Download research design and methods

RESEARCH DESIGN AND METHODS
VDR −/− NOD mice
The original Vdrtm1Ska/Vdrtm1Ska (VDR −/−) mice were produced by Dr. Kato (University of Tokyo, Japan) and
were kept on C57BL/6  CBA background (1). These mice have a deletion of the second exon of the VDR
gene (Chromosome 15, 97682461-97736330 Mb), which encodes the first of the two zinc fingers responsible
for DNA binding, making vitamin D hormone-dependent gene transcription impossible. After backcrosses of
male VDR −/+ heterozygotes to female NOD mice (N10 and N14), VDR −/+ NOD mice were intercrossed to
produce experimental animals of three genotypes: homozygous VDR −/− as well as heterozygous VDR −/+
and wildtype VDR +/+ NOD mice. All experiments were performed on age- and sex-matched VDR −/− and
VDR +/+ NOD littermates from intercrosses of N10 and N14 generations. All animals were maintained under
filter hoods and in sterile cages with pine chips while receiving a standard mouse chow diet containing 1.1%
calcium, 0.8% phosphorus, 2000 IU vitamin D/kg and 0% lactose (Standard; Carfil, Oud-Turnhout, Belgium).
All mouse protocols were approved by the ethical committee for animal research at the Katholieke
Universiteit Leuven and were in accordance with the NIH Guide for the Care and Use of Laboratory Animals.
Genotyping of VDR −/− NOD mice
Genotypes of mice from N2 to N14 generation were determined by testing tail DNA with microsatellite
markers linked to 15 insulin-dependent diabetes (Idd) loci (Idd1 to Idd15) as described (2). In brief, tail
fragments were lysed overnight at 57°C using proteinase K. Afterwards, the enzyme was inactivated by
incubating the lysate at 98°C for 10 min. PCR amplification was performed using fluorescent-labeled primers
for linkage markers D17MIT34, D9MIT25, D3MIT95, D3MIT100, D3MIT103, D11MIT115, D11MIT320,
D1MIT18, D1MIT46, D6MIT52, D6MIT339, D7MIT20, D14MIT110, D14MIT222, D4MIT59, D3MIT103,
D2MIT17, D2MIT395, D13MIT61, D5MIT48, D15MIT190, D15MIT34, D15MIT39, D15MIT48, and
D15MIT193 (MapPairs™; Research Genetics; Huntsville, AL) and sequences were as described
(http://www.genome.wi.mit.edu). Although no autoimmune diabetes susceptibility loci have previously been
reported on mouse Chromosome 15, we were very careful in introducing VDR −/− phenotype onto the NOD
background by including microsatellite markers very close to the VDR in the set of 15 Idd makers tested for
NOD homozygosity because many immune and regulatory genes reside in close proximity of the VDR gene.
The amplification products were electrophoresed using an automated DNA sequencer (ALF Express;
Pharmacia, Uppsala, Sweden) and analyzed using the Fragment Manager software (Pharmacia).
Genotyping with selected linkage markers indicated that mice from N9 generation onwards were
homozygous for NOD-derived genome at all Idd loci markers tested. Breeding was achieved by successive
backcrossing of congenic males with NOD females. VDR −/+ NOD mice were distinguished from VDR −/−
NOD homozygotes by amplification of the VDR gene (forward primer, AAAGAACTGCCACCCACTCTCC;
reverse primer, CTGCCATTGCCTCCATCC; probe, CTATGCTGAAGGTGCCAGCTCCTTTTG for VDR) as
described (3). Genomic PCR demonstrated that VDR −/−, −/+ and +/+ NOD mice were produced at the
expected 1:2:1 ratio (29, 46 and 25%, respectively, in N10 generation (n = 163) and, 27, 51 and 22%,
respectively, in N14 generation (n = 399)). Each backcross had normal percentage of live pups born, normalsize litters and no significant pup mortality at day 21 postpartum.
In vitro immune phenotyping
N10-and N14-generation VDR −/− and VDR +/+ NOD littermates of 100 days of age were subjected to an
extensive in vitro analysis of their immune system.
Flow cytometry of thymus, spleen and mesenteric lymph nodes
Single-cell suspensions from thymus, spleen and mesenteric lymph nodes were prepared as described (4).
