Download unit 3-genetics (part 1)

GENETICS
UNIT 3
The base of genetics are the
molecules of DNA and RNA


Both DNA and RNA are very long
molecules but their structure is very
simple because they are formed by the
repetition of the same unit: a
nucleotide.
DNA and RNA are polymers and
nucleotides are their monomers.
Nucleotides
Components of DNA
(desoxyribonucleic acid)
Sugar: 2-deoxyribose (or just
deoxyribose)
Phosphate group
Nitrogenous base: thymine, adenine,
cytosine and guanine
Components of DNA
A sugar, a phosphate group and a
nitrogenous base join to form a
nucleotide
Nucleotides are linked by
a phosphodiester bond
Long chains of nucleotides are
formed, all joined by
phosphodiester bonds
The structure of DNA is a double helix of two
large chains of nucleotides. The two chains
are antiparallel.
In the double helix adenine is always joined to thymine and guanine is
always joined to cytosine. ALWAYS. Bases are joined by a type of bond
that is called “hydrogen bond”.
Between thymine and adenine there are two hydrogen bonds and
between guanine and cytosine there are three hydrogen bonds.
The order of the bases in DNA
gives genetic information


In DNA the sugar and the phosphate group
are just the “skeleton”: thanks to them the
chains of DNA are formed. But it is the
sequence of nitrogenous bases that gives
the genetic information.
We usually refer to one part of DNA by the
order of the sequence of the bases, for
example: 3´ ATTCAGCATCG 5´
Exercise
Write the other strand of DNA in a
double helix for the following
sequences:
a) 3´ATTCGACCGTACGAAAATACGGG5´

b) 5´CGATCCGCAATTCGACCGTTTAG3´
Components of RNA
(ribonucleic acid)
Sugar: ribose
Phosphate group
Nitrogenouse base: uracil (NOT
thymine), adenine, cytosine and
guanine
Components of RNA
Components of RNA


A sugar, a phosphate group and a
nitrogenous base also join to form a
nucleotide.
Nucleotides are linked by
phosphodiester bonds to form long
chains of RNA.
Structure of RNA
In RNA we don´t have a double
helix but we can have loops in
some parts
In prokaryotic cells (bacterias) the DNA
is in the cytoplasm (no separation from
other components of the cell)
In eukaryotic cells (humans, animals, plants…)
the DNA is in the nucleus, separated from other
parts of the cell. We are going to focus on
eukaryotic cells.
In humans, plants and animals DNA
is joined to proteins forming
chromosomes
http://learn.genetics.utah.edu/content/chromosomes/intro/
Chromosomes


Each species have a specific number
of chromosomes. For example,
humans have 46 chromomes.
Chromosomes can only be seen when
the cell is dividing, in a process called
mitosis. In the mitosis the
chromosomes are condensed and
that´s why we can see them.
Celular cycle
Phases in the life of a cell


Interphase: the cell is not dividing.
During the interphase the DNA
duplicates so that when the cell
divides in two, each new cell has the
same DNA as the original cell.
Mitosis: the cell divides in two
daughter cells.
Chromosomes at the begining of the mitosis: as
the DNA has been duplicated they are formed
by two chromatids.
Sexual reproduction and
meiosis


Meiosis is used to form gametes
(sperm and egg cells).
In species with sexual reproduction
the offspring is produced by the
combination of the DNA of two
individuals, the father and the mother.
Sexual reproduction and
meiosis


When a spermatozoon and an egg cell join they
form the zygote, which is the initial cell of a new
individual. This initial cell will have several mitosis
to form the complete new individual.
As the zygote is the combination of a spermatozoon
and an egg cell, both the spermatozoon and the
egg cell have half the amount of the genetic
information of the parents, so that the offspring
don´t have twice the amount of DNA of their
parents.
Sexual reproduction and
meiosis


During a process called meiosis the
genetic information of a cell is reduced
to half the amount of it so that a
gamete is formed.
Masculine gametes are called
spermatozooa (plural for
spermatozoon) and female gametes
are called egg cells.
Sexual reproduction and
meiosis


A lot of species, humans for example, are
diploid (2n), that means that they have
pairs of chromosomes, each pair called
“homologous chromosomes”, and these are
chromosomes that contain the same genes.
Humans have 46 chromosomes, or, better
said, 23 pairs of chromosomes (2n, n=23).
Female human karyotype
Sexual reproduction and
meiosis


