Download Bone morphogenetic protein 4: a ventralizing factor

573
Development 115, 573-585 (1992)
Printed in Great Britain © The Company of Biologists Limited 1992
Bone morphogenetic protein 4: a ventralizing factor in early Xenopus
development
L. DALE1, G. HOWES2, B. M. J. PRICE2 and J. C. SMITH2
1
School of Biochemistry, University of Birmingham, PO Box 363, Birmingham B15 2TT, UK
^Laboratory of Developmental Biology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK
Summary
The mesoderm of amphibian embryos such as Xenopus
laevis arises through an inductive interaction in which
cells of the vegetal hemisphere of the embryo act on
overlying equatorial and animal pole cells. Three classes
of 'mesoderm-inducing factor' (MIF) that might be
responsible for this interaction in vivo have been
discovered. These are members of the transforming
growth factor type /J (TGF-/?), fibroblast growth factor
(FGF) and Wnt families. Among the most potent MIFs
are the activins, members of the TGF-/J family, but RNA
for activin A and B is not detectable in the Xenopus
embryo until neurula and late blastula stages, respectively, and this is probably too late for the molecules to
act as natural inducers. In this paper, we use the
polymerase chain reaction to clone additional members
of the TGF-/3 family that might possess mesoderminducing activity. We show that transcripts encoding
Xenopus bone morphogenetic protein 4 (XBMP-4) are
detectable in the unfertilized egg, and that injection of
XBMP-4 RNA into the animal hemisphere of Xenopus
eggs causes animal caps isolated from the resulting
blastulae to express mesoderm-specific markers. Surprisingly, however, XBMP-4 preferentially induces
ventral mesoderm, whereas the closely related activin
induces axial tissues. Furthermore, the action of XBMP4 is 'dominant' over that of activin. In this respect,
XBMP-4 differs from basic FGF, another ventral
inducer, where simultaneous treatment with FGF and
activin results in activin-like responses. The dominance
of XBMP-4 over activin may account for the ability of
injected XBMP-4 RNA to 'ventralize' whole Xenopus
embryos. It is interesting, however, that blastopore
formation in such embryos can occur perfectly normally. This contrasts with embryos ventralized by UVirradiation and suggests that XBMP-4-induced ventralization occurs after the onset of gastrulation.
Introduction
Smith, 1990; and see Smith and Harland, 1991; Sokol et
al., 1991). The first group consists of members of the
fibroblast growth factor family, such as basic fibroblast
growth factor (bFGF). These induce ventral mesoderm
when added to isolated animal caps. A second group
comprises members of the transforming growth factor-)?
(TGF-/3) superfamily, of which the most potent are
activins A and B (Asashima et al.. 1990; Smith et al.,
1990; Sokol et al., 1990; Thomsen et al., 1990; van den
Eijnden Van Raaij et al., 1990). These latter proteins
induce dorsal mesoderm when added to isolated animal
caps. The final group includes members of the Wnt
family of proteins. These are not available in soluble
form, but when synthetic RNA encoding one of the
members of the family is injected into the ventralvegetal quadrant of an early Xenopus embryo, it
induces a second dorsal axis (McMahon and Moon,
1989; Christian et al., 1991; Smith and Harland, 1991;
Sokol et al., 1991).
At present, it is not known which members of the
FGF, TGF-/J and Wnt families, if any, are the natural
The mesoderm in amphibian embryos such as Xenopus
laevis arises through an inductive interaction in which
cells of the vegetal hemisphere of the embryo act on
overlying equatorial and animal pole cells (Nieuwkoop,
1969; reviewed by Smith 1989). Embryological experiments suggest that only two types of mesoderm are
initially induced: the dorsalmost quadrant of the vegetal
hemisphere induces dorsal 'organizer' mesoderm, while
the remaining ventral and lateral quadrants induce
ventral mesoderm (Dale et al., 1985; Dale and Slack,
1987). The dorsal organizer then acts upon the ventral
mesoderm to generate the typical vertebrate mesodermal pattern, a process known as dorsalization (Smith
and Slack, 1983; Dale and Slack, 1987; Stewart and
Gerhart, 1990).
Recently, progress has been made in identifying
'mesoderm-inducing factors' (MIFs), and the candidates fall into three groups (reviewed by Whitman and
Melton 1989; Dawid and Sargent, 1990; New and
Key words: mesoderm induction, Xenopus, bone
morphogenetic protein-4, activin, FGF.
574
L. Dale and others
endogenous inducing factors, although the evidence is
good that an FGF-like molecule does play a role in
mesoderm formation. bFGF mRNA and protein are
present in the Xenopus egg and early embryo (Kimelman and Kirschner 1987; Kimelman et al., 1988; Slack
and Isaacs 1989), and recent work by Shiurba et al.
(1991) has shown that both basic and acidic FGF are
concentrated in the vegetal hemisphere and marginal
zone of the blastula. In addition, injection of RNA
encoding dominant negative mutations of the FGF
receptor into fertilized Xenopus eggs causes posterior
defects in the resulting tadpoles (Amaya et al., 1991), a
result consistent with the proposed role of FGF as an
inducer of posterior mesoderm (Green et al., 1990;
Ruiz i Altaba and Melton, 1989; Cho and De Robertis,
1990).
In this paper we concentrate on members of the
TGF-/S family. One strong candidate for a TGF-/S-like
natural inducing factor is the protein product of Vgl, a
vegetally localised maternal mRNA whose sequence is
most closely related to the bone morphogenetic proteins (Rebagliati et al., 1985; Weeks and Melton 1987).
However, there is no evidence that Vgl protein has
mesoderm-inducing activity, and indeed very little, if
any, of the 40 000 relative molecular mass (Mr)
immature protein is processed into the mature 17 000
MT form (Dale et al., 1989; Tannahill and Melton 1989).
Another candidate is activin B, transcripts for which are
first detected at the mid-blastula transition in Xenopus,
when zygotic transcription begins (Thomsen et al.,
1990). However, work by Jones and Woodland (1987)
suggests that mesoderm induction in vivo begins at the
64-cell stage, at least 3 hours before the mid-blastula
transition, indicating that the natural mesoderm-inducing factor(s) should be maternally encoded. Consistent with this, Asashima et al. (1991) have recently
shown that the Xenopus egg and early embryo contains
activin-like inducing activity.
Two approaches might be adopted to identify and
characterize the endogenous activin-like mesoderminducing factors. The first involves purifying and
sequencing the proteins, and work of this kind is under
way in one of our laboratories (G.-D. Guex and J.C.S.,
unpublished data). The alternative is to clone members
of the TGF-)3 family that are expressed during early
development in Xenopus, to study their expression
patterns, and then discover whether they have inducing
activity. In this paper, which is an example of the
second approach, we describe the cloning and expression pattern of Xenopus bone morphogenetic
protein-4 (XBMP-4), a member of the TGF-0 family,
and one which is particularly closely related to
Drosophila decapentaplegic (dpp), Xenopus Vgl,
mouse Vgr-1, and BMPs -2 and -3 (Padgett et al., 1987;
Weeks and Melton, 1987; Wozney et al., 1988; Lyons et
al., 1989). We also investigate the inducing activity of
XBMP-4 by injecting mRNA into the animal hemisphere of Xenopus eggs and dissecting animal caps from
the resulting blastulae. Using this technique, we find
that XBMR-4 preferentially induces ventral mesoderm,
unlike the closely related activin which induces axial
tissues. This result confirms those of Koster et al.
