, the M protein of Infectious Hematopoietic Necrosis
virus (IHNV), a closer relative to VHSv in the Novirhabdovirus family, has been
associated with inhibiting host-directed gene expression as well (Chiou, Kim, &
Ormonde, 2000). Despite the low sequence similarity among the VSV, IHNV and VHSv
M proteins, our studies indicated that the inhibitory function of M is conserved in VHSv.
We demonstrated that VHSv M, when ectopically expressed, can robustly inhibit gene
expression and, therefore, most subsequent anti-viral responses requiring active
transcription (i.e. – IFN and ISG transcription).
Previous studies from other labs have yielded mixed results regarding a
mechanism for the global inhibition of gene expression by M proteins. Most of the
experiments completed in those research projects only utilized protein analysis or
luciferase assays (Ferran & Lucas-Lenard, 1997; Waibler et al., 2007). Although those
52
techniques were able to easily detect a change in final protein expression, they did little to
answer the question of whether transcription, translation, or both processes were
inhibited.
To date, only a single study has indicated a decrease in actual mRNA
expression via northern blot analysis following ectopic expression of VSV M (Black &
Lyles, 1992). Our initial luciferase and western blot data also indicate a dose-dependent
decrease of expression at the protein level (Fig 9A-C). However, our real-time PCR
analysis of luciferase mRNA with increasing amounts of M showed little to no deviation
from one sample to the next (Fig. 9D).
This suggested that there may be another
mechanism involved in disrupting the gene expression in VHSv-infected cells.
Recent research on the VSV M protein has revealed an association between M
and a highly conserved complex consisting of ribonucleic acid export 1 (RAE1) and
nucleoporin 98 (NUP98) proteins (Fontoura, Faria, & Nussenzveig, 2005). This complex
primarily localizes to the nuclear pore complex and functions to shuttle mRNA from the
nucleus to the cytoplasm (Powers et al., 1997; Pritchard et al., 1999). The interaction
between VSV M and the NUP98/RAE1 complex blocks the transport of mRNA
molecules to the cytoplasm. This mechanism adequately explains not only previous
experiments from other labs, but also our initial results using luciferase assays and
western blot analysis. If luciferase mRNA failed to enter the cytoplasm for translation, it
would not be detected in our luciferase assay. Interaction of VHSv M with this complex
also could potentially explain our real-time PCR results: luciferase mRNA would still be
produced (and thus would exhibit consistent experimental levels) but could not leave the
nucleus. Current experiments in our lab are aimed at assessing mRNA levels in nuclear
and cytoplasmic fractions in the presence or absence of VHSv M. These experiments
53
could help determine if mRNA accumulates in the nucleus when M is expressed.
Intriguingly, our localization of VHSv M to the nuclear membrane could further support
a mechanism in VHSv infected fish cells that resembles that of VSV M in human cells
(von Kobbe C et al., 2000). Our lab currently is attempting to clone RAE1 and NUP98
orthologs from fish to further assess the mechanism.
Interestingly, the RAE1 and NUP98 complex also has been implicated in spindle
assembly complex formation (Blower, Nachury, Heald, & Weis, 2005). VSV M protein
interaction displaces RAE1 from the spindle assembly complex, causing abnormalities in
chromatin, which in turn activates an apoptotic response (Chakraborty et al., 2009). We
determined that ectopic expression of VHSv M induced apoptosis in cells after 48 h (Fig.
7). Furthermore, we observed that the apoptotic response was more pronounced when
the transfected cells were sparsely plated (data not shown). This would suggest that
dividing cells were more apt to undergo apoptosis.
Although the reduced gene
expression associated with M expression might also contribute to apoptosis, no evidence
for this mechanism of VHSv or other rhabdovirus M protein actions have been reported.
