* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Studies on host-virus interaction for viral hemorrhagic septicemia
Survey
Document related concepts
Transcript
The University of Toledo The University of Toledo Digital Repository Theses and Dissertations 2012 Studies on host-virus interaction for viral hemorrhagic septicemia virus (VHSv) Adam J. Pore The University of Toledo Follow this and additional works at: http://utdr.utoledo.edu/theses-dissertations Recommended Citation Pore, Adam J., "Studies on host-virus interaction for viral hemorrhagic septicemia virus (VHSv)" (2012). Theses and Dissertations. Paper 404. This Thesis is brought to you for free and open access by The University of Toledo Digital Repository. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of The University of Toledo Digital Repository. For more information, please see the repository's About page. A Thesis entitled Studies on Host-Virus interaction for Viral Hemorrhagic Septicemia Virus (VHSv) by Adam J. Pore Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Cellular and Molecular Biology ________________________________________ Dr. Douglas Leaman, Committee Chair ________________________________________ Dr. Patricia Komuniecki, Dean College of Graduate Studies The University of Toledo August 2012 An Abstract of Studies on Host-Virus Interaction for Viral Hemorrhagic Septicemia Virus by Adam J. Pore Submitted to the Graduate Faculty in partial fulfillment of the requirements for the Master of Science Degree in Cellular and Molecular Biology The University of Toledo August 2012 Viral hemorrhagic septicemia virus (VHSv), a member of the family Rhabdoviridae, is a highly contagious fish virus responsible for large-scale fish die-offs worldwide. A new strain of VHSv, designated IVb, has recently spread to the Great Lakes threatening the tourism, sports fishing and fishery industries of the region. Research on virus-host interactions in VHSv infected fish has been mostly limited to population and ecological based studies while the molecular basis of the disease remains widely uncharacterized. To study virus-host interactions on a molecular level, we cloned four of the six VHSv genes including the matrix (m), nucleocaspid (n), non-virion (nv), and phosphoprotein (p) genes. Of primary interest, the M protein encoded by VHSv seems to share similar characteristics with the matrix protein of a related rhabdovirus. Comparable to the wellstudied rhabdovirus vesicular stomatitis virus (VSV) M protein, ectopically expressed VHSv M inhibits promoter activity of both an interferon stimulated response element containing promoter and a constitutively active simian vacuolating virus 40 (SV40) promoter in Epithelioma Papulosum Cyprini (EPC) cells. Interestingly, real-time PCR iii data suggest mRNA levels remain steady, while protein levels decrease. Together, these data may suggest a similar interaction found in VSV between the M protein and the RAE1-NUP98 complex preventing nuclear export of mRNA. Furthermore, as seen in related rhabdoviruses, we have cell rounding after ectopic expression of the M protein for greater than 48h. Annexin V staining suggests these morphological changes in the cells are due to the induction of apoptosis. Together, these observations suggest two novel functions for the VHSv M protein. Future work will focus on determining the mechanisms utilized by VHSvM to inhibit transcription and induce apoptosis. Additionally, we identified the VHSv phosphoprotein as an inhibitor of both IFN gene activation and IFN-mediated activation of ISGs. The well-studied rabies rhabdovirus phosphoprotein inhibits phosphorylation of IRF3 to prevent transcription of IFN genes and also binds the ISGF3 transcription factor to prevent upregulation of ISGs. Our results suggest the VHSv P protein may utilize similar mechanisms to block antiviral responses. Together, we present here two proteins expressed by VHSv that inhibit innate immune responses in EPC cells. These data could help with the development of appropriate therapeutic interventions. iv This thesis is dedicated to my loving parents and supportive friends. "Walking with a friend in the dark is better than walking alone in the light." --Helen Keller v Acknowledgements First and foremost, I’d like to recognize and thank my advisor, Dr. Douglas Leaman. His guidance, support, patience and knowledge were paramount to my education and the completion of my thesis project. His advice taught me to think constructively and critically, thereby allowing me to formulate appropriate experiments and ideas for the success of my project. I would also like to thank Robert Rominski. As an undergrad in our lab his assistance in my project was more than I could have asked for. Likewise, I’d also like to thank Tyler Williams for his help with this project and for his continued work on unanswered topics. Furthermore, I am more than appreciative of all the support given to me by the other members of the Leaman lab. In particular, I acknowledge Kuldeep Sudini, who frequently helped me organize ideas and generate new ones. He is a fountain of knowledge that helped me learn many things. I would also like to thank the department of Biological Sciences who provided me with a firm foundation of scientific knowledge. The faculty is beyond amazing. I specifically would like to thank my committee members, Dr. Brian Ahsburner, Dr. Malathi Krishnamurthy and Dr. Carol Stepien, all of whom have given me great ideas throughout my project. Lastly, but most certainly not least, I’d like to thank my parents vi and friends who have supported me more than they will ever know. Without them, none of this would have been possible. vii Contents Abstract ............................................................................................................................. iii Aknowledgements ............................................................................................................ vi Contents .......................................................................................................................... viii List of Figures ................................................................................................................... xi List of Tables ................................................................................................................... xii List of Abbreviations ..................................................................................................... xiii 1. Introduction ................................................................................................................... 1 1.1 General Introduction ............................................................................................... 1 1.2 Viral Hemorrhagic Septicemia ............................................................................... 2 1.2.1 VHS Etiology and History ............................................................................ 2 1.3 Viral Hemorrhagic Septicemia virus ...................................................................... 3 1.3.1 Nomenclature and Classification .................................................................. 3 1.3.2 VHSv Structure and Replication ................................................................... 6 1.4 Host Innate Immune System ................................................................................. 11 1.4.1 Innate Immune Response to Viral Infection ............................................... 11 1.5 Viral Evasion of the Innate Immune System ........................................................ 16 1.5.1 Viral Mechanisms to Evade the Innate Immune System ........................... 16 viii 1.5.2 VHSv Evasion of Fish Innate Immune Response ...................................... 17 2. Materials and Methods ............................................................................................... 18 2.1 Cell lines and culture conditions ........................................................................... 18 2.2 Plasmids ................................................................................................................ 18 2.3 VHSv stocks and infection.................................................................................... 19 2.4 Cloning and PCR .................................................................................................. 19 2.5 Transfection .......................................................................................................... 23 2.6 Confocal Microscopy and Immunofluorescence .................................................. 23 2.7 Subcellular Fractionation ...................................................................................... 24 2.8 Luciferase assays/β-gal assays .............................................................................. 24 2.9 Immunoblotting..................................................................................................... 25 2.10 Annexin V staining ............................................................................................. 26 2.11 Real-time PCR .................................................................................................... 28 2.12 Viral Protection/IFN-production assays ............................................................. 28 3. Results .......................................................................................................................... 29 3.1 VHSv inhibits the innate immune response .......................................................... 29 3.1.1 VHSv inhibits IFN activity ........................................................................ 29 3.1.2 VHSv products modulate the innate immune response ............................. 33 3.2 The VHSv Matrix Protein ..................................................................................... 37 3.2.1 VHSv Matrix protein induce apoptosis...................................................... 37 ix 3.2.2 M localizes to the nuclear membrane and cytoplasm ................................ 40 3.2.3 M inhibits the production of function proteins .......................................... 43 3.3 The VHSv Phosphoprotein ................................................................................... 47 3.3.1 VHSv P inhibits IFN signaling .................................................................. 47 4. Discussion..................................................................................................................... 51 4.1 The VHSv Matrix Protein ..................................................................................... 52 4.2 The VHSv Phosphoprotein ................................................................................... 56 4.3 Future Goals and Experiments .............................................................................. 59 4.3.1 Other VHSv proteins.................................................................................. 59 4.3.2 Comparison of VHSv and related rhabdovirus strains .............................. 59 4.3.3 Recombinant viruses .................................................................................. 60 4.4 Overall summary ....................................................................................................60 References ........................................................................................................................ 