(1991), who treated animal caps with recombinant
Xenopus BMP-4. We also find, however, that the action
of XBMP-4 is 'dominant' over that of activin. In this
respect, XBMP-4 differs from basic FGF, another
ventral inducer, where simultaneous treatment with
FGF and activin results in activin-like responses
(Cooke, 1989). The dominance of XBMP-4 over activin
may account for the ability of injected XBMP-4 RNA
completely to 'ventralize' intact Xenopus embryos. It is
interesting, however, that blastopore formation in such
embryos can occur perfectly normally. This contrasts
with embryos ventralized by UV irradiation and
suggests that XBMP-4-induced ventralization occurs
after the onset of gastrulation.
Materials and methods
Polymerase chain reaction
To identify additional members of the TGF-/^activin family
that have mesoderm-inducing activity, we designed degenerate primers based on the known sequences of mammalian
activins A and B for use in the polymerase chain reaction
(PCR). The sequences of the primers are shown below:
A
5' TGGAACGACTGGATGATGGC
3'
T T
T T
B
5' GCACCCACACTCCTCCACAATCAT
G
G
3'
Thefirstprimer corresponds to the N-tenninal region of the
mature activin A protein, and the second to the C-terminal
region (Fig. 1C). DNA to be amplified was Xenopus genomic
DNA (1 fA of 1 mg ml" 1 DNA) or cDNA made from
poly(A)+ RNA derived from the Xenopus XTC cell line (5 /d
of reaction product from a reverse transcription reaction using
3 ng poly(A)+ RNA in a volume of 30 fA). For each PCR
reaction, we mixed DNA with 0.5 [A of 5 U ml" 1 Taq DNA
polymerase, 10 /il of 5xTaq polymerase buffer (0.25 M TrisHC1 pH 8.3, 0.375 M KC1,15 mM MgCl2, 50 mM DTT, 0.625
mM dNTPs) and 1 fA of each primer at 1 mg ml"1. The final
volume was adjusted to 50 u\ with water. Thirty cycles of
amplification were performed, each consisting of denaturation at 94°C for 1 minute, annealing at 52°C for 1.5 minutes
and elongation at 72°C for 1.5 minutes. The final elongation
step was extended to 10 minutes.
PCR products were approximately 260 nucleotides. They
were blunt-end cloned into the vector pSP72 and sequenced.
The 86 amino acids encoded by one cloned fragment differed
by only one amino acid from human bone morphogenetic
protein 4 (BMP-4), and this was used for screening an XTC
cDNA library (see below).
cDNA library screening
A Xenopus XTC cell cDNA library prepared in AZAP (the
kind gift of Dr I. B. Dawid, N1H, Bethesda) was plated on E.
coli BB4 cells. 8 x 105 plaques were screened with the cloned
PCR fragment. Three positive clones were isolated and
sequenced, of which the longest was about 1.3 kb. This clone,
pA, contained all but the first 50 amino acids of the coding
region of Xenopus BMP-4 (XBMP-4). To obtain a full-length
cDNA, we used this clone to screen a stage 15/16 Xenopus
cDNA library prepared in AgtlO. 106 plaques were screened,
and those with the longest inserts were selected as described
BMP-4 and mesoderm induction
by Elliott and Green (1989). Two cDNAs were obtained, one
of which was 1.9 kb (XBMP-4.1) and the other 2.3 kb
(XBMP-4.4). Both these cDNAs were subcloned into pBluescript KS+ and XBMP-4.1 was also cloned into pSP64T
(Krieg and Melton, 1984) in both the sense and antisense
orientations to yield, respectively, pSP64T-XBMP-4+ and
pSP64T-XBMP-4-.
Sequencing
XBMP-4.1 was sequenced using a Pharmacia T7 sequencing
kit.
RNAase protections
RNAase protections were carried out essentially as described
by Green et al. (1990). An XBMP-4 antisense probe was
prepared by digesting pA with Hpal, which was then
transcribed with T7 RNA polymerase to give a probe of
approximately 360 bases and a protected fragment of 300
bases, consisting of 200 bases of 3' untranslated region and
100 bases of the C terminus of XBMP-4 (see Fig. 1). Probes
for Xhox3 (Ruiz i Altaba and Melton, 1989) and musclespecific actin (Mohun et al., 1984) were also used. As a
loading control in RNAase protections, we used an antisense
probe for EF-la, which is expressed in all embryonic cells in
the absence of induction (Krieg et al., 1989; see Sargent and
Bennett, 1990).
Northern blots
RNA was extracted from Xenopus embryos and analysed by
northern blotting as described by Sambrook et al. (1989). For
XBMP-4 the probe was a Sad/HinCH fragment containing
most of the non-mature and about half of the mature region of
the protein (see Fig. 1C). To detect actin, RNA blots were
probed with an antisense RNA probe spanning the 3' UTR
and the last protein coding exon of muscle-specific o^actin
(Mohun et al., 1984). To detect globin transcripts, an
antisense RNA probe spanning the 5' HaeUl fragment of the
Xenopus tadpole /?Tl-globin gene was used (Banville et al.,
1983).
Embryos and inducing factors
Embryos of Xenopus laevis were obtained by artificial
fertilization as described by Smith and Slack (1983). They
were chemically dejellied using 2% cysteine hydrochloride
(pH 7.8-8.1), washed and transferred to Petri dishes containing 10% normal amphibian medium (NAM: Slack, 1984). The
embryos were staged according to Nieuwkoop and Faber
(1967). Embryos were dissected using sharpened forceps and
electrolytically sharpened tungsten needles. Treatment of
embryos with LiCl was as described by Cooke and Smith
(1988).
Recombinant human activin A was the generous gift of Dr
G. Wong (Genetics Institute, Massachusetts). Pure recombinant Xenopus bFGF was prepared from an expression
plasmid kindly provided by Drs D. Kimelman and M.W.
Kirschner (University of California, San Francisco; see
Kimelman et al., 1988).
RNA injections
Capped synthetic XBMP-4 mRNA was synthesized from
pSP64T-XBMP-4+ and pSP64T-XBMP-4- to give both the
sense and antisense transcripts. Polyacrylamide gel electrophoresis of the products of in vitro translation of sense RNA
resulted in a band of the expected size (Afr 43 xlO3), while no
band was visible with antisense RNA. Different concentrations of RNA were injected into Xenopus embryos
575
between the one-cell and four-cell stages. Some embryos were
then allowed to develop until stage 38-40, while the animal
pole regions of others were dissected and allowed to develop
in the presence or the absence of inducing factors, as
appropriate.
Histology
Embryos and explants were fixed and processed for histology
as described by Green et al. (1990). 7 pm sections were
stained by the Feulgen/Light Green/Orange G technique of
Cooke (1979).
Results
Isolation and characterization of Xenopus BMP-4
cDNAs
In an attempt to discover potential mesoderm-inducing
factors, we used the polymerase chain reaction to
search for activin-related molecules expressed during
early Xenopus development. Our primers were based
on the N- and C-terminal regions of mammalian
activins, which also resemble members of the BMP
family. PCR of both Xenopus genomic DNA and
cDNA from the XTC cell line gave fragments which
showed high homology to mammalian BMP-4, and we
went on to screen two libraries in order to obtain fulllength cDNAs for Xenopus BMP-4 (see Materials and
Methods).