54
mRNA export inhibited
“Normal” mRNA Export
Figure 11: VSV M inhibits nuclear export of mRNA. The panel on the left illustrates
normal export of mRNA through the RAE-1-NUP98-mRNA complex. NUP98 recruits
RAE-1 to the nuclear pore complex (NPC). In turn, mRNA binds to RAE1 and the
complex shuttles the mRNA into the cytoplasm. When VHSv M is present it interacts
with RAE1 thereby inhibiting association between RAE1 and mRNA. This prevents
mRNA from being exported from the nucleus, leading to its accumulation in the nucleus
and loss of cellular protein expression
55
4.2 The VHSv Phosphoprotein
The rabies virus (RV) P protein prevents transcriptional activation of IFN genes
and inhibits IFN-mediated JAK-STAT signaling (Faul et al., 2009). The “first phase” of
the IFN pathway leading to the transcription of IFNs relies primarily on IRF3 and IRF7
transcription factors. RV P interacts with these transcription factors and prevents them
from undergoing phosphorylation by the upstream signaling molecules, TBK1 and IKKi
(Maryam Ahmed et al., 2009; K Brzozka, Finke, & Conzelmann, 2005).
Without
phosphorylation, neither IRF3 nor IRF7 can localize to the nucleus to activate IFN gene
expression (Sun et al., 2010).
Despite a lack of available expression plasmids for many components of the fish
virus response pathway, our lab has developed parameters to analyze this pathway in fish
cells.
After activating the signaling pathway by over-expressing a fish ortholog of
MAVs, we can observe changes in IFN activation either by harvesting medium and
treating naïve cells with collected media dilutions prior to infecting them with VHSv to
assess protection or by using a highly conserved human IFNβ promoter luciferase
construct as pathway activation readout. In these experiments, VHSv P mildly inhibited
IFN production.
Although this observation may have multiple interpretations, we
hypothesize that this inhibition is likely due to an association between VHSv P and IRF3.
Our lab recently cloned the IRF3 ortholog in fish to test any potential interaction it may
have with VHSv P, to test this hypothesis.
RV P also potently inhibits the activation of ISGs by blocking JAK/STAT
signaling (Krzysztof Brzozka et al., 2006; Yu et al., 2010). Unlike the “first phase”
(virus detection arm) of the pathway where many proteins are involved in a complex
56
signaling cascade, the “second phase” (IFN response) is relatively simple, involving only
proteins that comprise the IFN receptor complex, the JAKs (JAK1 and JAK2), the
STATs (STAT1 and STAT2), and IRF9. Previous experiments with RV indicated that
the P protein bound to the STAT proteins only after their activation by the JAKs
associated with the IFN receptor (Brzozka et al., 2006). Following RV P binding to the
phosphorylated STATs, the STATs were sequestered in the cytoplasm, preventing them
from activating the transcription of target ISGs in the nucleus. Here, we have shown here
that the VHSv P protein potently inhibited ISG transcriptional activation in a dosedependent manner. It is likely that the VHSv P protein has a similar function to that of
the RV P protein. Although fish STAT genes have been difficult to clone, we are
working on isolating them so that we will be able to assess any interactions between
VHSvP and either STAT1 or STAT2.
57
(IFN response pathway)
(Viral detection pathway)
Figure 12: RV P prevents both IFN activation and ISG activation. In the viral
detection pathway the VSV P protein associates with IRF3 and prevents its
phosphorylation by up-stream signaling molecules. Without being phosphorylated, IRF3
cannot localize to the nucleus and activate IFN transcription.
In the IFN response
pathway, the P protein interacts with the ISGF3 complex after it has been activated by
IFN-mediated signaling.
This prevents the complex from entering the nucleus and
activating ISGs.