During the meiosis the pairs of
chromosomes (homologous chromosomes)
are separated so we obtain cells that have
half the genetic information of an individual.
Hence, a gamete is formed, which is haploid
(n).
In the case of humans, both spermatozooa
and egg cells have 23 chromosomes.
Sexual reproduction and
meiosis (in the example, n=2)
https://www.youtube.com/watch?v=nMEyeKQClqI
When a spermatozoon (n) fertilizes
an egg (n), a zygote is obtained
(2n)
Mendel laws


Once upon a time (1860's), in an Austrian monastery,
there lived a monk named Gregor Mendel. Monks had
a lot of time on their hands and Mendel spent his time
crossing pea plants. As he did this over & over & over
& over & over again, he noticed some patterns to the
inheritance of traits from one set of pea plants to the
next. By carefully analyzing his pea plant numbers (he
was really good at mathematics), he discovered three
laws of inheritance. Mendel's Laws are as follows:
1. The Law of Dominance
2. The Law of Segregation
3. The Law of Independent Assortment
Mendel´s laws

In Mendel´s work the words "chromosomes"
or "genes" are nowhere to be found. That is
because the role of these things in relation to
inheritance & heredity had not been
discovered yet. What makes Mendel's
contributions so impressive is that he
described the basic patterns of
inheritance before the mechanism for
inheritance (namely genes) was even
discovered.
Mendel´s laws



There are a few important vocabulary terms we should
iron-out before diving into Mendel's Laws.
GENOTYPE = the genes present in the DNA of an
organism. We will use a pair of letters (ex: AA or Aa or
aa, etc.) to represent genotypes for one particular
trait. There are always two letters in the genotype
because (as a result of sexual reproduction) one code
for the trait comes from mama organism & the other
comes from papa organism, so every offspring gets
two codes (two letters).
There are three possible GENOTYPES - two big letters
(like “AA"), one of each (“Aa"), or two lowercase
letters (“aa"). Each possible combo has a term for it.
Mendel´s laws


When we have two capital or two lowercase
letters in the GENOTYPE (ex: AA or aa) it's
calledHOMOZYGOUS ("homo" means "the
same"). Sometimes the term "PURE" is used
instead of homozygous.
When the GENOTYPE is made up of one
capital letter and one lowercase letter
(ex: Aa) it's calledHETEROZYGOUS ("hetero"
means "other"). A heterozygous genotype
can also be referred to as HYBRID.
Mendel´s laws
PHENOTYPE = how the trait physically showsup in the organism.
ALLELES = alternative forms of the same
gene. Alleles for a trait are located at
corresponding positions on homologous
chromosomes.
Mendel´s laws





For example:
The gene A codifies for brown eyes and the gene a
codifies for blue eyes.
One individual whose genotype is AA will have
brown eyes (phenotype).
One individual whose genotype is aa will have blue
eyes (phenotype).
One individual whose genotype is Aa will have
brown eyes (phenotype). This is because A is
dominant and a is recessive.
Mendel´s laws
http://learn.genetics.utah.edu/content/inheritance/traits/
Mendel´s laws
Mendel´s laws



The Law of Dominance
In a cross of parents that are pure for contrasting
traits, only one form of the trait will appear in the next
generation. Offspring, which are hybrid for the trait,
will have only the dominant trait in the phenotype.
The Law of Segregation
During the formation of gametes , the two alleles
responsible for a trait separate from each
other. Alleles for a trait are then "recombined" at
fertilization, producing the genotype for the traits of
the offspring.
The Law of Independent Assortment
Alleles for different traits are distributed to sex cells
(& offspring) independently of one another.
Mendel’s Laws

https://www.youtube.com/watch?v=lp
pF8Mv4sbo
Mendel´s laws



One man with brown hair who is
heterozygote (Aa) marries a woman
with blonde hair (aa). What
percentage of their children will have
blonde hair?
A) 0%
C) 50%
B) 25%
D) 75%
E) 100%
Mendel´s laws



One man with albinism (aa) marries a
woman with normal colour in her skin
who is a homozygote (AA). What
percentage of their children will have
skin with normal colour?
A) 0%
C) 50%
B) 25%
D) 75%
E) 100%
Mendel´s laws



Two people with familial
hypercholesterolemia, who are both
heterocygotes (Aa) marry. The gene that
causes familial hypercholesterolemia is
recessive. Calculate the percentaje of their
offspring that will have familial
hypercholesterolemia.
A) 0%
C) 50%
B) 25%
D) 75%
E) 100%
Mendel´s laws

The Law of Independent
Assortment
Alleles for different traits are
distributed to sex cells (&
offspring) independently of one
another.
Mendel´s laws