62 x List of Figures 1. Distribution of VHSv strains in the northern hemisphere .............................................5 2. Genome and virion structure for VHSv ........................................................................8 3. Rhabdovirus replication cycle .......................................................................................9 4. Type I IFN response to viral pathogens ......................................................................14 5. VHSv inhibits IFN activity .........................................................................................31 6. VHSv gene products modulate IFN reponses .............................................................35 7. VHSvM induces apoptosis ..........................................................................................38 8. VHSvM localized to the nucleus and cytoplasm ........................................................41 9. VHSvM inhibits steps following transcription ...........................................................45 10. VHSvP inhibits IFN signaling ....................................................................................49 11. VSV M inhibits nuclear export of mRNA ..................................................................55 12. RV P prevents both IFN activation and ISG activation ..............................................58 xi List of Tables 1. Cloning primers .............................................................................................................21 2. Expression primers ........................................................................................................22 xii List of Abbreviations ATCC ............................................................................. American Type Culture Collection CARD ........................................................... Caspase Activation and Recruitment Domain CPE ............................................................................................................. cytopathic effect DAPI ..................................................................................... 4',6-diamidino-2-phenylindole dNTP ................................................................................ deoxyribonucleotide triphosphate dsRNA............................................................................... double stranded ribonucleic acid DTT ................................................................................................................... dithiothreitol EDTA .................................................................................. ethylenediaminetetraacetic acid EPC .................................................................................... Epithelioma Papulosum Cyprini FBS ..........................................................................................................fetal bovine syrum g................................................................................................................. glycoprotein gene G............................................................................................................ glycoprotein protein h.....................................................................................................................................hours HCV ........................................................................................................... Hepatitis C virus IFN ......................................................................................................................... interferon IHNV..................................................................... Infectious Hematopoietic Necrosis virus IRF ............................................................................................. interferon regulatory factor ISG ...............................................................................................interferon stimulated gene ISGF3 ............................................................................. interferon-stimulated gene factor 3 JAK ................................................................................................................Janus Kinase 1 l .................................................................................................................. Polymerase gene L ..............................................................................................................Polymerase protein m......................................................................................................................... Matrix gene M .................................................................................................................... Matrix protein MAVs ................................................................................ mitochondrial antiviral signaling xiii MDA5 ............................................................. Melanoma differentiation-associated gene-5 MEM ......................................................................................... minimum essential medium min ......................................................................................................................... minute(s) n.............................................................................................................. Nucleoprotein gene N......................................................................................................... Nucleoprotein protein nv ................................................................................................................. Non-virion gene NV ........................................................................................................... Non-virion protein OIE ..............................................................World Organization for Animal Health (trans.) p............................................................................................................ Phosphoprotein gene P ................................................................................................................... Phosphoprotein PAMP....................................................................... pathogen associated molecular pattern PBS .............................................................................................. Phosphate buffered saline PCR ..............................................................................................polymerase chain reaction PPD ................................................................................................... paraphenylenediamine PRR ........................................................................................... pattern recognition receptor RIG-I ...................................................................................... retinoic acid inducible gene 1 RLH......................................................................................................... RIG-I-like helicase RV ..................................................................................................................... Rabies Virus SDS-PAGE ............................. sodium dodecyl sulfate polyacrylamide gel electrophoresis SHRV .............................................................................................. Snakehead Rhabdovirus ssRNA ................................................................................ single-stranded ribonucleic acid STATs ...................................................... signal transducers and activators of transcription TBST ...................................................................................... tris-buffered saline Tween-20 TEMED ..................................................................................... tetramethylethylenediamine Tyk2 ......................................................................................................... Tyrosine Kinase 2 VHS...................................................................................... Viral Hemorrhagic Septicemia VHSv........................................................................... Viral Hemorrhagic Septicemia virus VSV.............................................................................................. Vesicular Stomatitis virus xiv Chapter 1 Introduction 1.1 General introduction As the global human population continues to grow exponentially, demand for food has become a significant societal problem. Demand for seafood is increasingly being met through expansion in the number of aquaculture facilities and fisheries worldwide. However, with the increase of these facilities and global trading of fish there is also an increased risk of introducing aquatic pathogens to new regions, thereby posing a serious threat to an important food source (Peeler & Taylor, 2011). One such pathogen, Viral Hemorrhagic Septicemia virus (VHSv), has rapidly spread throughout the northern hemisphere in the last 50 years (Bain et al., 2010; Jonstrup et al., 2009). In an attempt to limit the spread of VHSv it has been listed as a reportable disease by the World Organization for Animal Health (OIE). VHSv has now been identified in the Great Lakes where it is an emerging threat to the region (VHSv Expert Panel, 2010). 1 1.2 Viral Hemorrhagic Septicemia 1.2.1 VHS etiology and history Viral hemorrhagic septicemia (VHS), also known as Egtved disease, was initially identified in rainbow trout (Salmo gairdnerri) in 1938 (Schäperclaus, 1938), re-emerging in Denmark in the early 1950s (Jensen, 1965; Schäperclaus, 1938). From that point, VHS spread rapidly throughout European fisheries, resulting in significant losses to regional industries (Smail, 1999; Wolf, 1988). The disease initially is characterized by its visible symptoms including: lack of appetite, abnormal behavior, hemorrhaging of gills and internal organs, discoloration, and disassociation from other fish (Rasmussen, 1965). Subsequent research on fish afflicted with VHS concluded that symptoms and susceptibility to the disease were significantly dependent on the species and environmental temperatures (Hawley & Garver, 2008; R. Kim & Faisal, 2010). The species most severely impacted in Europe were within the family Salmonidae (Ghittino, 1965; Jorgensen, 1982). However, over 70 species have been identified with VHSv infection, representing both salmonoid and non-salmonoid species (Brudeseth & Evensen, 2002; Jonstrup et al., 2009; W. Kim et al., 2009; T. R. Meyers, Short, & Lipson, 1999; Skall, Olesen, & Mellergaard, 2005). The disease is most prevalent during the fall and spring spawning season when water temperatures range from 9-12°C (Winton & Einer-Jensen, 2002). Inoculation of healthy naïve fish with bacteria- and fungus-free filtrate from diseased fish resulted in transfer of the disease, strongly implicating viral pathogenesis for VHS (Jensen, 1965; Schäperclaus, 1938). Transmission of the virus between fish occurs mainly via contact with mucus excretions, urine and semen from infected fish. 2 Therefore, proximity of fish increases transmission rate of the disease, contributing to its spread during spawning seasons and increasing its risk in aquaculture where fish are typically grown in a large population to tank size ratio (Winton & Einer-Jensen, 2002). Once infected, some fish remain asymptomatic for the disease but are carriers of the virus, making it difficult to track and/or control VHSv distribution in the wild (Hershberger et al., 2010; R. K. Kim & Faisal, 2010). 1.3 Viral hemorrhagic septicemia virus 1.3.1 Nomenclature and classification VHSv was first isolated in 1962 from infected rainbow trout raised in a fishery in Denmark (Einer-Jensen, 2004). Despite its rapid spread across Europe, it was not identified on other continents until 1988 when it was isolated from Atlantic salmon on the west coast of the United States (Brunson, True, & Yancey, 1989; Hopper, 1989). Since then, VHSv has been found throughout the Northern Hemisphere, including the Great Lakes region (Elsayed et al., 2006; Studer & Janies, 2011). Geographic location and genomic sequence similarities have been utilized to classify VHSv into four primary strains, I-IV (Fig. 1). Subsequent genetic differences found among new isolates of these strains have been used to classify variants into individual substrains (signified by lower case letters following the strain number). Strains I-III are endemic to Europe with type I being the most diverse, infecting both marine and freshwater fishes (Benmansour et al., 1997; Thiéry et al., 2002). With the exception of KRRV-9602 (type Ib) that was isolated 3 in Japan, the European strains have not been identified elsewhere (Nishizawa et al., 2002). The type IV strain is separated into two substrains. Type IVa was isolated in Japan and the western coast of the United States (T. Meyers & Winton, 1995; Nishizawa et al., 2002). The most recent emergence of VHSv is the IVb substrain, identified in the Great Lakes region in 2003 (Ammayappan & Vakharia, 2009; R. Kim & Faisal, 2010). This new substrain is highly virulent and has become endemic to the region, posing a significant risk to the sports fishing and aquaculture industries (Bain et al., 2010). 