XBMP-4.1 was completely sequenced, and was found
to be homologous, over most of its length, to the
Xenopus BMP-4n of Koster et al. (1991). The sequences diverged, however, 5' of nucleotide 295 of our
sequence (see Fig. 1A, showing the first 360 nucleotides
of XBMP-4.1). This 5' sequence includes an in-frame
ATG at nucleotide 267 (italics), which would add 12
amino acids to the proXBMP-4 of Koster et al. (1991)
which begins at our nucleotide 303. We suggest,
however, that XBMP-4.1 is derived from an unprocessed RNA. Firstly, there is a 3' splice-site consensus
sequence 8 nucleotides upstream from nucleotide 303
(bold). Secondly, sequence analysis of XBMP-4.4,
which is longer than XBMP-4.1, shows that the extreme
5' region of this cDNA is homologous to human BMP-4
but that it then diverges in the same way as XBMP-4.1
(data not shown). It is possible that XBMP-4.4 contains
the entire intron; our method for selecting the largest
inserts (see Materials and Methods) may inadvertently
have led us to isolate cDNAs representing unprocessed
transcripts.
The amino acid sequence of XBMP-4 (Fig. IB) shows
80% similarity with the human protein (66 mismatches
out of 398), with the highest homology in the C-terminal
TGF-£-like domain (2 mismatches out of 102). Both
XBMP-4 and its human homologue possess an Nterminal signal sequence, characteristic of secretory
proteins, and all four potential asparagine-linked
glycosylation sites are conserved, with an additional site
in Xenopus at Asn 237. Consistent with the expected
secretion of this protein, when synthetic XBMP-4 RNA
is translated in a message-dependent Xenopus egg cellfree system (Matthews and Colman, 1991), the resulting
576
61
121
181
241
L. Dale and others
EcoRI
AaajlT
TGCCGI^GACGCTCTCACTCAGATTAGCAACACGATGGCCCTGACTATCTOATWITCAGC
TCTCCTTGTCTATTATTrorrTrCATCCCGCTCTATCACTT(lATTTTTCTCAGTCTAATC
CCCCCACATCCTCCCTATTTATTTGCA TCTATTTTCTTTCTTCTGCACCCTCCAOAGACA
TCATCATTCCTGffTAACCGAATCHrrCATCCTCATTrTATTATCCCAACTCCTCCTCOCAC
M I P O N R H L M V I L L C Q V L L C C
B
i
KIPCNRHLMV ILLCQVLLGG TNHASLIPDT CKKKVAADIQ GGRRSAQCHE
51
LLRDFEVTLL QMFGU3KRPQ PSKEWWPAY MRDLYRLQSA EEEDELHDIS
101
KEYPERPTSR AHTVRSFHHE EHLENLPSTA ENGNFRFVFH_L2S IPENEVI
151
GSAELRLYRE QIDHCPAWDE CFHRIN1YEV MKPIAANGLM INRLLDTRLI
201
HHimQWESF DVSPAIMRWT RDKQIHHGLA IEVIHLU2IK THQGKHVRIS
251
RSLLPQEDAD WSQMHPLLIT FBHDGRCHAL TRRSKRBPKQ QRPRKKNKHC
301
RRHSLYVDFS DVCWNDHIVA PPCYQAFYCH CDCPFPLADH LMSUOtAIVQ
351
TLVNSVH4SI PKACCVPTEL SAISHLYLDE YDKWLKHYQ EHWECCGCK
SacI
I
HinCII/Hpal
Splice site?
Fig. 1. (A) The first 360 nucleotides of XBMP4.1. The first
ATG in the open reading frame is in italics and the
potential splice site mentioned in the text is in bold. (B)
The amino acid sequence of Xenopus BMP-4. Potential Nlinked glycosylation sites are underlined. Asterisk marks
the suggested cleavage site of the mature protein. (C) Map
of XBMP-4.1. The protein-coding region is boxed, with the
mature region of the protein shown in heavier stipple. The
potential splice site is indicated. The northern blot probe
was the indicated Sacl/HinCll fragment and an RNAase
protection probe was made by transcribing in the antisense
direction to the Hpal site. The PCR primers A and B are
also shown.
protein is both segregated within the endoplasmic
reticulum and glycosylated (data not shown). Active
human BMP-4 has been isolated and shown to comprise
the C-terminal 116 amino acids (Hammonds et al.,
1991), with cleavage from proBMP-4 occurring after the
amino acid sequence RAKR. Since a similar sequence
is found in our clone at amino acids 284-287 (RSKR),
we expect mature XBMP-4 to comprise a dimer of the
C-terminal 114 amino acids. Fig. 1C shows a map of
XBMP-4 indicating the probes used for RNAase
protection analyses and northern blots.
Expression of Xenopus BMP-4
RNAase protection analysis (Fig. 2A) showed that
zygotic expression of XBMP-4 begins at the midblastula transition and persists at least until stage 34. As
expected from PCR analysis and screening of the XTC
cDNA library, transcripts are also present in XTC cells.
Further analyses showed that low levels of maternal
XBMP-4 mRNA are also detectable (Fig. 2B). This
expression pattern differs slightly from that of BMP-4r
(Koster et al., 1991), where there is only a slight
increase in RNA levels after the mid-blastula transition.
XBMP-4 transcripts were studied by northern blot
analysis of RNA samples from fertilized eggs and late
gastrula-staged embryos (Fig. 2C). As expected from
the RNAase protection analysis described above, we
obtained a much stronger signal with late-gastrula RNA
than with unfertilized egg RNA. Two transcripts were
detected, one with an apparent size of 1.9 kb, and one
of about 3.1 kb. This larger RNA may be the result of
alternative splicing or may represent a close homologue
of the 1.9 kb transcript. Such a homologue has been
identified by Koster et al. (1991) and, from the
sequence of this gene, we might anticipate hybridisation
with our probe. However, K6ster et al. (1991) have
provided evidence that the RNA for their clone is
similarly represented in both the maternal and zygotic
pool, while the larger transcript in Fig. 2C is clearly
more abundant in the zygotic pool than in the maternal
pool.
The spatial expression of XBMP-4 at the early
gastrula stage was studied by dissection of embryos into
five regions (animal pole, vegetal pole, dorsal marginal
zone, lateral marginal zone and ventral marginal zone)
followed by RNAase protection analysis. Although in
one experiment levels were lower in the animal pole,
and in another in the lateral marginal zone, overall our
results suggest that expression occurs throughout the
early gastrula (Fig. 3).
Injection of XBMP-4 'ventralizes' Xenopus embryos
To investigate the function of XBMP-4 during Xenopus
development, we injected 1.5 - 2.0 ng XBMP-4 RNA
into the animal hemispheres of fertilized eggs. AH
embryos injected in this way developed normally up to
the early gastrula stage and formed a dorsal lip, but the
development of some of those receiving the higher
concentrations became slower at this stage, and the
blastopore did not close (Fig. 4A, B). Sections of
embryos (Fig. 4C, D) in which the progress of
gastrulation was delayed resembled those of embryos in
which ectopic mesoderm had formed in the animal cap,
in response to injection of Brachyury RNA (V. T.