All cells were incubated with either fluorescein isothiocyanate (FITC)–, phycoerythrin (PE)–, or peridinin
chlorophyll protein (PerCP)–conjugated antibodies. The following rat-, hamster- or goat-anti-mouse
antibodies were purchased from Pharmingen (Becton Dickinson, Erembodegem, Belgium): CD3 (clone 1452C11), CD4 (clone RM4-5), CD8 (clone 53-6.7), CD11b (clone M1/70), CD11c (clone HL3), CD14 (clone
RM052), CD25 (clone 3C7), CD40 (clone HM40-3), CD45R/B220 (clone RA3-6B2), CD54 (clone 3E2),
CD62L (clone MEL-14), CD80 (clone 16-10A1), CD86 (clone GL1), F4/80 (clone CI:A3-1), TCR-α/ß (clone
H57-597), and isotype-matched controls. After the last step, cells were washed and fixed in 1%
paraformaldehyde. Flow cytometric analysis was done on a dual-laser flow cytometer (FACSort; BectonDickinson) and cells present in the leukocyte gate as defined by light scatter were analyzed. Results are
expressed as percent positive cells.
Anti-CD3 stimulation and activation-induced cell death
T cell proliferation was assayed after a 3-day incubation with purified anti-CD3 mAb (Serotec, Oxford, UK) in
splenocytes isolated from VDR −/− and VDR +/+ NOD littermates as described (4). Proliferation values are
expressed as stimulation index (SI = cpm of stimulated splenocytes / cpm of control).
After culture for 24 hrs, cell death of recovered cells was determined by flow cytometry with terminal FITCdeoxynucleotidyl-mediated nick end labeling (TUNEL) as described (5). Cell death, activation-induced cell
1
death (AICD), resulting from activation without effective co-stimulation, is expressed as percentage of
TUNEL-positive cells of quadruplicate cultures.
In vitro phagocytic function
For analysis of phagocytic function, resident peritoneal macrophages as well as whole blood neutrophils and
monocytes were used in parallel tests (chemotaxis, phagocytosis and oxidative burst).
Resident macrophages from peritoneum
Macrophages were collected from the peritoneum of female VDR −/− and VDR +/+ NOD littermates as
described (4).
Chemotaxis activity was evaluated by flow cytometry on peritoneal macrophages incubated with fluoresceinlabeled casein (Invitrogen-Molecular Probes, Merelbeke, Belgium). Fluorescein-labeled zymosan particles
(Saccharomyces cerevisiae; Invitrogen-Molecular Probes) were used to evaluate the phagocytosis capacity
of various macrophages. In addition, oxidative burst was evaluated using the PHAGOBURST® test of
ORPEGEN Pharma (Heidelberg, Germany). The test was carried out following the manufacturer’s
instructions. All results are expressed as percentage of fluorescein-positive cells.
For mRNA analysis, macrophages from each group were pooled, plated on 24-well Petri dishes and allowed
to adhere as described (4). Non-adherent cells were aspirated. After incubation with or without LPS (100
µg/mL, Sigma-Aldrich, St. Louis, Missouri) for 6 hours, 1  106 cells were harvested and used immediately
for RNA extraction.
For nuclear factor-B (NF-B) staining, peritoneal macrophages, plated on 8-well glass chamber slides, were
incubated for 30 min with or without 100 µg/mL LPS (Sigma-Aldrich). After fixation with 4% formalin, slides
were washed with Tris-buffered saline solution containing 0.1% Triton-X-100 and incubated with a rabbit
polyclonal antibody against the p65/RelA component of the NF-B complex (sc-372, C-20; Santa Cruz
Biotechnology Inc., Santa Cruz, CA). After washing, cells were incubated with AlexaFluor 488-conjugated
anti-rabbit IgG (Invitrogen-Molecular Probes) for 60 min in the dark. After aspiration of secondary antibody,
coverslips were mounted on slides with ProLong Gold mounting medium with 4′,6′-diamidino-2-phenylindole
(DAPI) (Invitrogen-Molecular Probes). A ratio of translocated to non-translocated cells (100 cells for each
group) was counted by 2 individual researchers (one blinded) under a Zeiss microscope (Oberkochen,
Germany).