4 Figure 1: Distribution of VHSv strains in the Northern Hemisphere. Circles represent general areas where infections have been found for the individual strains. VHSv genotypes I, II, and III are found primarily in Europe although strain III was found in Japan. Type IVa is found in Japan and northwestern North America. Type IVb is endemic to the Great Lakes region in North America. 5 1.3.2 VHSv structure and replication Viral genome sequence information and electron microscopy led to classification of VHSv as a member of the Rhabdoviridae family of negative sense, single-stranded RNA viruses. Consistent with other rhabdoviruses, the VHSv genome encodes for five structural proteins including the nucleoprotein (N), phosphoprotein (P), matrix (M) protein, glycoprotein (G), and polymerase (L) protein (Fig. 2) (McAllister & Wagner, 1975; Tze, Mundt, & Mettenleiter, 1999). The virus also encodes for a non-virion (NV) protein identified only in fish rhabdoviruses, thereby further classifying VHSv to the genus Novirhabdovirus (Schütze et al., 1996). While VHSv replication is poorly characterized, it is likely similar to other rhabdoviruses. For these viruses to propagate, they must first gain access to host cellular machinery by entering a cell (Cureton et al., 2009). The glycoprotein binds to a surface receptor (potentially phosphotidyl serine) allowing viral endocytosis into the cell (Plemper, 2011). Cellular lysosomes fuse with the endosome thereby reducing the pH within the vesicle and triggering fusion between the glycoprotein and the vesicle membrane resulting in the release of the core nucleocaspid into the cytoplasm (Colman & Lawrence, 2003). Once the N protein disassociates from the negative sense genomic RNA, positive sense mRNA transcripts can be encoded by a viral RNA-directed RNA polymerase encoded by the L gene (Howard, 1989). The L protein, upon activation by the P protein and host factors, binds to the leader segment of the virus and begins transcription. Due to polymerase slippage following the polyadenylation signal and the inter segment regions 6 between coding regions on the viral genome, the polymerase is sometimes unable to proceed from one gene to the next (Ivanov et al., 2011). This results in a gradient in which 3’ most genes are transcribed at a higher copy number than those at the 5’ end. This gradient has a significant effect on the budding of new viral virions (Assenberg et al., 2010). Later in the replication cycle, the L protein switches from mRNA synthesis to replicating full length positive sense copies of the viral genome from which new negative stranded genomes are synthesized. Once a sufficient quantity of the N protein is processed to coat the viral genome, further transcription is halted (Ivanov et al., 2011). Thus, the virus creates a feedback loop to regulate the amount of virions produced versus the amount of transcription (Fig. 3). The glycoprotein (G protein) is produced in the endoplasmic reticulum and packaged as transmembrane proteins in vesicles for transport to the cell surface. Once these vesicles fuse to the cell surface, the M protein interacts with the inner portion of the G protein (Colman & Lawrence, 2003). This provides the initial scaffolding for the viral budding. As N protein associates with the viral RNA it also binds to M creating a zippering effect. This forms a bullet shaped virion with a ribonuclear core (H R Jayakar, Jeetendra, & Whitt, 2004). Lastly, host cellular factors recruited by M during the budding process are thought to mediate viral release from the cellular membrane (Fig. 3) (H R Jayakar, Murti, & Whitt, 2000). 7 Figure 2: Genome and virion structure for VHSv. VHSv is a bullet shaped rhabdovirus containing a negative sense single stranded RNA genome that encodes for 6 transcripts. G (green) is a transmembrane protein that forms “spike-like” projections on the viral surface allowing it to interact with cell receptors and fuse with cell membranes as well as interacting with the internal M protein (yellow). The N protein (red) interacts with the M protein and the RNA. This provides a helix-like packing for the viral RNA and helps to form the shape of the structure. Furthermore, the L protein (cyan) and P protein (blue) are associated with the N protein in the middle of the core. The NV protein (orange) is not present in the viral structure. 8 Figure 3: Rhabdovirus Replication Cycle: Once gaining entry to the cell (step 1) the virus requires host mechanics to replicate. The virus interacts with cell surface receptors and is endocytosed into the cell (step 2). Lysososomes fuse to the endosome carrying the virus, initiating acidification of the vesicle (step 3). This triggers a conformational change in the viral glycoprotein allowing it to fuse with the membrane and escape into the cytoplasm (step 4). The negative sense single stranded RNA genome is transcribed directly into mRNA, however due to slippage during polyadenylation, the polymerase protein sometimes falls off and has to re-initiate leading to a gradient where 5’ mRNA is expressed greater than 3’ (steps 5 and 6). The viral mRNA is translated using host machinery (step 7). When enough nucleoprotein is translated, it binds to the viral 9 genome causing the polymerase protein to switch from transcription to replication (steps 8a and 9a). The glycoprotein is shuttled to the cell surface in cellular endosome (step 8b) and the matrix protein interacts with its inner half (step 9b). The viral genome is organized into a coil by the interaction between the matrix protein and the nucleoprotein (step 10). Lastly, the virus is released from the cell into the extracellular space. 10 1.4 Host innate immune system 1.4.1 Innate immune response to viral infection To combat viral infections eukaryotes have evolved complex innate immune response networks. Integral to detecting viral infections are pattern recognition receptors (PRRs) that include the cytoplasmic viral detection receptors retinoic acid inducible gene I (RIG-I) and melanoma differentiation-associated gene-5 (MDA5), commonly referred to together as “RIG-I-like helicases (RLHs)” (Kato et al., 2006). RLHs contain helicase domains that are capable of “sensing” viral pathogen-associated molecular patterns (PAMPs), particularly dsRNA and uncapped ssRNA. The interaction causes a conformational change in the RLH exposing a Caspase Activation and Recruitment Domain (CARD) allowing it to signal to the downstream adaptor protein, Mitochondrial AntiViral-Signaling (MAVS) protein (also known as VISA/IPS-1/Cardiff) (Loo & Gale, 2011). The cascade activates transcription factors including Interferon-Regulatory Factors (IRFs) resulting in transcriptional activation of responsive genes, type I IFNs in particular (Fig. 2) (Marié, Durbin, & Levy, 1998; Taniguchi et al., 2001). This “first phase” of the innate immune response occurs primarily in infected cells, and many of the above signaling components have been identified in, and/or cloned, in fish as well as humans, mice and other organisms. For example, a putative precursor to the RLH genes has been cloned from Japanese flounder and a MAVS/IPS-1ortholog has been cloned from several fish species (Chang et al., 2011; Simora et al., 2010). Over expression of these proteins in cultured cells results in a decreased viral titer following infection, 11 suggesting that the antiviral roles they play in mammals originated in earlier vertebrates, such as fishes (Biacchesi et al., 2009; Stein et al., 2007). As mentioned, up-regulation of cytokines, IFNs in particular, is a critical aspect of the cellular innate immune signaling pathways. In mammals three distinct families of IFN have been identified, designated type I (IFN-α, -β, -ω, -τ, -δ, -ε etc), II (IFNγ) and III (IFNλ) IFNs (Borden et al., 2007). Type I and III IFNs have similar antiviral functions in humans and mice but have differing gene structures; type I IFNs are encoded from intronless genes, while IFNλ has introns (Fox, Sheppard, & O’Hara, 2009; Krause & Pestka, 2005). Interestingly, the two putative primordial type I IFNs that have been identified in fishes exhibit intron/exon structures most similar to IFNλ, but share higher overall coding sequence similarity with type I IFNs (Zou et al., 2007). True IFNλ orthologs have not been identified in fish, suggesting that these IFNs may have later evolved in mammals (Fox et al., 2009; Robertsen, 2006). Once type I IFNs are transcribed and translated, their protein products are processed and secreted from the cell into the surrounding tissues and to circulation. IFNs bind to high affinity cell surface receptors on neighboring or distal cells and activate JAK1 and TYK2 tyrosine kinases leading to the phosphorylation of STAT1 and STAT2. STAT1 and STAT2 dimerize and then complex with IRF9 to form the multimeric transcription factor complex IFNstimulated gene factor 3 (ISGF3). After translocation to the nucleus, ISGF3 transcriptionally upregulates hundreds of IFN-stimulated genes (ISGs) (Li et al., 1998). The protein products of these genes work in concert to induce physiological changes that lead to an antiviral state for the cell (Horvath & Darnell, 1996). As with the components of the virus detection pathway, components of the “second phase” of the innate immune 12 response (Fig. 2), including IFN receptors, JAKs, STATs, IRFs and many ISGs have been observed and cloned from multiple fish species (Hegedus et al., 2009; Sun et al., 2010; Yu et al., 2010). One well characterized ISG, the mx1 gene, has been identified in fish and is potently upregulated in response to virus (Tafalla et al., 2008). Taken together, the presence and activity of the main components of the innate immune antiviral response pathways suggest it has been conserved throughout vertebrate evolution and is functional in fish. 13 “Phase 1” “Phase 2” Figure 4: Type I IFN response to viral pathogens. Viral transcripts in the cytoplasm following viral endocytosis can be recognized by Rig-I like receptor (RLR) helicase domains. Binding of viral RNA products cause the receptors to unfold and expose a Caspase Activation and Recruitment domain (CARD). This allows the RLRs to interact with MAVS which in turn activates a signaling cascade leading to the phosphorylation of IRF3. Phosphorylated IRF3 dimerizes and translocates to the nucleus where it binds to the promoter of interferon genes and activates their transcription. Once IFNs are processed they are secreted from the cell and can subsequently bind to near or more distal cells via the type I IFN receptor (IFNAR). Activation of the IFN receptor complex leads to autophosphorylation of JAK1 and TYK2 followed by their phosphorylation of STAT1 14 and STAT2. Phosphorylated STAT1 and STAT2 dimerize and then complex with IRF9 to form a complex known as ISGF3. This transcription factor complex is capable of activating hundreds of genes that mediate establishment of an antiviral state. 15 1.5 Viral evasion of the innate immune system 1.5.1 Viral mechanisms to evade the innate immune system For viruses to survive and propagate they must somehow mitigate or evade the host innate immune response (Rieder, 2009). In some cases they have simply evolved mechanisms to replicate rapidly enough to outpace the innate response, or to mask their PAMPs to avoid detection (Liu & Gale, 2010; Warfield et al., 2004). However, most have developed means of perturbing signaling within either the PAMP detection (PRR) signaling cascades, or the IFN response pathways (Bowie & Unterholzner, 2008). In particular, latent viruses such as Hepatitis C virus (HCV) inhibit multiple steps in the RIG-I signaling pathway in order to prevent IFN production that would otherwise help to clear the infection. However, HCV also blocks IFN signaling by sequestering STATs and upregulating phosphatases and other proteins (SOCS) that suppress or prevent STAT activation (Breiman et al., 2005). Mechanisms such as these are common among most viruses studied, including Rhabdoviruses (Rieder, 2009). For example, Rabies Virus (RV) P protein has been proposed to hinder both IFN production and ISG activation. RV P prevents IRF3 phosphorylation, thus preventing IRF3 dimerization and translocation to the nucleus. While this inhibits type I IFN transcription, it is insufficient to completely block production of IFN (Brzozka, Finke, & Conzelmann, 2006). Therefore, RV P also inhibits JAK-STAT mediated signaling following IFN receptor interaction by binding to phospho-STAT1 and preventing the ISGF3 complex from entering the nucleus and activating ISGs (Brzozka, Finke, & Conzelmann, 2006). Another Rhabdovirus, vesicular stomatitis virus (VSV), relies instead on the actions of its matrix (M) protein, which shuts down host cell gene expression and induces cellular apoptosis (Kopecky & Lyles, 2003; 16 Waibler et al., 2007). Although the mechanism is not yet completely elucidated, VSV M has been implicated in inhibiting nuclear export of mRNA's by interacting with the nucleoprotein nup98 and the export factor Rae1. This process efficiently stops production of either IFNs or ISGs, but does so at a cost - the VSV M protein also initiates apoptosis in infected cells (Faria et al., 2005). Thus, unlike HCV or RV that remain present in the infected host for extended periods of time, VSV must replicate quickly to circumvent the apoptotic cell death initiated upon its infection. 