Cunliffe and J.C.S., unpublished data), or to intrablastocoelic injection of inducing factors (Cooke et al.,
1987; Cooke and Smith, 1989). Even when this did not
happen, however, by stage 40 virtually all injected
embryos appeared extremely abnormal (Fig. 4E, F).
Superficially they resembled the 'grade 0' embryos
caused by UV irradiation of the vegetal hemisphere of
fertilized eggs, and we were able to use the 'Dorsoanterior Index' (DAI) of Kao and Elinson (1988) to
reveal a graded response resulting from injections of
different amounts of RNA (Table 1). In this index, '5'
represents a normal embryo, '0' a completely ventralized case and '10' a completely dorsalized individual,
and our results showed that a 100-fold dilution of
injected RNA (1500 pg to 15 pg) increased the mean
DAI of the resulting embryos from 0.39 to 3.32.
Control injections of antisense XBMP-4 RNA (see Fig.
4 and Table 1), and RNA encoding Vgl (Dale et al.,
BMP-4 and mesoderm induction
2
N
577
3
13
is
DC
^H
^^
"1
O H JO J J «
QO &\
^^
^^
^H
f>
1^
^rf
s
S £j
^N UU
f
XBMP-4
I
28S
18S
EF-la
B
00
fif
XBMP-4
(W^
EF-la
00
«'•*•"
« •
•
'Mint
Fig. 2. (A) RNAase protection analysis showing expression of XBMP-4 from the late blastula stage (stage 9) until the
tailbud stage (stage 34). XTC cells also express XBMP-4. (B) RNAase protection analysis showing low maternal levels of
XBMP-4 with zygotic expression beginning around the mid-blastula transition. (C) Northern blot analysis of 10 fig total
RNA from unfertilized Xenopus eggs and stage 12 late gastrulae. Two transcripts (3.1 and 1.9 kb) are visible at the late
gastrula stage. In the unfertilized egg sample only the smaller transcript is visible.
1989) and prolactin (Leaf et al., 1990) did not perturb
development; in each case the resulting embryos had a
mean DAI of greater than 4.75 (data not shown).
More direct evidence that injection of XBMP-4
causes ventralization comes from histological examination of 'grade 0' injected embryos. In these cases
neither notochord nor muscle could be identified;
rather, they appear to produce an excess of ventral
mesoderm including large numbers of cells resembling
red blood cells (Fig. 4G, H). Lack of notochord and
muscle was confirmed by whole-mount immunocytochemistry with the monoclonal antibodies MZ15 (Smith
and Watt, 1985) and 12/101 (Kintner and Brockes, 1984)
(data not shown), and a large reduction in muscle was
also indicated by RNAase protection analysis of
injected embryos at stage 20 (data not shown) as well as
northern blot analysis performed at stage 40 (Fig. 8). To
determine whether XBMP-4 RNA injection causes
production of additional ventral mesoderm, as well as
loss of dorsal tissue, we examined levels of Xhox3 (Ruiz
i Altaba and Melton, 1989) and globin (Banville et al.,
1983) mRNA in injected embryos. Expression of both
these genes is restricted to posterior and/or ventral
mesoderm in normal embryos and the expression of
578
L. Dale and others
Table 2. Injection of 500 pg XBMP-4 RNA into
dorsal blastomeres causes more extreme ventralization
than injection into ventral blastomeres
DAI
XBMP-4
Injection position
0
1
2
3
4
5
Mean
Dorsal
Ventral
19
3
9
5
3
7
0
7
2
7
0
1
0.70
2.43
Numbers in Table indicate number of cases at each DAI.
In the same experiment injection of 1500 pg sense XBMP-4 into
13 embryos gave a DAI of 0.00, while injection of 500 pg
antisense RNA into dorsal and ventral blastomeres gave DAIs of
5.0. Prolactin and Vgl RNAs were similarly without effect.
EF-la
was greater than 4.75 irrespective of the site of
injection.
Fig. 3. Regional expression of XBMP-4. Xenopus early
gastrulae were dissected into animal pole (AP), vegetal
pole (VP), dorsal marginal zone (DMZ), lateral marginal
zone (LMZ) and ventral marginal zone (VMZ) regions and
analysed by RNAase protection for XBMP-4 and EF-la
expression. Similar levels of XBMP-4 RNA are present in
all regions.
Table 1. Injection of different amounts of XBMP-4
RNA gives a graded series of defects
DAI
DUDJ RJJA
pg
0
1
2
3
4
5
Mean
1500
300
75
15
77
41
9
9
10
5
7
4
2
7
9
12
5
3
14
7
2
3
0
0
9
31
0.39
0.68
2.67
3.32
12
8
Numbers in Table indicates number of cases at each DAI (see
Kao and Elinson, 1988, for explanation of the dorsoanterior
index).
In the same experiment injection of 1500 pg antisense XBMP-4
into 39 embryos gave a DAI of 4.98.
both is elevated in UV-irradiated embryos (Cooke and
Smith, 1987; Ruiz i Altaba and Melton, 1989), and we
find that the same is true in embryos injected with
XBMP-4 RNA (Figs 5 and 8).
These results indicate that injection of XBMP-4 RNA
causes ventralization of Xenopus embryos, with a
reduction in the amount of dorsal mesoderm being
complemented by an increase in ventral mesoderm.
One prediction from this is that injection of RNA into
the dorsal side of the embryo should have a more
dramatic effect than injection into the ventral side. We
therefore injected 0.5 ng RNA into either a single
dorsal or a single ventral blastomere at the 4-cell stage.
Table 2 shows that injection into a dorsal blastomere did
result in more extreme ventralization; whereas embryos
resulting from dorsal injections had a mean DAI of 0.7,
those resulting from ventral injections had a mean DAI
of 2.67. Once again the mean DAI of control injections
Injection of XBMP-4 RNA inhibits the response of
animal caps to activin to a greater extent than to FGF
In the experiments described above, XBMP-4 might
cause ventralization of Xenopus embryos by interfering
with the action of an endogenous dorsal mesoderminducing factor, and one plausible candidate for such a
molecule is activin. When added to isolated animal pole
cells in vitro activin induces a wide range of mesodermal
tissues, including notochord and muscle, in a concentration-dependent manner (Green et al., 1990). By
contrast, we would not expect XBMP-4 to inhibit the
action of a ventral mesoderm-inducing factor such as
bFGF (Slack et al., 1987; Green et al., 1990; Amaya et
al., 1991). To examine this, animal caps derived from
embryos injected with either sense or antisense XBMP4 RNA, or from uninjected embryos, were treated with
activin, FGF, or a control solution.