58
4.3 Future Goals and Experiments
4.3.1 Other VHSv proteins
We made a number of interesting observations on the functions of other VHSv
viral proteins. In addition to the M and P effects described in detail herein, some of our
initial experiments also indicated that the small NV gene found only in novirhabdoviruses
may be capable of positively augmenting or activating the transcription of IFN when
expressed alone in EPC cells (Fig. 6). These results suggest that NV may be a pathogen
associated molecular pattern that is detected by the RIG-I like helicases. To date we have
cloned NV from multiple strains of VHSv and have begun testing the expression vectors
in EPC cells.
4.3.2 Comparison of VHSv and related rhabdovirus strains
As alluded to above, our lab obtained cDNA from multiple VHSv strains and
related fish rhabdoviruses. Previous research on these strains has indicated that few
differences in amino acid sequence are required to dramatically alter the virulence and
lethality of the virus. As such, determining which amino acid differences in individual
proteins are most likely to alter viral function could allow us to better understand the
function and evolutionary importance for individual genes. Furthermore, mapping the
areas of the genome and determining proteins that influence virulence and cytopathicity
could aid development of future therapeutic interventions for VHSv. Thus far, our lab
has cloned the NV gene (as mentioned above) and the M gene from several variants.
Initial experiments on the M variants have indicated differences in the degree of M
59
transcriptional inhibition, despite minimal substitutional divergence among the
sequences.
4.3.3 Recombinant viruses
With the increase of genomic information and cloning techniques, development of
knock-out viruses has become more common. As suggested by the name, these viruses
would ultimately be fully developed virions whose genome lacks a gene or genes of
interest. As with other knock-outs used in model organisms, comparing the resulting
“phenotype” between the wild-type sample and the knock-out could help determine a
more global function for the target gene.
Furthermore, to verify results related to
differences in VHSv variants, we could develop recombinant viruses expressing only the
differing gene of interest and assess changes in its virulence and cytopathicity.
4.4 Overall Summary
We have herein reported novel functions for two VHSv IVb products. Ectopic
expression of the M protein for greater than 48 h induces apoptosis in fish EPC cells (Fig.
7). We have also shown that the M protein blocks the production of host cell proteins
while transcriptional activation continues, uninhibited by the presence of M. Both of
these results, along with our localization of M to the nuclear membrane, strongly suggest
that VHSv may utilize similar mechanisms as VSV through and association with the
NUP98-RAE1 complex.
Our experiments indicate that the VHSv P protein is an inhibitor of the innate
immune responses in EPC cells. Expressing MAVs alone can activate the down-stream
60
signaling pathway leading to the activation of IFN genes. In the presence of P, IFN
activation is dose-dependently decreased. This suggest that P is able to inhibit some step
in the vial detection pathway. Furthermore, activating the IFN response pathway by
treating cells with IFN in the presence of P block ISG gene transcription. This suggest
that P is also involved in the IFN response pathway. Taken together, these observations
are consistent with what is seen in the rabies virus.
61
References
Ahmed, M, & Lyles, D. S. (1998). Effect of vesicular stomatitis virus matrix protein on
transcription directed by host RNA polymerases I, II, and III. Journal of Virology,
72(10), 8413-9.
Ahmed, Maryam, Mitchell, L. M., Puckett, S., Brzoza-Lewis, K. L., Lyles, D. S., &
Hiltbold, E. M. (2009). Vesicular stomatitis virus M protein mutant stimulates
maturation of Toll-like receptor 7 (TLR7)-positive dendritic cells through TLRdependent and -independent mechanisms. Journal of Virology, 83(7), 2962-75.
Ammayappan, A., & Vakharia, V. N. (2009). Molecular characterization of the Great
Lakes viral hemorrhagic septicemia virus ( VHSV ) isolate from USA. Virology
Journal, 16, 1-16.
Assenberg, R., Delmas, O., Morin, B., Graham, S. C., De Lamballerie, X., Laubert, C.,
Coutard, B., et al. (2010). Genomics and structure/function studies of Rhabdoviridae
proteins involved in replication and transcription. Antiviral research. Elsevier B.V.