Polymorphonuclear neutrophils and monocytes from whole blood
Phagocytosis in whole blood was measured by flow cytometry using PHAGOTEST® (ORPEGEN Pharma)
as described (4). By gating on neutrophils and monocytes, the percentage of phagocytic cells was analyzed.
In vitro phenotype of bone marrow-derived dendritic cells
Bone marrow-derived dendritic cells were generated as described (6). At the end of the culture, nonadherent cells were harvested, counted and analyzed for their surface marker expression using flow
cytometry. Cells were double-stained with antibodies against CD11c (clone HL3) and one of the following
surface markers: MHC-II (I-Ak; clone 10-3.6), CD86 (clone GL1), CD40 (clone HM40-3) and CD54 (clone
3E2) (Pharmingen-Becton Dickinson).
Assessment of diabetes, pancreatic histopathology and insulin content determination
Diabetes development was analyzed at N10- and N14-backcross generation in VDR −/− NOD mice of both
sexes. Comparison was made with VDR +/+ NOD littermates. Mice were tested weekly for spontaneous
glycosuria development using Clinistix (Bayer Diagnostics, Germany). Mice were considered diabetic after
two consecutive weekly values testing 250 mg/dL blood glucose by a glucose meter (Glucocard Memory 2;
Menarini, Florence, Italy). All mice were killed at 250 days of age and exsanguinated by heart puncture. The
pancreas was rapidly removed, and a sample was weighted and frozen at -20°C for insulin content
determination as described (4). The spleen part of the pancreas was fixed in 4% formalin and embedded in
paraffin. For routine histopathology, pancreas sections were stained with Harris hematoxylin-eosin, whereas
immunohistochemistry studies were carried out with two primary antibodies namely insulin (Sigma-Aldrich)
and glucagon (DakoCytomation, Heverlee, Belgium) as described (4). By light microscopy, insulitis was
scored by an experienced blinded observer as follows: 0, islets free of insulitis; 1, islets with peri-insulitis; 2,
islets with lymphocyte infiltration in less than 50% of the area; 3, islets with lymphocyte infiltration in more
than 50% of the area; 4, islets with severe insulitis and ß-cell destruction.
Calcium and bone parameters
At the end of the in vivo experiments (250 days of age), blood was collected by heart puncture and femurs
and tibias were removed. Serum and femur were stored at -20°C until analysis. The left femur was immersed
in Burckhardt’s fixative for 24 hrs at 4°C and subsequently kept in 100% ethanol until histomorphometric
analysis. Total calcium content of the right femur, measured on HCl dissolved bone ashes, and of the serum
was assessed by an auto analyzer (Syncron CX4, Beckman Coulter; Palo Alto, CA) using the calcium2
sensitive dye arsenazo III (Sigma-Aldrich). Serum concentrations of 25(OH)D3 and 1,25(OH)2D3 were
assessed using 125I RIA kits (DiaSorin, Inc., Stillwater, MN).
For histological analysis of bone, the undecalcified tibias were embedded in methyl methacrylate, and 4 µm
longitudinal sections were cut. The histological sections were stained according to Goldner and evaluated by
a Zeiss microscope. The trabecular bone volume was measured as described (7). Peripheral Quantitative
Computed Tomography (pQCT) was performed on the removed left femur with the Stratec XCT Research M+
densitometer (Norland Medical Systems, Inc., Fort Atkinson, WI) using software version 5.40 as described
(7).
In vivo metabolic measurements
Glucose tolerance tests were done on N10- and N14-backcross VDR −/− and VDR +/+ NOD littermates of
both sexes fasted overnight. Glucose (2 g/kg) was given i.p. at time 0. Tail blood was collected after 15, 30,
60, and 120 min, and blood glucose concentration was determined by glucose-oxidation method (Glucocard
memory 2, Menarini).