1.5.2: VHSv evasion of fish innate immune response The continued propagation, virulence, and lethality of VHSv suggest that it has developed at least one mechanism to evade the innate immune response in fishes. We hope to elucidate the mechanisms and proteins responsible for dodging these vital pathways. Furthermore, in these investigations we would like to gain a better understanding of how the fish innate immune system works and how it is similar to those previously studied in mammals. 17 Chapter 2 Materials and Methods: 2.1 Cell lines and culture conditions Epithelionma papulosum cyprini (EPC) cells were purchased from the American Type Culture Collection (ATCC) (Rockville, MD). The cells were grown in minimum essential medium (MEM) (Fisher) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 22º C in a 5% CO2 enriched environment. Typically, cells were passaged 1:3 using trypsin-EDTA to disperse cells from culture plates. Cells were regularly checked for mycloplasma infection by staining with DAPI (Fisher) and observing under the epi-fluorescent microscope (Olympus IX81) at 40x. 2.2 Plasmids The expression vectors for EPC MAVs and EPC IFN were kindly provided by Dr. Michel Brémont (French National Institute for Agricultural Research [INRA], Jouy-enJosas Cedex, France). The IFITM-1-luciferase and human IFN-luciferase constructs and CMV-lacZ, and CMV-GFP expression vectors previously were cloned in our lab. Plasmids expressing the VHSv coding sequence are described in detail in the cloning section of the Materials and Methods. 18 2.3 VHSv stocks and infection Stocks of the VHSv IVb strain initially were obtained from Dr. James Winton (USGS, Seattle, WA.). The virus was propagated by infecting a monolayer of EPC cells in serum free media at a low MOI for an h and then incubating them at 22º C in complete media containing 10% serum until complete cytopathicity was reached (typically 4872h). Media was collected and dead cells and debris were cleared by centrifugation. Stocks were serially diluted 1:3 on a 96 well plate of confluent EPC cells to determine relative viral concentration. 2.4 Cloning and PCR Primers used to clone VHS IVb genes were designed from the full-length genomic sequence of the MI03GL isolate (GQ385941). The primers used to clone the VHSv genes are listed in table 1 along with annealing temperatures and extension times. EPC cells were infected with VHSv for no more than two days and were then collected in TRIzol. RNA was isolated using TRIzol per manufacturer’s protocol (Invitrogen, San Diego, CA). Two µg of the RNA was reverse transcribed using M-MLV RT (Promega) as previously described (Sambrook, Fritsch, & Maniatis, 1989). Briefly, two µg of RNA was mixed with 100ng of random hexamer primers and the volume was taken to 7 µl with water. The solution was incubated at 70°C for 5 min. The tube was briefly cooled before adding the M-MLV-RT mixture (5µl M-MLV 5x Reaction Buffer, 5ul dNTPs (Invitrogen), Recombinant RNasin Ribonuclease Inhibitor (Invitrogen), M-MLV RT (Promega), and water to 25µl). The samples were mixed gently and then incubated at 42°C for 1 h. PCR was completed with the primer sets, annealing temperatures and 19 elongation times found in Tables 1 and 2. All PCR programs began with a 5 min denaturation step at 95°C. Each cycle included a 30 second 95°C denaturation step, an annealing step with temperature dependent on the primers used, and a 72°C extension/elongation step with time dependent on the size of template and final product. While VHSvM, NV, G, and N required only one set of primers, VHSvP was cloned by first obtaining a larger section of the virus, sequencing it, then preparing appropriate primers to subclone the coding sequence into pcDNA3.1(-)-myc/his A. All fragments were cloned into pcDNA 3.1 (-) myc/his A (Invitrogen), pGEM-t easy (Promega), or p3xFLAG-CMV-14 (Sigma). EPC MX1 primers were designed previously (M. S. Kim & Kim, 2011). The mRNA seuquence used to design the luciferase primers was found on genbank (U47295). 20 21 VHSvNnew_EcoRI.se CAGAATTCATGGAAGGAGGAATC VHSvNnew_KpnI.as GTGGTACCATCAGAGTCCTCG VHSvG.se_EcoRI VHSvG.as_KpnI VHSvN-myc/his VHSvG-myc/his ACGAATTCATGGAATGGAATACTT GTGGTACCGACCATCTGGCT GCTCAATGGGACAGGAATGA CTATCTTGAAGCTTGTGATCAG CAGAATTCATGACTGATATTGAGAT GTGGTACCCTCTAACTTGTCCA NforP.se Mforp.as VHSvP.se VHSvP.as VHSvP-myc/his CTGAATTCATGGCTCTTTCAAAAG TATCTAGACCGGGGTCGGAC ACGAATTCATGGCTCTATTCAAAAG ACGGTACCCCGGGGTCGGACAGAG Sequence (5'-3') ACGAATTCATGACGACCCAGTCGGCAC ACGGTACCTGGGGGAGATTCGGAGCCA Mflag.se_EcoRI Mflag.as_Xbai VHSvM.se VHSvM.as Primer Name VHSvNV-myc/his VHSvNV.se VHSvNV.as VHSvM-flag VHSvM-myc/his Gene Cloned each 25μl PCR reaction. EcoRI KpnI EcoRI KpnI EcoRI KpnI EcoRI KpnI EcoRI XbaI EcoRI KpnI 53 54 53 52 57 55 55 Restiction Annealing Site Temp (°C) 2:30 2:30 1:30 2:00 1:30 1:30 1:30 Extension Time (Minutes) at a 1µg/µl stock concentration. 0.5µl of a 100ng/µl working dilution was used for each primer in ordered from Invitrogen at 25N scale. Lyophilized primers were resuspended in nuclease-free water annealing temperature and extension times. All primers are listed in 5’ to 3’ orientation and were Table 1: Cloning Primers. The primers used to clone VHSv genes are listed together with their 22 Luciferase.se Lucuferase.as EPC_MX1.se EPC_MX1.as MX1 Primer Name Luciferase Target ATTACCTGGTTGTGGTGCCATGC TACCACTGTCCCTTCAGTGCCTTT TCAAAGAGGCGAACTGTGTG GGTGTTGAGCAAGATGGAT Sequence (5' - 3') (U47295). EPC MX1 primers were previously designed. 52 52 Annealing Temp (°C) 30 30 Extension Time (Minutes) expression of genes. Luciferase primers were designed from a sequence hosted on genbank Table 2: Expression Primers. These primers are used in RT-PCR to measure the general 2.5 Transfection Transfections were performed using Polyjet reagent (Signagen) according to the manufacturer’s instructions. Tranfections were performed in SF MEM, which was changed to complete medium 3h after transfection. Plasmid amounts were as specified in presented figures (Figs 6B, 9, 10). 2.6 Confocal microscopy and immunofluorescence Cells were plated on glass cover slips treated with poly-L lysine and transiently transfected the next day at a density ~10%. The following day the media was removed and the cells were rinsed with PBS. The cells were fixed with 4% paraformaldehyde for 15 min at room temperature and washed 3 times with PBS for 5 min to ensure the complete removal of the fixing agent. The fixed cells were blocked for 1 h at room temperature (1x PBS, 5% normal goat serum, and .3% Triton X-100). While blocking, fresh antibody dilution buffer was prepared (1x PBS, 1% BSA, .3% triton X-100) and the primary antibody was added. The blocking solution was aspirated and the primary antibody solution was added. Cells were incubated overnight at 4°C. The next day the cells were rinsed in PBS 3 times for 5 min. The antibody dilution buffer containing the secondary antibody conjugated with FITC was added to the cells. The cells were allowed to incubate 1.5 h at room temperature in the dark. The coverslips were removed from the plate and mounted to slides with mounting media (glycerol and 1% PPD), sealed with nail polish and stored at 4 C. Prepared slides were imaged with a confocal microscope (Olympus IX81) at 100X the same or the following day. 23 2.7 Subcellular fractionation Three 10cm plates were transfected with VHSvM-myc/his expression plasmid then fractionated into nuclear, cytoplasmic, mitochondrial and nuclear membrane extracts. The following day, cells were scraped from the plate and resuspended in 5 volumes of mitochondrial isolation buffer (220 mM mannitol, 68 mM sucrose, 10 mM HEPES pH 7.4, 10 mM KCl, 1 mM EGTA, 1 mM EDTA, 1 mM MgCl2). Cells were incubated for 5 min on ice and then dounce homogenized. Homogenate was centrifuged for 10 min at 1000g. The supernatant was further centrifuged for 10 min at 10,000g yielding a mitochondrial pellet and cytoplasmic fraction (supernatant). The pellet was resuspended with RIPA lysis buffer (150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris pH 8.0, 1 mM PMS) and incubated on ice for 15 min. Finally, the lysate was centrifuged at 10,000g for 10 min to yield the nucleoplasm and nuclear membrane extracts. Both final pellet fractions were washed three times with the buffer used in the previous step. Lysates were run on a 15% SDS-Page gel and transferred to PVDF. VHSvM-myc/his was detected with 1:1000 Myc antibody (Cell signaling). Details on the immunoblotting procedure can be found in the Materials and Methods. 2.8 Luciferase assays/β-gal assays EPC cells were transfected at 70% confluency with a luciferase promoter construct, a CMV-LacZ expression vector, and VHSv protein expression vectors. The assay was performed 24-48 h following the transfection. Media was removed and cells detached from the plate with Versene (1% EDTA in PBS), scraped, and then washed with 24 PBS. The cells were carefully pelleted then lysed with 115µl Reporter Lysis 5x Buffer (Promega) for 5 min on ice. Samples were subsequently centrifuged at 12,000g for 10 min to clear the lysate. 50µl of each sample was added to a well on a clear 96 well plate along with 50 µl of the β-gal buffer (3.2µl β-mercaptoethanol, 200µl ortho-Nitrophenylβ-galactoside (ONPG), and 1ml of β-gal buffer [8.5g Na₂HPO₄, 4.75g NaH₂PO₄, 10ml 1M KCl, and .246g MgSO₄; Q.S. to 1L]). The mixture was incubated in a clear plate at 37°C until samples became light yellow. The absorbance was read at 414nm on a SpectraMax plate reader. The second half of the cellular lysate was placed into an opaque white plate. ATP (2.5ml ATP buffer, 25µl DTT and 50µl 100mM ATP) and luciferin (500µl luciferin, 250µl Glycyl-glycine, 25µl DTT and 1.75ml water) solutions were made separately and then mixed quickly before adding 50µl to each sample in a white 96 well plate. The plate was read rapidly (100ms integration period) for luminescence on a SpectraMax plate reader. When possible, the luciferase values were normalized to the corresponding values from the β-gal assay. To do this, the luciferase values were divided by their respective β-gal absorbances. To obtain a fold induction relative to the negative control, the values were individual normalized (divivided) by the value for the negative control. 