Bain, M. B., Cornwell, E. R., Hope, K. M., Eckerlin, G. E., Casey, R. N., Groocock, G.
H., Getchell, R. G., et al. (2010). Distribution of an invasive aquatic pathogen (Viral
Hemorrhagic Septicemia virus) in the Great Lakes and its relationship to shipping.
PloS One, 5(4), e10156.
Benmansour, A., Basurco, B., Monnier, a F., Vende, P., Winton, J. R., & de Kinkelin, P.
(1997). Sequence variation of the glycoprotein gene identifies three distinct lineages
within field isolates of Viral Haemorrhagic Septicaemia virus, a fish rhabdovirus.
The Journal of General Virology, 78(11), 2837-46.
Biacchesi, S., Leberre, M., Lamoureux, A., Louise, Y., Lauret, E., Boudinot, P., &
Bremont, M. (2009). Mitochondrial antiviral signaling protein plays a major role in
induction of the fish innate immune response against RNA and DNA viruses.
Journal of Virology, 83(16), 7815-7827.
Black, B. L., & Lyles, D. S. (1992). Vesicular stomatitis virus matrix protein inhibits host
cell-directed transcription of target genes in vivo. Journal of virology, 66(7), 405864.
62
Blower, M. D., Nachury, M., Heald, R., & Weis, K. (2005). A Rae1-containing
ribonucleoprotein complex is required for mitotic spindle assembly. Cell, 121(2),
223-34.
Borden, E. C., Sen, G. C., Uze, G., Silverman, R. H., Ransohoff, R. M., Foster, G. R., &
Stark, G. R. (2007). Interferons at age 50: past, current and future impact on
biomedicine. Nature Reviews. Drug Discovery, 6(12), 975-90.
Bowie, A. G., & Unterholzner, L. (2008). Viral evasion and subversion of patternrecognition receptor signalling. Nature Reviews. Immunology, 8(12), 911-22.
Breiman, A., Grandvaux, N., Lin, R., Ottone, C., Akira, S., Yoneyama, M., Fujita, T., et
al. (2005). Inhibition of RIG-I-dependent signaling to the interferon pathway during
hepatitis C virus expression and restoration of signaling by IKKε. Journal of
Virology, 79(7), 3969-3978.
Brudeseth, B. E., & Evensen, O. (2002). Occurrence of Viral Haemorrhagic Septicaemia
virus (VHSV) in wild marine fish species in the coastal regions of Norway. Diseases
of Aquatic Organisms, 52(1), 21-8.
Brunson, R., True, K., & Yancey, J. (1989). VHS virus at Makah national fish hatchery.
American Fisheries Society, Fish Health Section Newsletter, 17, 2837-2846.
Brzozka, K, Finke, S., & Conzelmann, K. (2005). Identification of the rabies virus
alpha/beta interferon antagonist: phosphoprotein P interferes with phosphorylation
of interferon regulatory factor 3. Journal of Virology, 79(12), 7673-7681.
Brzozka, Krzysztof, Finke, S., & Conzelmann, K.-klaus. (2006). Inhibition of interferon
signaling by rabies virus phosphoprotein P : activation-dependent binding of STAT1
and STAT2. Journal of Virology, 80(6), 2675-2683.
Chakraborty, P., Seemann, J., Mishra, R. K., Wei, J.-H., Weil, L., Nussenzveig, D. R.,
Heiber, J., et al. (2009). Vesicular stomatitis virus inhibits mitotic progression and
triggers cell death. EMBO Reports, 10(10), 1154-60. Nature Publishing Group.
Chang, M., Collet, B., Nie, P., Lester, K., Campbell, S., Secombes, C. J., & Zou, J.
(2011). Expression and functional characterization of the RIG-I like receptors
MDA5 and LGP2 in rainbow trout (Oncorhynchus mykiss). Journal of Virology,
85(16), 8403-8412.