Quantitative analysis of gene expression profile in kidney, spleen, and peritoneal macrophages
Total RNA from kidney tissue and peritoneal macrophages was extracted by using the High pure RNA
isolation protocol (Roche Diagnostics Belgium, Vilvoorde, Belgium). Reverse transcription (RT), PCR
amplification and sequences of primer sets and probes for ß-actin (house-keeping gene), VDR, CYP27B1,
CYP24A1, IL-1, IL-6, IL-12p35, IL-12p40, IL-18, IL-23p19, and chemokine (C-C motif) ligand 2 (CCL2), and
tumor necrosis factor-α (TNF-α) were as described (8-10). Primers and probe sequences for sequences for
cathelicidin antimicrobial peptide (CAMP) gene were: forward primer: 5’-AAAGGTGGGGAGAAGATTGG-3’;
reverse
primer:
5’-CCGGCTGAGGTACAAGTTTC-3’
and
probe:
5’TGAAAAGCTTAAGAAAATTGGCCAGAAAA-3’. PCR reactions were performed in MyiQ real-time PCR
detection system from Bio-Rad (Hercules, CA) according to the manufacturer's instructions.
Statistics
Data were analyzed using NCSS 2000 statistical software (Kaysville, Utah). Results were expressed as
mean  SEM, and differences were considered significant when P0.05. Differences between groups were
evaluated by analysis of variance (ANOVA) and post-hoc unpaired Student’s t test. For comparing the in vivo
insulitis and diabetes incidence, Kaplan Meier survival curves, log rank test as well as chi-square test were
used.
3
REFERENCES
1. Yoshizawa,T, Handa,Y, Uematsu,Y, Takeda,S, Sekine,K, Yoshihara,Y, Kawakami,T, Arioka,K, Sato,H,
Uchiyama,Y, Masushige,S, Fukamizu,A, Matsumoto,T, Kato,S: Mice lacking the vitamin D receptor
exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nat.Genet.
16:391-396, 1997
2. Serreze,DV, Chapman,HD, Varnum,DS, Hanson,MS, Reifsnyder,PC, Richard,SD, Fleming,SA,
Leiter,EH, Shultz,LD: B lymphocytes are essential for the initiation of T cell-mediated autoimmune
diabetes: analysis of a new "speed congenic" stock of NOD.Ig mu null mice. J.Exp.Med. 184:20492053, 1996
3. Mathieu,C, van Etten,E, Gysemans,C, Decallonne,B, Kato,S, Laureys,J, Depovere,J, Valckx,D,
Verstuyf,A, Bouillon,R: In vitro and in vivo analysis of the immune system of vitamin D receptor
knockout mice. J.Bone Miner.Res. 16:2057-2065, 2001
4. Giulietti,A, Gysemans,C, Stoffels,K, van Etten,E, Decallonne,B, Overbergh,L, Bouillon,R, Mathieu,C:
Vitamin D deficiency in early life accelerates type 1 diabetes in non-obese diabetic mice. Diabetologia.
47:451-462, 2004
5. Decallonne,B, van Etten,E, Giulietti,A, Casteels,K, Overbergh,L, Bouillon,R, Mathieu,C: Defect in
activation-induced cell death in non-obese diabetic (NOD) T lymphocytes. J.Autoimmun. 20:219-226,
2003
6. van Etten,E, Dardenne,O, Gysemans,C, Overbergh,L, Mathieu,C: 1,25-Dihydroxyvitamin D3 alters the
profile of bone marrow-derived dendritic cells of NOD mice. Ann.N.Y.Acad.Sci. 1037:186-192, 2004
7. Venken,K, Moverare-Skrtic,S, Kopchick,JJ, Coschigano,KT, Ohlsson,C, Boonen,S, Bouillon,R,
Vanderschueren,D: Impact of androgens, growth hormone, and IGF-I on bone and muscle in male
mice during puberty. J.Bone Miner.Res. 22:72-82, 2007
8. Overbergh,L, Valckx,D, Waer,M, Mathieu,C: Quantification of murine cytokine mRNAs using real time
quantitative reverse transcriptase PCR. Cytokine. 11:305-312, 1999
9. Van Cromphaut,SJ, Dewerchin,M, Hoenderop,JG, Stockmans,I, Van Herck,E, Kato,S, Bindels,RJ,
Collen,D, Carmeliet,P, Bouillon,R, Carmeliet,G: Duodenal calcium absorption in vitamin D receptorknockout mice: functional and molecular aspects. Proc.Natl.Acad.Sci.U.S.A. 98:13324-13329, 2001
10. Overbergh,L, Gysemans,C, Mathieu,C: Quantification of chemokines by real-time reverse
transcriptase PCR: applications in type 1 diabetes. Expert.Rev.Mol.Diagn. 6:51-64, 2006
4