The first indication that injection of XBMP-4 RNA
inhibits the response to activin was that the elongation
of animal pole regions that is observed in response to
this factor (Symes and Smith, 1987) was inhibited (not
shown). When such animal caps were allowed to
Fig. 4. Effects of injecting 2 ng XBMP-4 RNA into
fertilized Xenopus eggs. (A) The blastopores of embryos
injected with sense XBMP-4 RNA do not close normally,
unlike those injected with antisense RNA (B). (C) Section
of one of the embryos in A. This resembles sections of
embryos that have been injected with Brachyury RNA
(V.T. Cunliffe and J.C.S., unpublished data) or which have
received intrablastocoelic injections of mesoderm-inducing
factors (Cooke and Smith, 1989). There is a thick pad of
mesoderm-like tissue at the animal pole to which the
endodermal mass adheres strongly. This obliterates the
blastocoel and creates a compensatory cavity at the vegetal
hemisphere. (D) Section of an embryo that received an
injection of antisense XBMP-4 RNA. The blastopore has
closed normally. (E) Embryos injected with sense XBMP-4
allowed to develop to the equivalent of stage 39 appear
ventralized compared with controls, which received
injections of antisense RNA (F). (G) Sections of embryos
shown in E reveal no notochord or muscle, unlike (H)
sections of those in F. Scale bars in C and D are 100 /m\,
and also apply to G and H. Scale bar in F is 1 mm, and
also applies to A, B and E.
BMP-4 and mesoderm induction
579
580
L. Dale and others
ise
c
B
pM
<
t
EF-la
•
Fig. 5. Levels of Xhox3 are
elevated in embryos injected
with sense XBMP-4 RNA.
Embryos injected with 1.5 ng
sense or antisense XBMP-4
RNA were allowed to develop
to stage 12 (late gastrula).
Xhox3 expression was analysed
by RNAase protection.
develop further, histological analysis showed that they
did not form significant amounts of muscle or notochord but either appeared uninduced or resembled the
weak 'ventral' inductions formed in response to low
concentrations of FGF (Fig. 6 and Table 3). By
contrast, injection of XBMP-4 RNA appeared to have
B
little effect on induction by FGF, where the animal caps
formed structures similar to those differentiating in
response to FGF alone. Animal caps derived from
embryos injected with XBMP-4 RNA and then allowed
to develop in the absence of inducing factors appeared
uninduced or showed weak ventral-like inductions,
which were distinct from those obtained with FGF
alone (Fig. 6 and Table 3). As controls, animal caps
derived from uninjected embryos or embryos receiving
antisense XBMP-4 RNA were treated with activin,
FGF or control solutions; the results were similar to
those reported by Green et al. (1990) (see Fig. 6 and
Table 3).
The above data were confirmed by molecular analysis
of treated animal caps. Induction of muscle-specific
actin in response to activin was greatly reduced in
animal caps derived from embryos receiving injections
of XBMP-4 RNA (Fig. 7A). Animal caps derived from
embryos injected with XBMP-4 RNA, but not exposed
to exogenous growth factors, express very low levels of
muscle-specific actin (Fig. 7A). As with the histological
data, this suggests that XBMP-4 is itself an inducer of
mesoderm. This is confirmed by data presented in Fig.
7B. Xhox3 is most strongly expressed in ventral and
Svv.:
Fig. 6. Histological analysis of animal pole regions from uninjected embryos (C), (F), (I), or embryos injected with sense
(A), (D), (G), or antisense (B), (E), (H) XBMP-4 RNA. The animal caps were cultured in the absence of inducing factors
(G), (H), (I), or treated with 10 units ml" 1 recombinant activin A (A), (B), (C) or 50 units ml" 1 recombinant Xenopus
basic FGF (D), (E), (F) (see Cooke et al., 1987, for definition of units of inducing activity). They were cultured until the
equivalent of stage 41 and then processed for histology. XBMP-4 RNA has little effect on induction by FGF, but
significantly inhibits the response to activin. XBMP-4 RNA itself produces only a weak response at the histological level.
Scale bar in I is 100 fan, and applies to all other frames.
BMP-4 and mesoderm induction
Activin
Table 3. Injection of XBMP-4 RNA inhibits the
response of animal pole regions to activin, but has
little effect on induction by FGF
Treatment
Axial
Ventral
Con
11
Response
Uninduced
B
c
<
O
1/3
Sense XBMP-4 RNA
Activin
0
FGF
0
No inducer
0
8
22
9
Antisense XBMP-4 RNA
Activin
16
FGF
0
No inducer
0
0
11
0
No RNA injection
Activin
13
FGF
0
No inducer
0
1
16
0
581
©
U
8
•a
us
P
Muscle
actin
•«
0
If
1
1IS
Table indicates numbers of explants falling into each category.
Xenopus eggs were injected with 1.5 ng sense or antisense
XBMP-4 RNA or were left uninjected. At stage 8 (mid-blastula)
animal caps were dissected and cultured until the equivalent of
stage 40 in the absence of inducing factors or in the presence of 10
units ml" 1 activin A or 50 units ml" 1 FGF. After fixation and
sectioning they were classified as 'uninduced', 'ventral mesoderm'
(lacking muscle and notochord) or 'axial mesoderm' (containing
muscle and/or notochord).
posterior mesoderm, and animal caps from embryos
injected with XBMP-4, but not exposed to exogenous
growth factors, express levels of Xhox3 similar to those
occurring in response to bFGF. This suggests that
XBMP-4 is an inducer of ventral mesoderm. These
experiments also confirmed that XBMP-4 mRNA
injection 'ventralizes' the response to activin, because
such animal caps express high levels of Xhox3.
Ventralization caused by BMP-4 cannot be rescued by
LiCl
Xenopus embryos can also be ventralized by UVirradiation of the vegetal hemisphere shortly after
fertilization (Scharf and Gerhart, 1983), a procedure
that blocks the formation of the dorsal mesoderminducing centre in the vegetal hemisphere (Gimlich and
Gerhart, 1984). This block can be 'reversed' by
exposing UV-irradiated embryos to solutions of lithium
chloride during early cleavage stages (Kao et al., 1986).
As a result, embryos become 'hyperdorsal', with dorsal
mesoderm differentiating from all sectors of the
marginal zone (Kao and Elinson, 1988). The first signs
of hyperdorsalization are observed at the early gastrula
stage, when the blastoporal lip of the invaginating
mesoderm is found all round the vegetal hemisphere of
LiCl-treated embryos but localized to the dorsal
quadrant in normal embryos. LiCl is believed to act by
sensitizing the response of animal cap cells to ventral
mesoderm-inducing signals (e.g. FGF or low concentrations of activin), such that they respond as though
they were exposed to a dorsal signal (e.g. a high
concentration of activin: Kao and Elinson, 1988; Slack
et al., 1988; Cooke et al., 1989).
Cytoskeletol
actin
tit
Activin
B
FGF
<
Xhox3 #
Con
i
on
•i t f
EF-la
Fig. 7. XBMP-4 RNA inhibits muscle-specific actin
expression in response to mesoderm induction but
enhances Xhox3 expression. (A) Mid-blastula animal pole
regions derived from control embryos or embryos injected
with sense or antisense XBMP-4 RNA were exposed to 10
units ml" 1 activin A, 50 units ml" 1 Xenopus recombinant
FGF, or a control solution. They were cultured until the
equivalent of stage 20 and actin gene expression was
analysed by RNAase protection. XBMP-4 RNA itself is a
weak inducer of muscle-specific actin gene expression, but
it reduces muscle-specific actin expression in animal caps
treated with FGF and apparently abolishes expression in
response to activin. (B) Mid-blastula animal pole regions
derived from embryos injected with sense or antisense
XBMP-4 RNA were exposed to 10 units ml" 1 activin A, 50
units ml" 1 Xenopus recombinant FGF, or a control
solution. They were cultured until the equivalent of stage
12 and Xhox3 gene expression was then analysed by
RNAase protection. XBMP-4 RNA itself, like FGF, is a
strong inducerNof Xhox3 gene expression, and it elevates
the expression seen in response to activin.