Chiou, P. P., Kim, C. H., & Ormonde, P. (2000). Infectious Hematopoietic Necrosis virus
Matrix protein inhibits host-directed gene expression and induces morphological
changes of Apoptosis in Cell Cultures. Journal of Virology, 74(16), 7619-7627.
63
Colman, P. M., & Lawrence, M. C. (2003). The structural biology of type I viral
membrane fusion. Nature reviews. Molecular cell biology, 4(4), 309-19.
Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., & Whelan, S. P. J.
(2009). Vesicular stomatitis virus enters cells through vesicles incompletely coated
with clathrin that depend upon actin for internalization. PLoS pathogens, 5(4),
e1000394.
Einer-Jensen, K. (2004). Evolution of the fish rhabdovirus viral haemorrhagic
septicaemia virus. Journal of General Virology, 85(5), 1167-1179.
Elsayed, E., Faisal, M., Thomas, M., Whelan, G., Batts, W., & Winton, J. (2006).
Isolation of viral hemorrhagic septicemia virus from muskellunge, Esox
masquinongy (Mitchill), in Lake St Clair, Michigan, USA reveals a new sublineage
of the North American genotype. Journal of fish diseases, 29, 611-619.
Faria, P. a, Chakraborty, P., Levay, A., Barber, G. N., Ezelle, H. J., Enninga, J., Arana,
C., et al. (2005). VSV disrupts the Rae1/mrnp41 mRNA nuclear export pathway.
Molecular cell, 17(1), 93-102.
Faul, E. J., Lyles, D. S., & Schnell, M. J. (2009). Interferon Response and Viral Evasion
by Members of the Family Rhabdoviridae. Viruses, 1, 832-851.
Ferran, M. C., & Lucas-Lenard, J. M. (1997). The vesicular stomatitis virus matrix
protein inhibits transcription from the human beta interferon promoter. Journal of
virology, 71(1), 371-7.
Fontoura, B. M., Faria, P. a, & Nussenzveig, D. R. (2005). Viral interactions with the
nuclear transport machinery: discovering and disrupting pathways. IUBMB life,
57(2), 65-72.
Fox, B. a, Sheppard, P. O., & O’Hara, P. J. (2009). The role of genomic data in the
discovery, annotation and evolutionary interpretation of the interferon-lambda
family. PloS one, 4(3), e4933.
Ghittino, P. (1965). Viral hemorrhagic septicemia (VHS) of rainbow trout in Italy. Annals
of the New York Academy of Sciences, 126(1), 468-478.
Hawley, L., & Garver, K. (2008). Stability of viral hemorrhagic septicemia virus (VHSV)
in freshwater and seawater at various temperatures. Diseases of aquatic organisms,
82(3), 171-178.
Hegedus, Z., Zakrzewska, A., Agoston, V. C., Ordas, A., Rácz, P., Mink, M., Spaink, H.
P., et al. (2009). Deep sequencing of the zebrafish transcriptome response to
mycobacterium infection. Molecular immunology, 46(15), 2918-30.
64
Hershberger, P., Gregg, J., Grady, C., Taylor, L., & Winton, J. (2010). Chronic and
persistent viral hemorrhagic septicemia virus infections in Pacific herring. Diseases
of Aquatic Organisms, 93(1), 43-49.
Hopper, K. (1989). The isolation of VHSv from chinook salmon at Glenwood Springs,
Orcas Island, Washington. American Fisheries Society, Fish Health Section
Newsletter, 17, 1-2.
Horvath, C. M., & Darnell, J. E. (1996). The antiviral state induced by alpha interferon
and gamma interferon requires transcriptionally active Stat1 protein. Journal of
Virology, 70(1).
Howard, M. (1989). Vesicular stomatitis virus RNA replication: a role for the NS protein.
Journal of General Virology, 70, 2683-2694.
Ivanov, I., Yabukarski, F., Ruigrok, R. W. H., & Jamin, M. (2011). Structural insights
into the rhabdovirus transcription/replication complex. Virus research, 162, 126-37.