2.9 Immunoblotting Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was used to detect protein expression of cloned VHSv proteins tagged with a myc or flag epitopes. Either 15% (2.5ml 4x buffer, 3.75ml 40% acrylamide, 0.1ml 10% APS, 0.01ml TEMED, 3.64ml H₂O) or 12.5% (2.5ml 4x buffer, 3.125ml 40% acrylamide, 0.1ml 10% 25 APS, 0.01ml TEMED, 4.265ml H₂O) separating gels were prepared. In both cases, the separating gel was topped with a 4% stacking gel (1.25ml 4x buffer, 0.625ml 40% acrylamide, 0.05ml 10% APS, 0.005ml TEMED, 3.07ml H₂O). Lysates were loaded with 4x SDS buffer including bromophenol blue dye. Gels were run at a constant 20 volts in running buffer (25 mM Tris base, 192 mM glycine, and 6.94 mM SDS). Proteins were transferred to Immobilon-P Polyvinylidene Fluoride (PVDF) membrane using a Bio-Rad Trans-Blot SD Semi-Dry Electrophoretic Transfer Cell after being soaked in transfer buffer (25 mM Tris base, 192 mM glycine and 20% methanol) 35-40 min at constant 20 volts. Blots were blocked in 5% non-fat milk (Kroger’s instant non-fat dry milk) in TBST for 1 h/ and incubated in primary antibody (diluted in 1% BSA in TBST) overnight at 4°C. The next day, membranes were washed 3 times in TBST and then incubated with secondary antibody conjugated with HRP in 5% non-fat milk in TBST for one h. Blots were washed in TBST three more times before adding Enhanced Chemilumenscence reagent as described by the manufacturer (Pierce). The blots were developed using a Kodak Image Station 4000R pro for 5-10 min. 2.10 AnnexinV staining An Annexin V-FITC Fluorescence Microscopy kit (BD Pharmingen) was used to stain transfected or untransfected cells following the manufacturer’s directions. Briefly, cells were washed twice with PBS and then once more with Annexin V Binding buffer. Cells were stained with Annexin V-FITC solution diluted 1:10 in the binding buffer for 15 min at room temperature. Cells were washed again with 1x binding buffer and then 26 counterstained with DAPI. Cells were observed at 200x under phase contrast, DAPI, and FITC filters on an Olympus IX81 microscope. 2.11 Real-time PCR Quantitative real-time PCR was performed with the SsoFast Evagreen Supermix master mix (Biorad). The mastermix was diluted from 2x to 1x in each 20µl reaction. Each reaction consisted of 1µl cDNA, 10µl SsoFast Supermix, 50ng sense primer, 50ng antisense primer, and 8µl of nuclease free water. Samples were loaded into a clear 96 well PCR plate (Biorad) and placed into an Eppendorf Mastercycler® ep Realplex Thermal Cycler. After an initial 5 min denaturation step at 95°C, 40 cycles of 30 seconds at 95°C and 60 seconds at 62°C were carried out. The thermocycler was set to read fluorescence at the end of each 62°C step (the end of the elongation phase). Samples were normalized to the fish β-actin housekeeping gene. 2.12 Viral-protection assay/IFN-production assay To quantify IFN activity is in media following treatment or infection, conditioned media was collected and serially diluted on confluent EPC cells on a 96 well plate. Serving as controls, the top and bottom rows were left untreated with media. Twentyfour to forty-eight h following the dilution, the 96 well plate was infected with VHSv IVb (MOI = 1) with the exception of the bottom row as a negative control. Cells were monitored until the cells that were both untreated and infected showed complete cytopathicity. Cells were washed with PBS, fixed with methanol, and then stained with 27 crystal violet. Results were interpreted by identifying the 50% killing point (IC50) for each condition. 28 Chapter 3 Results 3.1 VHSv inhibits the innate immune response 3.1.1 VHSv inhibits interferon activity As previously presented, activation of the IFN receptor leads to the expression of hundreds of ISGs that work in concert to induce an anti-viral state in cells. Therefore, pre-treating cells prior to infection should subsequently protect them from the virus. Furthermore, if a virus is incapable of inhibiting the innate response, one would expect treatment following infection to also suppress viral replication and inhibit cytopathic effect (CPE). To determine if VHSv could inhibit protection conferred by treatment with fish interferon (fIFN), we performed a time-course experiment in which Epithelioma Papulosum Cyprini (EPC) fish cells were left uninfected or were infected pre- or posttreatment with fIFN (Fig. 5A). As expected, fIFN treatment 24 h prior to infection completely protected the cells from viral CPE. However, cells treated with the same dose of IFN 16 or 24 h post virus infection (but prior to any signs of CPE) were not protected (Fig. 5A). These results suggested that a factor or factors introduced by VHSv infection 29 inhibited IFN’s ability to establish an antiviral state. To determine if VHSv had any direct impact on IFN signaling, we transiently transfected a luciferase construct driven by the IFITM1 ISG promoter into EPC cells and left the cells uninfected or infected them for 24 or 48 h (Fig. 5B). The cells then were treated with IFN 6 h prior to preparation of the cell lysates and luciferase assay. Treatment with IFN following viral infection resulted in lower IFITM1 promoter activity as compared to IFN treatment alone (Fig. 1B). Taken together, these data provide strong evidence for the existence of at least one VHSv factor capable of inhibiting downstream signaling by interferon. 30 B 31 Figure 5 – VHSv inhibits IFN activity. A) EPC cells were treated with IFN pre- or post-VHSv infection as indicated. Cells were imaged under phase contrast microscopy (40x) 72 h post-infection. B) EPC cells were transfected with an IFITM1/luc construct and β-galactosidase (-gal) expression vectors. The next day they were infected with VHSv for 24 or 48 h or left uninfected. The indicated samples were treated with IFN for 6 h, after which cells were lysed in 5x reporter lysis buffer (Promega). Lysates were split equally and used for a luciferase and -gal assays. Samples were normalized to the -gal control and values expressed as a fold expression relative to untreated controls. 32 3.1.2 Individual VHSv proteins modulate innate immune responses To identify the individual factors responsible for blocking innate immune responses, we cloned individual VHSv genes into expression vectors. These constructs were transfected alone or with fish MAVS (fMAVs) into EPC cells. Overexpression of MAVS activated the downstream signaling pathway leading to the up-regulation of type I IFNs. Therefore, the relative amount of IFN present in the media was indicative of the activation of this pathway. Media from the transfected cells was harvested and serially diluted on a 96 well plate containing naïve EPC cells. After 24 h, treated cells were infected with VHSv (MOI = 1). After three days the cells were fixed and stained (Fig. 6A). In wells containing the media from cells transfected only with MAVS there was significant protection, thus verifying IFN production. When combined with MAVs, the viral genes P and M inhibited MAVs induced viral protection. Although N and G displayed some effect in this replicate, the observed inhibition was not consistent with results from other experiments (data not shown). In contrast, transiently expressing the nv gene moderately enhanced the activation of the pathway. These data were supported by assaying the transcriptional activation of the IFITM1 ISG promoter (Fig. 6B). The expression vectors for the viral genes were transfected along with the IFITM1-luciferase construct, with or without MAVS co-transfection. The production of luciferase from the IFITM1 promoter was assayed by measuring cellular luciferase levels 24 h later. As above, P showed some degree of inhibition, while M showed complete inhibition of MAVS-induce ISG expression. Furthermore, this experiment also indicated both NV augmentation of MAVS activity and induction of luciferase activity when expressed 33 alone. These data suggest that VHSv produces products that are capable of augmenting the innate immune response. 34 1:3 35 Figure 6: VHSv gene products modulate IFN responses. A) Media harvested from cells previously transfected with MAVS alone or MAVS plus Myc-tagged M, P, NV, N or G was titered in 1:3 dilutions onto naïve EPC cells grown on a 96-well plate. After 48 h the cells were infected with VHSv (excluding the bottom row). The cells were fixed in methanol and stained with crystal violet 72 h post infection. Transfected cells were also analyzed by immunoblot analysis for viral protein expression, by using anti-Myc antibody (note that M protein expression was low due to cellular apoptosis at that time point). B) EPC cells were transfected with 0.3μg of an IFITM1\luc promoter construct and 0.3 μg of a CMV-LacZ(β-gal) expression vector along with 0.2μg of the indicated construct with or without MAVS (0.3μg). The cells were harvested 48 h after transfection and Luciferase and β-gal assays were performed. The graph represents the fold induction of β-gal correct luminescence values relative to the negative control (± standard deviation). 36 3.2 The VHSv Matrix protein 3.2.1 VHSv Matrix (M) protein induces apoptosis The potent effect of the M protein on innate immune signaling prompted additional studies on its potential actions. To assess the impact of the VHSv M protein on cell viability, EPC cells were transiently transfected with M expression vectors. During these experiments we observed morphological changes characteristic of apoptosis, such as EPC cell rounding and nuclear blebbing 48 h following transfection, and complete cell death after 72 h (Fig. 7, Phase Contrast). To determine if the death was due to an apoptotic response to VHSv M protein, cells were stained with Annexin-V FITC and DAPI. Cells infected with VHSv for 72 h and those transiently transfected with M for 48 h stained positive for Annexin-V, while the uninfected controls and cells transfected with an empty vector remained unstained (Fig. 7, Annexin-V). Furthermore, the cells transfected with M or infected with VHSv also exhibited other hallmarks of apoptosis, including nuclear condensation (Fig. 7, DAPI staining). These data taken together suggest that the M protein is capable of inducing apoptosis when expressed in isolation, and that this cellular apoptotic response was morphologically similar to that of cells infected by VHSv. 37 38 Annexin VFITC DAPI Phase Contrast Control VHSv (1:50) pcDNA 3.1 (-) VHSv M Figure 7: VHSv M induces apoptosis. EPC cells were either left untreated or infected for 72 h, or were transiently transfected with an empty vector (pcDNA3.1) or an M (0.3μg) expression vector as indicated and cultured for 48 h. Cells then were stained with AnnexinV-FITC and DAPI and imaged on a fluorescent microscope. Phase contrast pictures were taken to illustrate changes in morphology and cell density. 39 3.2.2 M Localizes to the Nuclear Membrane and Cytoplasm. To help elucidate a potential mechanism for the anti-cellular action of the M protein, we first sought to determine its specific location within the cell. Initial fractionation studies employing specific lysis buffers and centrifugation separated cells into nuclear membrane, soluble nuclear, mitochondrial and cytoplasmic fractions. The presence of the M protein in the specific compartments was assessed using Western blot analysis. The fractionation studies indicated that the M protein localized to the nuclear membrane and to the cytoplasm. To confirm our initial observations, we used immunofluorescence and confocal microscopy. After fixation, cells previously transfected with an M-flag fusion vector were permeabilized and incubated with a flag antibody to detect the M protein. The primary antibody subsequently was detected by incubation with a FITC conjugated secondary antibody. Cells also were counterstained with propidium iodide to stain the nuclei. Consistent with the above fractionation results, confocal microscopy suggested that the M protein associated with the nucleus, but also was found in the cytoplasm. 40 A NM = Nuclear Membrane SN = Soluble Nuclear M = Mitochondria C = Cytoplasm NM SN M B 100x Confocal Primary = Flag Secondary = Goat anti rabbit-FITC Counterstained with PI 41 C Figure 8: M Localizes to the Nucleus and Cytoplasm. A) Cells transiently transfected with VHSvM-myc/his were fractionated into nuclear membrane, soluble nuclear, mitochondrial and cytoplasmic fractions using differential centrifugation and various lysis buffers (listed in Materials and Methods section). Western blot analysis of the fractions was conducted using an anti-Myc antibody. B) EPC cells were transfected with VHSvM-Flag and fixed after 24 h. Fixed/permeabilized cells were incubated with an anti-Flag primary antibody and then a Goat-anti-Rabbit secondary antibody conjugated with FITC. Cells were counterstained with propidium iodide and viewed using a confocal microscope with a 100X objective. 