582
L. Dale and others
Table 4. Lithium chloride treatment does not significantly 'rescue' embryos injected with 1500 pg XBMP-4 RNA
DAI
Treatment
0
l
2
3
4
5
6
1
8
9
10
Mean
-LiCl
Sense RNA
Antisense
54
0
9
0
14
1
7
0
0
1
0
62
0
0
0
0
0
0
0
0
0
0
0.69
4.94
+LiCI
Sense RNA
Antisense
35
0
9
0
5
0
0
0
0
0
0
3
0
0
0
5
0
11
0
0
0
0.39
7.78
8
Numbers in Table indicate number of cases at each DAI.
Control
Antisense
Sense
Cytoskeletal
Actin
Muscle
Actin
Globin
Fig. 8. Globin expression is elevated, and muscle-specific
actin expression reduced, in embryos receiving injections of
sense XBMP-4 RNA. This 'ventralization' is not rescued
by LiCl treatment of embryos. Fertilized eggs received
injections of 1.5 ng of sense, or antisense, XBMP-4 RNA,
and about half of these, together with uninjected controls,
were subsequently exposed to LiCl at the 64- to 128-cell
stages. The embryos were allowed to develop to stage 40,
when RNA was extracted and analysed by northern
blotting. This figure also illustrates the effect of LiCl on
globin gene expression. Cooke and Smith (1988) showed
that LiCl-treated embryos contain 'substantial blood', but
that this is immature compared with untreated controls.
Consistent with this, comparison of lanes 1 and 2 suggests
that LiCl treatment reduces globin expression somewhat,
but this is not observed in lanes 3 and 4. The reason for
this difference is not clear.
We examined whether embryos ventralized by injection of BMP-4 RNA could be rescued in this way by
exposing them to 0.3 M LiCl at the 64- to 128-cell stage.
The results were assessed at stage 38 by the DAI index
(Table 4) and by northern blot analysis using probes for
actin and globin (Fig. 8). Both methods of analysis
showed that LiCl treatment cannot rescue BMP-4
injected embryos. Table 4 shows that antisense-injected
embryos were hyperdorsalized by exposure to LiCl,
with a DAI of 7.78 compared with a control value of
4.94. Histological examination showed that these
embryos differentiated more notochord at the expense
of muscle ( data mnt shown\. and1 a sevp.;re. reduction in
muscle differentiation is reflected in the reduced levels
of muscle-specific actin expression shown in Fig. 8. By
contrast, exposure of XBMP-4 injected embryos to LiCl
had no effect on the DAI index (0.69 in the absence of
LiCl compared to 0.39 in the presence of LiCl), and
histological examination confirmed that the embryos
remained ventralized, differentiating blood and mesothelium at the expense of muscle and notochord (data
not shown). This is also confirmed in Fig. 8, which
shows that exposure to LiCl has no effect on the
enhanced expression of a tadpole /J-globin in XBMP-4
injected embryos. Interestingly, however, in embryos
injected with both sense and antisense XBMP-4 RNA,
the blastopore Up appeared around all regions of the
marginal zone as if presaging hyperdorsal development.
Like our earlier observation that XBMP-4 injection can
cause ventralization even though the blastopore lip
forms normally (see above), this result suggests that
XBMP-4 acts late to produce ventralized embryos.
Discussion
The results described in this paper add a further level of
complexity to the analysis of mesoderm induction in
Xenopus. In a search for additional mesoderm-inducing
factors, we have used the polymerase chain reaction
followed by cDNA library screening to obtain a fulllength cDNA clone for Xenopus bone morphogenetic
protein 4 (XBMP-4). Like Koster et al. (1991) we
observe low levels of maternal mRNA for XBMP-4,
and this is followed by a dramatic increase in RNA at
the late blastula stage. The increase reported by Koster
et al. (1991) was less dramatic than that seen in our Fig.
2, and this may be because their expression study
concentrated on BMP-4r, while our sequence resembles their BMP-4n. At the early gastrula stage
XBMP-4 is expressed at similar levels in all regions of
the embryo.
Bone morphogenetic proteins were originally identified in bone extracts by their ability to induce the
formation of ectopic cartilage and bone following
implantation in rats (Wang et al., 1988). BMP-4
(formerly called BMP-2b) was cloned because of its
homology to the closely related BMP-2, a component of
bone extracts (Wozney et al., 1988), and was subsequently shown to have similar activity (Hammonds et
BMP-4 and mesoderm induction
al., 1991). A recent analysis using in situ hybridization
has implicated BMP-4 in diverse processes during
murine embryogenesis, including development of the
limbs, heart, face and pituitary gland (Jones et al.,
1991). Although expression of this RNA in pregastrula
mouse embryos was not identified, in early neurulae it
was localized to the' posterior and ventral mesoderm
suggesting a role for BMP-4 in the development of
mesoderm in vertebrates. The results we have presented for Xenopus suggest that this is indeed the case.
Using morphological, histological and molecular
criteria, we show that overexpression of XBMP-4 by
microinjection of transcripts into the animal hemisphere of the fertilized egg causes 'ventralization' of the
resulting embryo. In these embryos, dorsal mesodermal
tissues such as notochord and muscle are severely
reduced and replaced by ventral mesodermal tissues
such as blood. Consistent with this, injection of
transcripts into the dorsal half of the early embryo has a
more dramatic effect than injection into the ventral
half. Furthermore, like Koster et al. (1991), we show
that XBMP-4 can act as a ventral mesoderm-inducing
factor. Thus, injection of XBMP-4 mRNA into the
animal hemisphere of the Xenopus embryo followed by
dissection of the animal cap at the mid-blastula stage
results in the formation of ventral mesodermal cell
types, as assayed both by conventional histology and by
the level of activation of Xhox3, which in normal
embryos is most highly expressed in posterior and
ventral mesoderm (Ruiz i Altaba and Melton, 1989). In
this respect XBMP-4 differs from the activins, to which
it is closely related, because the activins preferentially
induce anterior and dorsal mesoderm (Green et al.,
1990). Rather, the action of XBMP-4 more resembles
that of members of the FGF family (Slack et al., 1987;
Kimelman and Kirschner, 1987).
It is possible that the ability of XBMP-4 to induce
ventral mesoderm is responsible for its ability to
ventralize whole embryos. In order to cause ventralization in this way it is necessary that the ventralizing
effect of XBMP-4 is 'dominant' over treatment with
dorsal mesoderm-inducing factors such as activin. This
is observed in experiments in which animal caps derived
from embryos receiving injections of XBMP-4 RNA are
treated with activin, and the effect is demonstrated
most dramatically by the observation that injection of
XBMP-4 RNA can even ventralize embryos that
subsequently are treated with the dorsalizing agent
LiCl. This dominant effect of a ventral mesoderminducing factor contrasts with work in which activin and
FGF are applied simultaneously to animal cap tissue;
here, the ability of activin to induce animal pole cells to
form Spemann's organizer is not compromised by the
ventral mesoderm-inducing factor bFGF (Cooke,
1989).