Elsevier B.V.
Jayakar, H R, Murti, K. G., & Whitt, M. a. (2000). Mutations in the PPPY motif of
vesicular stomatitis virus matrix protein reduce virus budding by inhibiting a late
step in virion release. Journal of Virology, 74(21), 9818-27.
Jayakar, Himangi R, Jeetendra, E., & Whitt, M. A. (2004). Rhabdovirus assembly and
budding. Virus Research, 106, 117-132.
Jensen, M. H. (1965). Research on the virus of Egtved disease. Annals of the New York
Academy of Sciences, 126(1), 422-426.
Jonstrup, S. P., Gray, T., Kahns, S., Skall, H. F., Snow, M., & Olesen, N. J. (2009).
FishPathogens.eu/vhsv: a user-friendly viral haemorrhagic septicaemia virus isolate
and sequence database. Journal of Fish Diseases, 32(11), 925-9.
Jorgensen, P. E. V. (1982). Egtved virus: occurrence of inapparent infections with
virulent virus in free-living rainbow trout, Salmo gairdneri Richardson, at low
temperature. Journal of Fish Diseases, 5(3), 251-255.
Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu,
S., et al. (2006). Differential roles of MDA5 and RIG-I helicases in the recognition
of RNA viruses. Nature, 441(7089), 101-5.
Kim, M. S., & Kim, K. H. (2011). Inhibition of viral hemorrhagic septicemia virus
replication using a short hairpin RNA targeting the G gene. Archives of Virology,
156(3), 457-64.
65
Kim, R., & Faisal, M. (2010). Comparative susceptibility of representative Great Lakes
fish species to the North American viral hemorrhagic septicemia virus Sublineage
IVb. Diseases of Aquatic Organisms, 91(1), 23-34.
Kim, R. K., & Faisal, M. (2010). The Laurentian Great Lakes strain (MI03) of the viral
haemorrhagic septicaemia virus is highly pathogenic for juvenile muskellunge ,
Esox masquinongy (Mitchill). Journal of Fish Diseases, 513-527.
Kim, W., Kim, S.-R., Kim, D., Kim, J.-O., Park, M.-A., Kitamura, S.-I., Kim, H.-Y., et
al. (2009). An outbreak of VHSV (viral hemorrhagic septicemia virus) infection in
farmed olive flounder Paralichthys olivaceus in Korea. Aquaculture, 296(1-2), 165168. Elsevier B.V.
Kopecky, S. A., & Lyles, D. S. (2003). Contrasting effects of matrix protein on apoptosis
in HeLa and BHK cells infected with vesicular stomatitis virus are due to inhibition
of host gene expression. Journal of Virology, 77(8), 4658-4669.
Krause, C. D., & Pestka, S. (2005). Evolution of the class 2 cytokines and receptors, and
discovery of new friends and relatives. Pharmacology & Therapeutics, 106(3), 299346.
Li, X., Leung, S., Burns, C., & Stark, G. R. (1998). Cooperative binding of Stat1-2
heterodimers and ISGF3 to tandem DNA elements. Biochimie, 80(8-9), 703-10.
Liu, H. M., & Gale, M. (2010). Hepatitis C virus evasion from RIG-I-dependent hepatic
innate immunity. Gastroenterology Research and Practice, 2010, 548390.
Loo, Y.-M., & Gale, M. (2011). Immune signaling by RIG-I-like receptors. Immunity,
34(5), 680-92. Elsevier Inc.
Marié, I., Durbin, J. E., & Levy, D. E. (1998). Differential viral induction of distinct
interferon-alpha genes by positive feedback through interferon regulatory factor-7.
The EMBO Journal, 17(22), 6660-9.
McAllister, P. E., & Wagner, R. R. (1975). Structural proteins of two salmonid
rhabdoviruses. Journal of Virology, 15(4), 733-8.