42 3.2.3 M Inhibits the Production of Functional Proteins As discussed previously, the VHSv M protein potently inhibited luciferase production by the IFITM1 ISG promoter in response to MAVs overexpression (Fig. 5B). To further refine the site of the M protein’s effect on the IFN response, we directly stimulated the cells with IFN to assess its impact on the IFN response pathway. Similar to its effect on MAVS responses, M potently decreased IFN-induced luciferase expression from the IFITM1 promoter in a dose-dependent manner (Fig. 9A). Interestingly, we also observed a significant decrease in the expression of our β-gal transfection control in the above experiments when M was co-expressed (data not shown). This suggested that the transcriptional inhibitory effect associated with M expression may be more global. To assess whether M was involved in general transcriptional or translational machinery inhibition, we co-transfected the M protein with a constituently active SV40 promoter luciferase construct. As in the IFITM1/luc experiments, we observed a marked inhibition of SV40 promoter activity even at the lowest dose of M (Fig. 9B). To verify these results, an unrelated protein, ZNF313-myc his was transiently co-transfected with or without M, and immunoblot analysis of ZNF313 expression was performed after 48 h. ZNF313-myc/his protein expression again was substantially inhibited at the lower doses of M, and completely abolished when that was increased (Fig. 9C). Taken together, these data suggest that M inhibits a step(s) in the cellular transcriptional or translational pathway. 43 To assess M’s impact on transcription, we monitored the amount of luciferase mRNA produced by the SV40 luciferase construct in the presence or absence of M using real-time PCR. Interestingly, the relative amount of luciferase mRNA remained the same regardless of the amount of M expression vector transfected into the cells (Fig. 9D). These initial experiments suggest that the M protein inhibited a post-transcriptional step in the protein expression pathway. 44 45 Figure 9: VHSv M inhibits steps following transcription. A) EPC cells were cotransfected with the IFITM1/luc construct, fish IFN (fIFN) and pcDNA or 0.2-0.6μg M as indicated. After 24h, activity of the luciferase construct was measured as previously described. (± standard deviation) B) EPC cells were co-transfected with a SV40/luc construct and pcDNA or 0.1-0.5μg M for 24 h and luciferase activity measured. Values are expressed as fold induction obtained by dividing raw luminescence by the negative control (± standard deviation). C) EPC cells were transfected with empty pcDNA, VHSv M, or ZNF313 alone, or co-transfected with M and ZNF313 as indicated. Lysates were collected after 24 h and immunoblots probed with anti-Myc and anti-Flag polyclonal antibodies. D) Cells were transfected with the indicated plasmids and RNA was isolated 24 h following transfection. Reverse-transcription coupled real-time PCR was performed using luciferase primers, with actin mRNA serving as a control. It is important to note that actin CT levels were constant and were not affected by the expression of M in this experiment. Error bars represent the mean ± standard deviation. 46 3.3 The VHSv Phosphoprotein 3.3.1 VHSv P inhibits IFN signaling As previously mentioned, our initial experiments suggested that, like M, VHSv P protein also may negatively impact innate immune responses. Although the effect of VHSv P on IFN production was less obvious than M (Fig. 6A), the effect of the P protein on ISG regulation was quite substantial (Fig. 6B), suggesting a possible effect downstream of IFN production. To further investigate the role of P in the IFN pathway, a VHSv P expression plasmid was co-transfected with an IFITM1-luciferase construct and a fish MAVs expression plasmid (Fig. 10A). P co-transfection led to a dose-dependent inhibition of IFITM1-luciferase expression (Fig. 10A). In order to examine the first phase of the IFN pathway, we transfected cells with an IFNβ-luciferase plasmid, MAVs plasmid and increasing amounts of a P expression vector (Fig. 10B). As above, we observed a dose-dependent inhibition of IFNβ-luciferase activation. The second phase of the IFN response was evaluated by transfecting cells with the IFITM1-luciferase construct along with increasing amounts of the P vector followed by treatment IFN (x. 10c). Interestingly, these experiments also resulted in an inhibition of ISG promoter activation, although this inhibition was considerably more potent than what was seen in the first phase. VHSv P thus seems to have a negative impact on both phases of the IFN response. Consequently, the overall inhibitory effect on ISG production was robust. To confirm this observation, we analyzed the effect of VHSv P on fish ISG MX1 mRNA transcription following stimulation by IFN (Fig. 10D). Like our previous results, the presence of P potently suppressed IFN-induced ISG transcription. Taken together, these 47 data suggest that P may negatively impact both phases of the IFN pathways, virus induced IFN and IFN-induced gene expression. However, the cumulative result is reduced ISG activation. In summary we determined two novel functions for the VHSv IVb P protein. We showed here that the transient expression of the P protein in EPC cells is capable of inhibiting the cellular innate immune response. Furthermore, we have shown that the P protein can inhibit both the viral detection pathway and the IFN response pathway. 48 49 Figure 10: VHSv P inhibits IFN signaling. A) EPC cells were transfected with 0.3 μg IFITM1-luciferase reporter plasmid, the indicated amounts of VHSv P expression plasmid and 0.3 μg of a fish MAVs expression plasmid. After 24 h, cell lysates were assessed for luciferase and values normalized to an internal β-gal control (± standard deviation). B) Cells were transfected as in “A”, but with a human IFNβ-luciferase construct instead of the IFITM1-luciferase vector. After 24 h, cell lysates were again assessed for luciferase activity and values normalized to an internal β-gal control (± standard deviation). C) Cells were transfected with IFITM1-luciferase reporter plasmid and the indicated amounts of VHSvP. Six h following the transfection, cells were treated with fIFN as indicated. 24 h following the treatment, lysates were assessed for luciferase activity and values normalized to an internal β-gal control (± standard deviation). D) Cells were transfected with VHSv P expression plasmid as indicated. Specified samples were treated with fIFN 24 h after transfection and RNA isolated 12 h post IFN treatment. MX1 and relative actin levels were assessed for each sample using real-time PCR. The graph is plotted as the inverse of ΔΔCT (ΔΔCT * -1) (± standard deviation). 50 Chapter 4 Discussion Ecological and economic studies have helped to explain how the spread of VHSv can potentially impact important food and tourism industries (Smail, 1999). However, despite the severity of this threat, little is known about the cellular and molecular details of this disease. Information gained in this area could allow more targeted efforts in development of appropriate vaccines and treatment methods. Such studies also should reveal basic information on rhabdovirus mechanisms and evolution. Over the last 50 years VHSv has continued to spread and adapt to new environmental niches (Bain et al., 2010; Jonstrup et al., 2009). This suggests that the virus has evolved at least one mechanism to survive the innate immune systems of multiple fish species from diverse environments. This obvious, but important, possibility was supported by experiments in our lab where cells treated with IFN following infection were unable to clear viral infection (Fig. 5A). That observation indicated that the innate immune system was prevented from functioning appropriately following viral infection. Upon exploring this issue further, we identified at least two individual proteins produced by the virus, the M protein and the P protein, that were capable of potently disrupting 51 innate immune response activation or function. Interestingly, orthologs of the viral antagonists found in our initial screen of VHSv genes also have been identified as inhibitors of innate immune responses in other rhabdoviruses (Faul, Lyles, & Schnell, 2009; Rieder, 2009). As such, we chose to focus our initial experiments with this project on the VHSv M and P proteins, with the goal of further characterizing their potential sites of action and mechanisms. 4.1 The VHSv Matrix protein The VSV M protein is the most understood and well-studied M ortholog within the rhabdovirus family. As briefly mentioned in the introduction, the VSV M protein has been implicated to inhibit host gene expression (M Ahmed & Lyles, 1998; Ferran & Lucas-Lenard, 1997). Similarly, the M protein of Infectious Hematopoietic Necrosis virus (IHNV), a closer relative to VHSv in the Novirhabdovirus family, has been associated with inhibiting host-directed gene expression as well (Chiou, Kim, & Ormonde, 2000). Despite the low sequence similarity among the VSV, IHNV and VHSv M proteins, our studies indicated that the inhibitory function of M is conserved in VHSv. We demonstrated that VHSv M, when ectopically expressed, can robustly inhibit gene expression and, therefore, most subsequent anti-viral responses requiring active transcription (i.e. – IFN and ISG transcription). Previous studies from other labs have yielded mixed results regarding a mechanism for the global inhibition of gene expression by M proteins. Most of the experiments completed in those research projects only utilized protein analysis or luciferase assays (Ferran & Lucas-Lenard, 1997; Waibler et al., 2007). Although those 52 techniques were able to easily detect a change in final protein expression, they did little to answer the question of whether transcription, translation, or both processes were inhibited. To date, only a single study has indicated a decrease in actual mRNA expression via northern blot analysis following ectopic expression of VSV M (Black & Lyles, 1992). Our initial luciferase and western blot data also indicate a dose-dependent decrease of expression at the protein level (Fig 9A-C). However, our real-time PCR analysis of luciferase mRNA with increasing amounts of M showed little to no deviation from one sample to the next (Fig. 9D). This suggested that there may be another mechanism involved in disrupting the gene expression in VHSv-infected cells. Recent research on the VSV M protein has revealed an association between M and a highly conserved complex consisting of ribonucleic acid export 1 (RAE1) and nucleoporin 98 (NUP98) proteins (Fontoura, Faria, & Nussenzveig, 2005). This complex primarily localizes to the nuclear pore complex and functions to shuttle mRNA from the nucleus to the cytoplasm (Powers et al., 1997; Pritchard et al., 1999). The interaction between VSV M and the NUP98/RAE1 complex blocks the transport of mRNA molecules to the cytoplasm. This mechanism adequately explains not only previous experiments from other labs, but also our initial results using luciferase assays and western blot analysis. If luciferase mRNA failed to enter the cytoplasm for translation, it would not be detected in our luciferase assay. Interaction of VHSv M with this complex also could potentially explain our real-time PCR results: luciferase mRNA would still be produced (and thus would exhibit consistent experimental levels) but could not leave the nucleus. Current experiments in our lab are aimed at assessing mRNA levels in nuclear and cytoplasmic fractions in the presence or absence of VHSv M. These experiments 53 could help determine if mRNA accumulates in the nucleus when M is expressed. Intriguingly, our localization of VHSv M to the nuclear membrane could further support a mechanism in VHSv infected fish cells that resembles that of VSV M in human cells (von Kobbe C et al., 2000). Our lab currently is attempting to clone RAE1 and NUP98 orthologs from fish to further assess the mechanism. Interestingly, the RAE1 and NUP98 complex also has been implicated in spindle assembly complex formation (Blower, Nachury, Heald, & Weis, 2005). VSV M protein interaction displaces RAE1 from the spindle assembly complex, causing abnormalities in chromatin, which in turn activates an apoptotic response (Chakraborty et al., 2009). We determined that ectopic expression of VHSv M induced apoptosis in cells after 48 h (Fig. 7). Furthermore, we observed that the apoptotic response was more pronounced when the transfected cells were sparsely plated (data not shown). This would suggest that dividing cells were more apt to undergo apoptosis. Although the reduced gene expression associated with M expression might also contribute to apoptosis, no evidence for this mechanism of VHSv or other rhabdovirus M protein actions have been reported. 