Superficially, XBMP-4-injected embryos resemble
those resulting from UV irradiation of the vegetal
hemisphere soon after fertilization (Scharf and Gerhart, 1983). UV irradiation blocks the cortical rotation
which is responsible for the formation of a dorsovegetal
inducing centre, which in turn induces dorsal organizer
583
mesoderm from the overlying marginal zone (Gimlich
and Gerhart, 1984). However, there are clear differences in the gastrulation movements of UV-irradiated
and XBMP-4-injected embryos. UV-irradiated embryos form a 'ventral-type' blastoporal lip which
appears late and synchronously around the whole
circumference of the embryo (Scharf and Gerhart,
1983). By contrast, XBMP-4 injected embryos form a
dorsal lip at the same time as controls. Although in
some cases gastrulation then arrests, due to formation
of ectopic mesoderm in the animal hemisphere of the
embryo (see Cooke et al., 1987; Cooke and Smith,
1989; V. T. Cunliffe and J.C.S., unpublished data), in
most cases the blastopore closes on a time scale similar
to that of embryos injected with antisense RNA.
XBMP-4 injected embryos also differ from UVirradiated embryos in that they cannot be 'rescued' by
exposure to LiCl, even though in both types of embryo
LiCl causes the formation of a precociously complete
blastoporal lip around the circumference of the entire
vegetal hemisphere.
Together, these results suggest that the ventralization
caused by XBMP-4 is a late event, occurring after the
onset of gastrulation. The mechanism by which this
occurs is unclear, although one possibility is that the
action of XBMP-4 resembles that of polysulphonated
compounds such as trypan blue and suramin. If injected
into the blastocoels of embryos when the dorsal lip first
appears, these compounds inhibit convergent extension
movements while allowing blastopore closure. The
resulting embryos fail to differentiate dorsal mesodermal tissues and become ventralized (Gerhart et al.,
1989). If, however, these agents are injected after the
end of gastrulation, when convergent extension has
been completed, they have no effect on the differentiation of dorsal mesoderm. Like XBMP-4, but unlike
UV-irradiation, both trypan blue and suramin can
reverse the hyperdorsalizing effects of LiCl.
It is not clear how trypan blue and suramin inhibit
convergent extension and cause ventralization,
although suramin is known to disrupt the binding of
some growth factors to their receptors. These include
members of all three families of mesoderm-inducing
factor such as FGF and TGF-0 (Coffey et al., 1987), and
members of the Wnt family (Papkoff and Schryver,
1990; Chakrabarti et al., 1992). It is possible that the
continued presence of a member of one of these
families is required for convergent extension and dorsal
development and that an excess of exogenous XBMP-4
competes for the receptor for such a protein. This is
under investigation.
The role of XBMP-4 in Xenopus development will
remain unknown until it becomes possible to eliminate
the protein or its receptor from the embryo. It is clear,
however, that the action of XBMP-4 must be considered in the context of the other inducing factors
known to be present in the embryo, such as members of
the activin, FGF and Wnt families as well as other bone
morphogenetic proteins. It will be a formidable task to
understand how the functions of all these factors are
coordinated to form the normal embryo.
584
L. Dale and others
This work is supported by the Medical Research Council.
L.D. thanks Professor Alan Colman for support. J.C.S.
thanks Dr Igor Dawid for the XTC cDNA library. We also
thank Drs Rob Grainger and Margaret Saha for the Xhox3
probe and Roger Patient and Adnan Ruazi for the globin
probe.
References
Amaya, E., Musci, T. J. and Kirschner, M. W. (1991). Expression of
a dominant negative mutant of the FGF receptor disrupts
mesoderm formation in Xenopus embryos. Cell 66, 257-270.
Asashima, M., Nakano, H., Shimada, K., Klnoshlta, K., Ishii, K.,
ShlbaJ, H. and Ueno, N. (1990). Mesodrmal induction in early
amphibian embryos by activin A (erythroid differentiation factor).
Roux's Arch, devl Biol. 198, 330-335.
Asashima, M., Nakano, H., Uchiyama, H., Sngino, H., Nakamura,
T., Eto, Y., Ejima, D., Nishimatsu, S.-I., Ueno, N. and Klnoshlu,
K. (1991). Presence of activin (erythroid differentiation factor) in
unfertilized eggs and blasrulae of Xenopus laevis. Proc. Nad. Acad.
Sci. U S A 88, 6511-6514.
Banville, D., Kay, R. M., Harris, R. and Williams, J. G. (1983). The
nucleotide sequence of the mRNA encoding a tadpole /J-globin
polypeptide of Xenopus laevis. J. Biol. Chem. 258, 7924-7927.
Chakrabartl, A., Matthews, G., Colman, A. and Dale, L. (1992).
Secretory and inductive properties of Drosophila wingless (Dwnt1) protein in Xenopus oocytes and embryos. Development 115, 355370.
Cho, K. W. Y. and De Roberts, E. M. (1990). Differential activation
of Xenopus homeobox genes by mesoderm-inducing factors and
retinoic acid. Genes Dev. 4, 1910-1916.
Christian, J. L., McMahon, J. A., McMahon, A. P. and Moon, R. T.
(1991). Xwnt-8, a Xenopus wnt-l/int-1 related gene responsive to
mesoderm inducing growth factors, may play a role in ventral
mesodermal patterning during embryogenesis. Development 111,
1045-1055.
Coffey, R. J., Leof, E. B., Shipley, G. D. and Moses, H. L. (1987).
Suramin inhibition of growth factor receptor binding and
mitogenicity in AKR-2B cells. /. Cell Physiol. 132, 143-148.
Cooke, J. (1979). Cell number in relation to primary pattern
formation in the embryo of Xenopus laevis. I. The cell cycle during
new pattern formation in response to implanted organisers. J.
Embryol. Exp. Morph. 51, 165-182.
Cooke, J. (1989). Mesoderm-inducing factors and Spemann's
organiser phenomenon in amphibian development. Development
107, 229-241.
Cooke, J. and Smith, E. J. (1988). The restrictive effect of early
exposure to lithium upon body pattern in Xenopus development
studied by quantitative anatomy and immunofluorescence.
Development 102, 85-99.
Cooke, J. and Smith, J. C. (1987). The midblastula cell cycle
transition and the character of mesoderm in u.v.-induced nonaxial
Xenopus development. Development 99, 197-210.
Cooke, J. and Smith, J. C. (1989). Gastrulation and larval pattern in
Xenopus after blastocoelic injection of a Xenopus-dcnvcd inducing
factor: experiments testing models for the normal organization of
mesoderm. Dev. Biol. 131, 383-400.
Cooke, J., Smith, J. C , Smith, E. J. and Yaqoob, M. (1987). The
orgaization of mesodermal pattern in Xenopus laevis: experiments
using a Xenopus mesoderm-inducing factor. Development 101, 893908.
Cooke, J., Symes, K. and Smith, E. J. (1989). Potentiation by the
lithium ion of morphogenetic responses to a Xenopus inducing
factor. Development 105, 549-558.
Dale, L., Matthews, G., Tabe, L. and Colman, A. (1989).
Developmental expression of the protein product of Vgl, a
localized maternal mRNA in the frog Xenopus laevis. EMBO J. 8,
1057-1065.
Dale, L. and Slack, J. M. W. (1987). Regional specification within the
mesoderm of early embryos of Xenopus laevis. Development 100,
279-295.