Meyers, T. R., Short, S., & Lipson, K. (1999). Isolation of the North American strain of
viral hemorrhagic septicemia virus (VHSV) associated with epizootic mortality in
two new host species of Alaskan marine fish. Diseases of Aquatic Organisms, 38(2),
81-6.
Meyers, T., & Winton, J. (1995). Viral hemorrhagic septicemia virus in North America.
Annual Review of Fish Diseases, 5, 3-24.
66
Nishizawa, T., Iida, H., Takano, R., Isshiki, T., Nakajima, K., & Muroga, K. (2002).
Genetic relatedness among Japanese, American and European isolates of viral
hemorrhagic septicemia virus (VHSV) based on partial G and P genes. Diseases of
Aquatic Organisms, 48(2), 143-8.
Peeler, E. J., & Taylor, N. G. (2011). The application of epidemiology in aquatic animal
health -opportunities and challenges. Veterinary Research, 42(1), 94-109. BioMed
Central Ltd.
Plemper, R. K. (2011). Cell entry of enveloped viruses. Current Opinion in Virology,
1(2), 92-100. Elsevier B.V.
Powers, M., Forbes, D., Dahlberg, J., & Lund, E. (1997). The vertebrate GLFG
nucleoporin, Nup98, is an essential component of multiple RNA export pathways.
The Journal of Cell Biology, 136(2), 241-50.
Pritchard, C. E., Fornerod, M., Kasper, L. H., & van Deursen, J. M. (1999). RAE1 is a
shuttling mRNA export factor that binds to a GLEBS-like NUP98 motif at the
nuclear pore complex through multiple domains. The Journal of Cell Biology,
145(2), 237-54.
Rasmussen, C. J. (1965). A biological study of the Egtved disease (INuL). Annals of the
New York Academy of Sciences, 126(1), 427-60.
Rieder, M. (2009). Rhabdovirus evasion of the interferon system. Journal of Interferon &
Cytokine Research, 29, 499-509.
Robertsen, B. (2006). The interferon system of teleost fish. Fish & Shellfish Immunology,
20(2), 172-91.
Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor. Cold Spring Harbor, New York: Cold Spring Harbor
Laboratory.
Schäperclaus, W. (1938). Die Immunisierung von karlen gegen Bauchwa sucht auf
natürilchem und künstlichem Wege. Fishereig, Neudamm, 193-196.
Schütze, H., Enzmann, P. J., Mundt, E., & Mettenleiter, T. C. (1996). Identification of the
non-virion (NV) protein of fish rhabdoviruses viral haemorrhagic septicaemia virus
and infectious haematopoietic necrosis virus. The Journal of General Virology,
77(6), 1259-63.
Simora, R. M., Ohtani, M., Hikima, J., Kondo, H., Hirono, I., Jung, T. S., & Aoki, T.
(2010). Molecular cloning and antiviral activity of IFN-β promoter stimulator-1
67
(IPS-1) gene in Japanese flounder, Paralichthys olivaceus. Fish & Shellfish
Immunology, 29(6), 979-86. Elsevier Ltd.
Skall, H. F., Olesen, N. J., & Mellergaard, S. (2005). Viral haemorrhagic septicaemia
virus in marine fish and its implications for fish farming--a review. Journal of Fish
Diseases, 28(9), 509-29.
Smail, D. A. (1999). Viral Haemorrhagic Septicemia virus. In P. T. . Woo & D. W.
Bruno (Eds.), Fish Diseases and Disorders, Viral, Bacterial and Fungal Infections,
vol 3. (pp. 123-147). New York: CAB International.
Stein, C., Caccamo, M., Laird, G., & Leptin, M. (2007). Conservation and divergence of
gene families encoding components of innate immune response systems in
zebrafish. Genome Biology, 8(11), R251.