54 mRNA export inhibited “Normal” mRNA Export Figure 11: VSV M inhibits nuclear export of mRNA. The panel on the left illustrates normal export of mRNA through the RAE-1-NUP98-mRNA complex. NUP98 recruits RAE-1 to the nuclear pore complex (NPC). In turn, mRNA binds to RAE1 and the complex shuttles the mRNA into the cytoplasm. When VHSv M is present it interacts with RAE1 thereby inhibiting association between RAE1 and mRNA. This prevents mRNA from being exported from the nucleus, leading to its accumulation in the nucleus and loss of cellular protein expression 55 4.2 The VHSv Phosphoprotein The rabies virus (RV) P protein prevents transcriptional activation of IFN genes and inhibits IFN-mediated JAK-STAT signaling (Faul et al., 2009). The “first phase” of the IFN pathway leading to the transcription of IFNs relies primarily on IRF3 and IRF7 transcription factors. RV P interacts with these transcription factors and prevents them from undergoing phosphorylation by the upstream signaling molecules, TBK1 and IKKi (Maryam Ahmed et al., 2009; K Brzozka, Finke, & Conzelmann, 2005). Without phosphorylation, neither IRF3 nor IRF7 can localize to the nucleus to activate IFN gene expression (Sun et al., 2010). Despite a lack of available expression plasmids for many components of the fish virus response pathway, our lab has developed parameters to analyze this pathway in fish cells. After activating the signaling pathway by over-expressing a fish ortholog of MAVs, we can observe changes in IFN activation either by harvesting medium and treating naïve cells with collected media dilutions prior to infecting them with VHSv to assess protection or by using a highly conserved human IFNβ promoter luciferase construct as pathway activation readout. In these experiments, VHSv P mildly inhibited IFN production. Although this observation may have multiple interpretations, we hypothesize that this inhibition is likely due to an association between VHSv P and IRF3. Our lab recently cloned the IRF3 ortholog in fish to test any potential interaction it may have with VHSv P, to test this hypothesis. RV P also potently inhibits the activation of ISGs by blocking JAK/STAT signaling (Krzysztof Brzozka et al., 2006; Yu et al., 2010). Unlike the “first phase” (virus detection arm) of the pathway where many proteins are involved in a complex 56 signaling cascade, the “second phase” (IFN response) is relatively simple, involving only proteins that comprise the IFN receptor complex, the JAKs (JAK1 and JAK2), the STATs (STAT1 and STAT2), and IRF9. Previous experiments with RV indicated that the P protein bound to the STAT proteins only after their activation by the JAKs associated with the IFN receptor (Brzozka et al., 2006). Following RV P binding to the phosphorylated STATs, the STATs were sequestered in the cytoplasm, preventing them from activating the transcription of target ISGs in the nucleus. Here, we have shown here that the VHSv P protein potently inhibited ISG transcriptional activation in a dosedependent manner. It is likely that the VHSv P protein has a similar function to that of the RV P protein. Although fish STAT genes have been difficult to clone, we are working on isolating them so that we will be able to assess any interactions between VHSvP and either STAT1 or STAT2. 57 (IFN response pathway) (Viral detection pathway) Figure 12: RV P prevents both IFN activation and ISG activation. In the viral detection pathway the VSV P protein associates with IRF3 and prevents its phosphorylation by up-stream signaling molecules. Without being phosphorylated, IRF3 cannot localize to the nucleus and activate IFN transcription. In the IFN response pathway, the P protein interacts with the ISGF3 complex after it has been activated by IFN-mediated signaling. This prevents the complex from entering the nucleus and activating ISGs. 58 4.3 Future Goals and Experiments 4.3.1 Other VHSv proteins We made a number of interesting observations on the functions of other VHSv viral proteins. In addition to the M and P effects described in detail herein, some of our initial experiments also indicated that the small NV gene found only in novirhabdoviruses may be capable of positively augmenting or activating the transcription of IFN when expressed alone in EPC cells (Fig. 6). These results suggest that NV may be a pathogen associated molecular pattern that is detected by the RIG-I like helicases. To date we have cloned NV from multiple strains of VHSv and have begun testing the expression vectors in EPC cells. 4.3.2 Comparison of VHSv and related rhabdovirus strains As alluded to above, our lab obtained cDNA from multiple VHSv strains and related fish rhabdoviruses. Previous research on these strains has indicated that few differences in amino acid sequence are required to dramatically alter the virulence and lethality of the virus. As such, determining which amino acid differences in individual proteins are most likely to alter viral function could allow us to better understand the function and evolutionary importance for individual genes. Furthermore, mapping the areas of the genome and determining proteins that influence virulence and cytopathicity could aid development of future therapeutic interventions for VHSv. Thus far, our lab has cloned the NV gene (as mentioned above) and the M gene from several variants. Initial experiments on the M variants have indicated differences in the degree of M 59 transcriptional inhibition, despite minimal substitutional divergence among the sequences. 4.3.3 Recombinant viruses With the increase of genomic information and cloning techniques, development of knock-out viruses has become more common. As suggested by the name, these viruses would ultimately be fully developed virions whose genome lacks a gene or genes of interest. As with other knock-outs used in model organisms, comparing the resulting “phenotype” between the wild-type sample and the knock-out could help determine a more global function for the target gene. Furthermore, to verify results related to differences in VHSv variants, we could develop recombinant viruses expressing only the differing gene of interest and assess changes in its virulence and cytopathicity. 4.4 Overall Summary We have herein reported novel functions for two VHSv IVb products. Ectopic expression of the M protein for greater than 48 h induces apoptosis in fish EPC cells (Fig. 7). We have also shown that the M protein blocks the production of host cell proteins while transcriptional activation continues, uninhibited by the presence of M. Both of these results, along with our localization of M to the nuclear membrane, strongly suggest that VHSv may utilize similar mechanisms as VSV through and association with the NUP98-RAE1 complex. Our experiments indicate that the VHSv P protein is an inhibitor of the innate immune responses in EPC cells. Expressing MAVs alone can activate the down-stream 60 signaling pathway leading to the activation of IFN genes. In the presence of P, IFN activation is dose-dependently decreased. This suggest that P is able to inhibit some step in the vial detection pathway. Furthermore, activating the IFN response pathway by treating cells with IFN in the presence of P block ISG gene transcription. This suggest that P is also involved in the IFN response pathway. Taken together, these observations are consistent with what is seen in the rabies virus. 61 References Ahmed, M, & Lyles, D. S. (1998). Effect of vesicular stomatitis virus matrix protein on transcription directed by host RNA polymerases I, II, and III. Journal of Virology, 72(10), 8413-9. Ahmed, Maryam, Mitchell, L. M., Puckett, S., Brzoza-Lewis, K. L., Lyles, D. S., & Hiltbold, E. M. (2009). Vesicular stomatitis virus M protein mutant stimulates maturation of Toll-like receptor 7 (TLR7)-positive dendritic cells through TLRdependent and -independent mechanisms. Journal of Virology, 83(7), 2962-75. Ammayappan, A., & Vakharia, V. N. (2009). Molecular characterization of the Great Lakes viral hemorrhagic septicemia virus ( VHSV ) isolate from USA. Virology Journal, 16, 1-16. Assenberg, R., Delmas, O., Morin, B., Graham, S. C., De Lamballerie, X., Laubert, C., Coutard, B., et al. (2010). Genomics and structure/function studies of Rhabdoviridae proteins involved in replication and transcription. Antiviral research. Elsevier B.V. Bain, M. B., Cornwell, E. R., Hope, K. M., Eckerlin, G. E., Casey, R. N., Groocock, G. H., Getchell, R. G., et al. (2010). Distribution of an invasive aquatic pathogen (Viral Hemorrhagic Septicemia virus) in the Great Lakes and its relationship to shipping. PloS One, 5(4), e10156. Benmansour, A., Basurco, B., Monnier, a F., Vende, P., Winton, J. R., & de Kinkelin, P. (1997). Sequence variation of the glycoprotein gene identifies three distinct lineages within field isolates of Viral Haemorrhagic Septicaemia virus, a fish rhabdovirus. The Journal of General Virology, 78(11), 2837-46. Biacchesi, S., Leberre, M., Lamoureux, A., Louise, Y., Lauret, E., Boudinot, P., & Bremont, M. (2009). Mitochondrial antiviral signaling protein plays a major role in induction of the fish innate immune response against RNA and DNA viruses. Journal of Virology, 83(16), 7815-7827. Black, B. L., & Lyles, D. S. (1992). Vesicular stomatitis virus matrix protein inhibits host cell-directed transcription of target genes in vivo. Journal of virology, 66(7), 405864. 62 Blower, M. D., Nachury, M., Heald, R., & Weis, K. (2005). A Rae1-containing ribonucleoprotein complex is required for mitotic spindle assembly. Cell, 121(2), 223-34. Borden, E. C., Sen, G. C., Uze, G., Silverman, R. H., Ransohoff, R. M., Foster, G. R., & Stark, G. R. (2007). Interferons at age 50: past, current and future impact on biomedicine. Nature Reviews. Drug Discovery, 6(12), 975-90. Bowie, A. G., & Unterholzner, L. (2008). Viral evasion and subversion of patternrecognition receptor signalling. Nature Reviews. Immunology, 8(12), 911-22. Breiman, A., Grandvaux, N., Lin, R., Ottone, C., Akira, S., Yoneyama, M., Fujita, T., et al. (2005). Inhibition of RIG-I-dependent signaling to the interferon pathway during hepatitis C virus expression and restoration of signaling by IKKε. Journal of Virology, 79(7), 3969-3978. Brudeseth, B. E., & Evensen, O. (2002). Occurrence of Viral Haemorrhagic Septicaemia virus (VHSV) in wild marine fish species in the coastal regions of Norway. Diseases of Aquatic Organisms, 52(1), 21-8. Brunson, R., True, K., & Yancey, J. (1989). VHS virus at Makah national fish hatchery. American Fisheries Society, Fish Health Section Newsletter, 17, 2837-2846. Brzozka, K, Finke, S., & Conzelmann, K. (2005). Identification of the rabies virus alpha/beta interferon antagonist: phosphoprotein P interferes with phosphorylation of interferon regulatory factor 3. Journal of Virology, 79(12), 7673-7681. Brzozka, Krzysztof, Finke, S., & Conzelmann, K.-klaus. (2006). Inhibition of interferon signaling by rabies virus phosphoprotein P : activation-dependent binding of STAT1 and STAT2. Journal of Virology, 80(6), 2675-2683. Chakraborty, P., Seemann, J., Mishra, R. K., Wei, J.-H., Weil, L., Nussenzveig, D. R., Heiber, J., et al. (2009). Vesicular stomatitis virus inhibits mitotic progression and triggers cell death. EMBO Reports, 10(10), 1154-60. Nature Publishing Group. Chang, M., Collet, B., Nie, P., Lester, K., Campbell, S., Secombes, C. J., & Zou, J. (2011). Expression and functional characterization of the RIG-I like receptors MDA5 and LGP2 in rainbow trout (Oncorhynchus mykiss). Journal of Virology, 85(16), 8403-8412. Chiou, P. P., Kim, C. H., & Ormonde, P. (2000). Infectious Hematopoietic Necrosis virus Matrix protein inhibits host-directed gene expression and induces morphological changes of Apoptosis in Cell Cultures. Journal of Virology, 74(16), 7619-7627. 63 Colman, P. M., & Lawrence, M. C. (2003). The structural biology of type I viral membrane fusion. Nature reviews. Molecular cell biology, 4(4), 309-19. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., & Whelan, S. P. J. (2009). Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS pathogens, 5(4), e1000394. Einer-Jensen, K. (2004). Evolution of the fish rhabdovirus viral haemorrhagic septicaemia virus. Journal of General Virology, 85(5), 1167-1179. Elsayed, E., Faisal, M., Thomas, M., Whelan, G., Batts, W., & Winton, J. (2006). Isolation of viral hemorrhagic septicemia virus from muskellunge, Esox masquinongy (Mitchill), in Lake St Clair, Michigan, USA reveals a new sublineage of the North American genotype. Journal of fish diseases, 29, 611-619. Faria, P. a, Chakraborty, P., Levay, A., Barber, G. N., Ezelle, H. J., Enninga, J., Arana, C., et al. (2005). VSV disrupts the Rae1/mrnp41 mRNA nuclear export pathway. Molecular cell, 17(1), 93-102. Faul, E. J., Lyles, D. S., & Schnell, M. J. (2009). Interferon Response and Viral Evasion by Members of the Family Rhabdoviridae. Viruses, 1, 832-851. Ferran, M. C., & Lucas-Lenard, J. M. (1997). The vesicular stomatitis virus matrix protein inhibits transcription from the human beta interferon promoter. Journal of virology, 71(1), 371-7. Fontoura, B. M., Faria, P. a, & Nussenzveig, D. R. (2005). Viral interactions with the nuclear transport machinery: discovering and disrupting pathways. IUBMB life, 57(2), 65-72. Fox, B. a, Sheppard, P. O., & O’Hara, P. J. (2009). The role of genomic data in the discovery, annotation and evolutionary interpretation of the interferon-lambda family. PloS one, 4(3), e4933. Ghittino, P. (1965). Viral hemorrhagic septicemia (VHS) of rainbow trout in Italy. Annals of the New York Academy of Sciences, 126(1), 468-478. Hawley, L., & Garver, K. (2008). Stability of viral hemorrhagic septicemia virus (VHSV) in freshwater and seawater at various temperatures. Diseases of aquatic organisms, 82(3), 171-178. Hegedus, Z., Zakrzewska, A., Agoston, V. C., Ordas, A., Rácz, P., Mink, M., Spaink, H. P., et al. (2009). Deep sequencing of the zebrafish transcriptome response to mycobacterium infection. Molecular immunology, 46(15), 2918-30. 64 Hershberger, P., Gregg, J., Grady, C., Taylor, L., & Winton, J. (2010). Chronic and persistent viral hemorrhagic septicemia virus infections in Pacific herring. Diseases of Aquatic Organisms, 93(1), 43-49. Hopper, K. (1989). The isolation of VHSv from chinook salmon at Glenwood Springs, Orcas Island, Washington. American Fisheries Society, Fish Health Section Newsletter, 17, 1-2. Horvath, C. M., & Darnell, J. E. (1996). The antiviral state induced by alpha interferon and gamma interferon requires transcriptionally active Stat1 protein. Journal of Virology, 70(1). Howard, M. (1989). Vesicular stomatitis virus RNA replication: a role for the NS protein. Journal of General Virology, 70, 2683-2694. Ivanov, I., Yabukarski, F., Ruigrok, R. W. H., & Jamin, M. (2011). Structural insights into the rhabdovirus transcription/replication complex. Virus research, 162, 126-37. Elsevier B.V. Jayakar, H R, Murti, K. G., & Whitt, M. a. (2000). Mutations in the PPPY motif of vesicular stomatitis virus matrix protein reduce virus budding by inhibiting a late step in virion release. Journal of Virology, 74(21), 9818-27. Jayakar, Himangi R, Jeetendra, E., & Whitt, M. A. (2004). Rhabdovirus assembly and budding. Virus Research, 106, 117-132. Jensen, M. H. (1965). Research on the virus of Egtved disease. Annals of the New York Academy of Sciences, 126(1), 422-426. Jonstrup, S. P., Gray, T., Kahns, S., Skall, H. F., Snow, M., & Olesen, N. J. (2009). FishPathogens.eu/vhsv: a user-friendly viral haemorrhagic septicaemia virus isolate and sequence database. Journal of Fish Diseases, 32(11), 925-9. Jorgensen, P. E. V. (1982). Egtved virus: occurrence of inapparent infections with virulent virus in free-living rainbow trout, Salmo gairdneri Richardson, at low temperature. Journal of Fish Diseases, 5(3), 251-255. Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S., et al. (2006). Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature, 441(7089), 101-5. Kim, M. S., & Kim, K. H. (2011). Inhibition of viral hemorrhagic septicemia virus replication using a short hairpin RNA targeting the G gene. Archives of Virology, 156(3), 457-64. 65 Kim, R., & Faisal, M. (2010). Comparative susceptibility of representative Great Lakes fish species to the North American viral hemorrhagic septicemia virus Sublineage IVb. Diseases of Aquatic Organisms, 91(1), 23-34. Kim, R. K., & Faisal, M. (2010). The Laurentian Great Lakes strain (MI03) of the viral haemorrhagic septicaemia virus is highly pathogenic for juvenile muskellunge , Esox masquinongy (Mitchill). Journal of Fish Diseases, 513-527. Kim, W., Kim, S.-R., Kim, D., Kim, J.-O., Park, M.-A., Kitamura, S.-I., Kim, H.-Y., et al. (2009). An outbreak of VHSV (viral hemorrhagic septicemia virus) infection in farmed olive flounder Paralichthys olivaceus in Korea. Aquaculture, 296(1-2), 165168. Elsevier B.V. Kopecky, S. A., & Lyles, D. S. (2003). Contrasting effects of matrix protein on apoptosis in HeLa and BHK cells infected with vesicular stomatitis virus are due to inhibition of host gene expression. Journal of Virology, 77(8), 4658-4669. Krause, C. D., & Pestka, S. (2005). Evolution of the class 2 cytokines and receptors, and discovery of new friends and relatives. Pharmacology & Therapeutics, 106(3), 299346. Li, X., Leung, S., Burns, C., & Stark, G. R. (1998). Cooperative binding of Stat1-2 heterodimers and ISGF3 to tandem DNA elements. Biochimie, 80(8-9), 703-10. Liu, H. M., & Gale, M. (2010). Hepatitis C virus evasion from RIG-I-dependent hepatic innate immunity. Gastroenterology Research and Practice, 2010, 548390. Loo, Y.-M., & Gale, M. (2011). Immune signaling by RIG-I-like receptors. Immunity, 34(5), 680-92. Elsevier Inc. Marié, I., Durbin, J. E., & Levy, D. E. (1998). Differential viral induction of distinct interferon-alpha genes by positive feedback through interferon regulatory factor-7. The EMBO Journal, 17(22), 6660-9. McAllister, P. E., & Wagner, R. R. (1975). Structural proteins of two salmonid rhabdoviruses. Journal of Virology, 15(4), 733-8. Meyers, T. R., Short, S., & Lipson, K. (1999). Isolation of the North American strain of viral hemorrhagic septicemia virus (VHSV) associated with epizootic mortality in two new host species of Alaskan marine fish. Diseases of Aquatic Organisms, 38(2), 81-6. Meyers, T., & Winton, J. (1995). Viral hemorrhagic septicemia virus in North America. Annual Review of Fish Diseases, 5, 3-24. 66 Nishizawa, T., Iida, H., Takano, R., Isshiki, T., Nakajima, K., & Muroga, K. (2002). Genetic relatedness among Japanese, American and European isolates of viral hemorrhagic septicemia virus (VHSV) based on partial G and P genes. Diseases of Aquatic Organisms, 48(2), 143-8. Peeler, E. J., & Taylor, N. G. (2011). The application of epidemiology in aquatic animal health -opportunities and challenges. Veterinary Research, 42(1), 94-109. BioMed Central Ltd. Plemper, R. K. (2011). Cell entry of enveloped viruses. Current Opinion in Virology, 1(2), 92-100. Elsevier B.V. Powers, M., Forbes, D., Dahlberg, J., & Lund, E. (1997). The vertebrate GLFG nucleoporin, Nup98, is an essential component of multiple RNA export pathways. The Journal of Cell Biology, 136(2), 241-50. Pritchard, C. E., Fornerod, M., Kasper, L. H., & van Deursen, J. M. (1999). RAE1 is a shuttling mRNA export factor that binds to a GLEBS-like NUP98 motif at the nuclear pore complex through multiple domains. The Journal of Cell Biology, 145(2), 237-54. Rasmussen, C. J. (1965). A biological study of the Egtved disease (INuL). Annals of the New York Academy of Sciences, 126(1), 427-60. Rieder, M. (2009). Rhabdovirus evasion of the interferon system. Journal of Interferon & Cytokine Research, 29, 499-509. Robertsen, B. (2006). The interferon system of teleost fish. Fish & Shellfish Immunology, 20(2), 172-91. Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory. Schäperclaus, W. (1938). Die Immunisierung von karlen gegen Bauchwa sucht auf natürilchem und künstlichem Wege. Fishereig, Neudamm, 193-196. Schütze, H., Enzmann, P. J., Mundt, E., & Mettenleiter, T. C. (1996). Identification of the non-virion (NV) protein of fish rhabdoviruses viral haemorrhagic septicaemia virus and infectious haematopoietic necrosis virus. The Journal of General Virology, 77(6), 1259-63. Simora, R. M., Ohtani, M., Hikima, J., Kondo, H., Hirono, I., Jung, T. S., & Aoki, T. (2010). Molecular cloning and antiviral activity of IFN-β promoter stimulator-1 67 (IPS-1) gene in Japanese flounder, Paralichthys olivaceus. Fish & Shellfish Immunology, 29(6), 979-86. Elsevier Ltd. Skall, H. F., Olesen, N. J., & Mellergaard, S. (2005). Viral haemorrhagic septicaemia virus in marine fish and its implications for fish farming--a review. Journal of Fish Diseases, 28(9), 509-29. Smail, D. A. (1999). Viral Haemorrhagic Septicemia virus. In P. T. . Woo & D. W. Bruno (Eds.), Fish Diseases and Disorders, Viral, Bacterial and Fungal Infections, vol 3. (pp. 123-147). New York: CAB International. Stein, C., Caccamo, M., Laird, G., & Leptin, M. (2007). Conservation and divergence of gene families encoding components of innate immune response systems in zebrafish. Genome Biology, 8(11), R251. Studer, J., & Janies, D. A. (2011). Global spread and evolution of viral haemorrhagic septicemia virus. Journal of Fish Diseases, 34, 741-747. Sun, F., Zhang, Y.-B., Liu, T.-K., Gan, L., Yu, F.-F., Liu, Y., & Gui, J.-F. (2010). Characterization of fish IRF3 as an IFN-inducible protein reveals evolving regulation of IFN response in vertebrates. Journal of Immunology (Baltimore, Md. : 1950), 185(12), 7573-82. Tafalla, C., Sanchez, E., Lorenzen, N., DeWitte-Orr, S. J., & Bols, N. C. (2008). Effects of viral hemorrhagic septicemia virus (VHSv) on the rainbow trout (Oncorhynchus mykiss) monocyte cell line RTS-11. Molecular Immunology, 45(5), 1439-48. Taniguchi, T., Ogasawara, K., Takaoka, A., & Tanaka, N. (2001). IRF family of transcription factors as regulators of host defense. Annual Review of Immunology, 19, 623-55. Thiéry, R., de Boisséson, C., Jeffroy, J., Castric, J., de Kinkelin, P., & Benmansour, A. (2002). Phylogenetic analysis of viral haemorrhagic septicaemia virus (VHSv) isolates from France (1971-1999). Diseases of Aquatic Organisms, 52(1), 29-37. Tze, È., Mundt, E., & Mettenleiter, T. C. (1999). Complete genomic sequence of Viral Hemorrhagic Septicemia virus , a fish rhabdovirus. Virus Genes, (7), 59-65. VHSv Expert Panel. (2010). Viral hemorrhagic septicemia virus ( VHSV IVb ) risk factors and association measures derived by expert panel. Preventive Veterinary Medicine, 94(1-2), 128-139. Elsevier B.V. Waibler, Z., Detje, C. N., Bell, J. C., & Kalinke, U. (2007). Matrix protein mediated shutdown of host cell metabolism limits vesicular stomatitis virus-induced 68 interferon-alpha responses to plasmacytoid dendritic cells. Immunobiology, 212(910), 887-94. Warfield, K. L., Perkins, J. G., Swenson, D. L., Deal, E. M., Bosio, C. M., Aman, M. J., Yokoyama, W. M., et al. (2004). Role of natural killer cells in innate protection against lethal ebola virus infection. The Journal of Experimental Medicine, 200(2), 169-79. doi:10.1084/jem.20032141 Winton, J. R., & Einer-Jensen, K. (2002). Molecular diagnosis of infectious hematopoietic necrosis and viral hemorrhagic septicemia. In C. O. Cunninghan (Ed.), Molecular Diagnosis of Salmonid Diseases (pp. 49-79). Dordrecht, Netherlands: Kluwer Academic Publishers. Wolf, K. (1988). Hemorrhagic septicemia virus. Fish Viruses and Fish Viral Diseases (pp. 217-249). Ithaca, NY: Cornell University Press. Yu, F. F., Zhang, Y. B., Liu, T. K., Liu, Y., Sun, F., Jiang, J., & Gui, J. F. (2010). Fish virus-induced interferon exerts antiviral function through Stat1 pathway. Molecular Immunology, 47(14), 2330-41. Elsevier Ltd. Zou, J., Tafalla, C., Truckle, J., & Secombes, C. J. (2007). Identification of a second group of type I IFNs in fish sheds light on IFN evolution in vertebrates. Journal of Immunology (Baltimore, Md. : 1950), 179(6), 3859-71. von Kobbe C, van Deursen JM, Rodrigues, J. P., Sitterlin, D., Bachi, A., Wu, X., Wilm, M., et al. (2000). Vesicular stomatitis virus matrix protein inhibits host cell gene expression by targeting the nucleoporin Nup98. Molecular cell, 6(5), 1243-52. 69