Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Evidence for Evolution – DNA, RNA, Amino Acid Analyses! Analyze the gel electrophoresis on the right: 1. What do each of the horizontal black bands stand for? (what do they represent?) 2. Samples A, B, C, D, E, and F all come from different organisms. Which band rows do ALL the organisms have in common? 3. Which band rows are unique to only one organism? 4. According to the gel, which two organisms are MOST closely related? a. How do you know this? 5. According to the gel, which two organisms are most likely to share a common ancestor? 6. Write down which organisms correspond to each sample: a. ________________________________ d. ________________________________ b. ________________________________ e. ________________________________ c. ________________________________ f. ________________________________ 7. Now that you know which animals correspond to which sample, do your answers to numbers 4 and 5 seem reasonable? Why or why not? Gel Electrophoresis – YOUR turn to practice! Scientists are studying how four species of deer are related. The scientists believe that Species 1 is the common ancestor to the other three species. The four species have traits in common. They also have traits that are unique to their species. Scientists used the process of gel electrophoresis to study the relatedness of the four deer species. The results of their gel electrophoresis study are shown: 8. Which species is MOST closely related to the common ancestor? a. What evidence do you have? 9. Which species is LEAST closely related to the common ancestor? a. What evidence do you have? 10. What is the name of the process that leads to the development of different species? Compare the DNA sequences for the four primates listed below: CHIMPANZEE GORILLA HUMAN ORANGUTAN GGTGGAAGTGTGCCCTGTCTATTCCTGAAATT GGTGCAAGTGCGCCCTGTCTATTCCTGAAATT GGTGGAAGTGTGCCCTGTCTATTCCTGAAATT AGCCGCCT AACACTTTGAGCAGATATAAGCTT 11. Which two organisms are MOST closely related? a. How do you know this? 12. Which two organisms are LEAST closely related? a. How do you know this? 13. If a scientist approached you and asked if any of the four primates listed above share a common ancestor, what would you say? a. Why would you say this? BONUS! Can you figure out this old HSA question??? Background Information: Cytochrome C is an amino acid that scientists can use to determine how closely related two organisms are. The more closely related two organisms are, the more similar their Cytochrome C amino acid sequences will be. 14. What is the title of this chart? 15. How many differences are there between the cytochrome c molecules in TURTLES and KANGAROOS? 16. How many differences are there between the cytochrome c molecules in RABBITS and HUMANS? 17. Of the species shown, which two species are the MOST related? a. Why are they the most related? 18. Of the species shown, which two species are the LEAST related? a. Why are they the least related?