Studer, J., & Janies, D. A. (2011). Global spread and evolution of viral haemorrhagic
septicemia virus. Journal of Fish Diseases, 34, 741-747.
Sun, F., Zhang, Y.-B., Liu, T.-K., Gan, L., Yu, F.-F., Liu, Y., & Gui, J.-F. (2010).
Characterization of fish IRF3 as an IFN-inducible protein reveals evolving
regulation of IFN response in vertebrates. Journal of Immunology (Baltimore, Md. :
1950), 185(12), 7573-82.
Tafalla, C., Sanchez, E., Lorenzen, N., DeWitte-Orr, S. J., & Bols, N. C. (2008). Effects
of viral hemorrhagic septicemia virus (VHSv) on the rainbow trout (Oncorhynchus
mykiss) monocyte cell line RTS-11. Molecular Immunology, 45(5), 1439-48.
Taniguchi, T., Ogasawara, K., Takaoka, A., & Tanaka, N. (2001). IRF family of
transcription factors as regulators of host defense. Annual Review of Immunology,
19, 623-55.
Thiéry, R., de Boisséson, C., Jeffroy, J., Castric, J., de Kinkelin, P., & Benmansour, A.
(2002). Phylogenetic analysis of viral haemorrhagic septicaemia virus (VHSv)
isolates from France (1971-1999). Diseases of Aquatic Organisms, 52(1), 29-37.
Tze, È., Mundt, E., & Mettenleiter, T. C. (1999). Complete genomic sequence of Viral
Hemorrhagic Septicemia virus , a fish rhabdovirus. Virus Genes, (7), 59-65.
VHSv Expert Panel. (2010). Viral hemorrhagic septicemia virus ( VHSV IVb ) risk
factors and association measures derived by expert panel. Preventive Veterinary
Medicine, 94(1-2), 128-139. Elsevier B.V.
Waibler, Z., Detje, C. N., Bell, J. C., & Kalinke, U. (2007). Matrix protein mediated
shutdown of host cell metabolism limits vesicular stomatitis virus-induced
68
interferon-alpha responses to plasmacytoid dendritic cells. Immunobiology, 212(910), 887-94.
Warfield, K. L., Perkins, J. G., Swenson, D. L., Deal, E. M., Bosio, C. M., Aman, M. J.,
Yokoyama, W. M., et al. (2004). Role of natural killer cells in innate protection
against lethal ebola virus infection. The Journal of Experimental Medicine, 200(2),
169-79. doi:10.1084/jem.20032141
Winton, J. R., & Einer-Jensen, K. (2002). Molecular diagnosis of infectious
hematopoietic necrosis and viral hemorrhagic septicemia. In C. O. Cunninghan
(Ed.), Molecular Diagnosis of Salmonid Diseases (pp. 49-79). Dordrecht,
Netherlands: Kluwer Academic Publishers.
Wolf, K. (1988). Hemorrhagic septicemia virus. Fish Viruses and Fish Viral Diseases
(pp. 217-249). Ithaca, NY: Cornell University Press.
Yu, F. F., Zhang, Y. B., Liu, T. K., Liu, Y., Sun, F., Jiang, J., & Gui, J. F. (2010). Fish
virus-induced interferon exerts antiviral function through Stat1 pathway. Molecular
Immunology, 47(14), 2330-41. Elsevier Ltd.
Zou, J., Tafalla, C., Truckle, J., & Secombes, C. J. (2007). Identification of a second
group of type I IFNs in fish sheds light on IFN evolution in vertebrates. Journal of
Immunology (Baltimore, Md. : 1950), 179(6), 3859-71.
von Kobbe C, van Deursen JM, Rodrigues, J. P., Sitterlin, D., Bachi, A., Wu, X., Wilm,
M., et al. (2000). Vesicular stomatitis virus matrix protein inhibits host cell gene
expression by targeting the nucleoporin Nup98. Molecular cell, 6(5), 1243-52.
69