Dale, L., Smith, J. C. and Slack, J. M. W. (1985). Mesoderm
induction in Xenopus laevis: A quantitative study using a cell
lineage label and tissue specific antibodies. J. Embryol. Exp.
Morph. 89, 289-312.
Dawid, I. B. and Sargent, T. D. (1990). The role of growth factors in
embryonic induction in amphibians. Curr. Top. Dev. Biol. 24, 3155.
Elliott, R. M. and Green, C. D. (1989). A simple purification
procedure for A gt bacteriophage DNA with hybridization size
screening for isolation of longest length cDNA clones. Anal.
Biochem. 183, 89-93.
Gerhart, J., Danllchik, M., Donlach, T., Roberts, S., Rownlng, B.
and Stewart, R. (1989). Cortical rotation of the Xenopus egg:
consequences for the anterior-posterior pattern of embryonic
dorsal development. Development Suppl., 37-51.
Gimlich, R. L. and Gerhart, J. (1984). Early cellular interactions
promote embryonic axis formation in Xenopus laevis. Dev. Biol.
104, 117-130.
Green, J. B. A., Howes, G., Symes, K., Cooke, J. and Smith, J. C.
(1990). The biological effects of XTC-MIF: quantitative
comparison with Xenopus bFGF. Development 108, 173-183.
Hammonds, G. R., Schwall, R., Dudley, A., Berkemeier, L., Lai, C ,
Lee, J., Cunningham, N., Reddi, A. H., Wood, W. I. and Mason,
A. J. (1991). Bone-inducing activity of mature BMP-2b produced
from a hybrid BMP-2a/2b precursor. Mol. Endocrinol. 5,149-155.
Jones, C. M., Lyons, K. M. and Hogan, B. L. M. (1991). Involvement
of Bone Morphogenetic Protein-4 (BMP-4) and Vgr-1 in
morphogenesis and neurogenesis in the mouse. Development 111,
531-542.
Jones, E. A. and Woodland, H. R. (1987). The development of animal
cap cells in Xenopus: a measure of the start of animal cap
competence to form mesoderm. Development 101, 557-563.
Kao, K. R. and Elinson, R. P. (1988). The entire mesodermal mantle
behaves as a Spemann's organizer in dorsoanterior enhanced
Xenopus ktevis embryos. Dev. Biol. 127, 64-77.
Kao, K. R., Masul, Y. and Elinson, R. P. (1986). Lithium-induced
respecification of pattern in Xenopus laevis embryos. Nature 322,
371-373.
Kimelman, D., Abraham, J. A., Haaparanta, T., PallsJ, T. M. and
Kirschner, M. W. (1988). The presence of fibroblast growth factor
in the frog egg: its role as a natural mesoderm inducer. Science 242,
1053-1056.
Kimelman, D. and Kirschner, M. (1987). Synergistic induction of
mesoderm by FGF and TGF-beta and the identification of an
mRNA coding for FGF in the early Xenopus embryo. Cell SI, 869877.
Klntner, C. R. and Brockes, J. P. (1984). Monoclonal antibodies
identify blastemal cells derived from differentiating muscle in newt
limb regeneration. Nature 308, 67-69.
Koster, M., Plessow, S., Clement, J. H., Lorenz, A., Tiedemann, H.
and Kndchel, W. (1991). Bone morphogenetic protein 4 (BMP-4), a
member of the TGF-/3 family, in early embryos of Xenopus laevis:
analysis of mesoderm-inducing activity. Mech. Dev. 33, 191-199.
Krleg, P. A. and Melton, D. A. (1984). Functional messenger RNAs
are produced by SP6 in vitro transcription of cloned DNAs. Nucl.
Acids Res. 12, 7057-7070.
Krleg, P. A., Varnum, S. M., Wormlngton, W. M. and Melton, D. A.
(1989). The mRNA encoding elongation factor \-a (EF-la) is a
major transcript at the midblastula transition in Xenopus. Dev. Biol
133, 93-100.
Leaf, D. S., Roberts, S. J., Gerhart, J. C. and Moore, H-P. (1990).
The secretory pathway is blocked between the trans-Golgi and the
plasma membrane during meiotic maturation in Xenopus oocytes.
Dev. Biol. 141, 1-12.
Lyons, K., Graycar, J. L., Lee, A., Hashml, S., Lindqnist, P. B.,
Chen, E. Y., Hogan, B. L. M. and Derynck, R. (1989). Vgr-1, a
mammalian gene related to Xenopus Vg-1, is a member of the
transforming growth factor p* gene superfamily. Proc. Nad. Acad.
Sci. US Ate, 4554-4558.
Matthews, G. and Colman, A. (1991). A highly efficient, cell-free
translation/translocation system prepared from Xenopus eggs.
Nucl. Acids Res. 19, 6405-6412.
McMahon, A. P. and Moon, R. T. (1989). Expression of the protooncogene int-1 in Xenopus embryos leads to duplication of the
embryonic axis. Cell 58, 1075-1085.
BMP-4 and mesoderm induction
Mohan, T. J., Brennan, S., Da than, N., Fairman, S. and Gordon, J.
B. (1984). Cell type specific activation of actin genes in the early
amphibian embryo. Nature 311, 715-721.
New, H. V. and Smith, J. C. (1990). Inductive interactions in early
amphibian development. Curr. Opin. Cell Biol. 2, 969-974.
Nienwkoop, P. D. (1969). The formation of mesoderm in Urodelean
amphibians. I. Induction by the endoderm. Roux's Arch devl Biol.
162, 341-373.
Nieuwkoop, P. D. and Faber, J., eds (1967). Normal Table of
Xenopus laevis (Daudin) 2nd ed. Amsterdam: North Holland.
Padgett, R. W., St Johnstone, R. D. and Gelbart, W. M. (1987). A
transcript from a Drosophila pattern gene predicts a protein
homologous to the transforming growth factor-beta family. Nature
325, 81-84.
Papkoff, J. and Schryver, J. (1990). Secreted int-1 protein is
associated with the cell surface. Mol. Cell Biol. 10, 2723-2730.
RebagUatl, M. R., Weeks, D. L., Harvey, R. P. and Melton, D. A.
(1985). Identification and cloning of localized maternal RNAs from
Xenopus eggs. Cell 42, 769-777.
Ruiz i Altaba, A. and Melton, D. A. (1989). Interaction between
peptide growth factors and homeobox genes in the establishment of
antero-posterior polarity in frog embryos. Nature 341, 33-38.
Sambrook, J., Fritsch, E. F. and Manlatis, T. (1989). Molecular
Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory
Press.
Sargent, M. G. and Bennett, M. F. (1990). Identification in Xenopus
of a structural homologue of the Drosophila gene snail.
Development 109, 967-973.
Scharf, S. and Gerhart, J. C. (1983). Determination of the dorsoventral axis in eggs of Xenopus laevis: complete rescue of UVimpaired eggs by oblique orientation before first cleavage. Dev.
Biol. 79, 181-198.
Shiorba, R. A., Jtng, N., Sakakura, T. and Godsave, S. F. (1991).
Nuclear translocation of fibroblast growth factor during Xenopus
mesoderm induction. Development 113, 487-493.
Slack, J. M. W. (1984). Regional biosynthetic markers in the early
amphibian embryo. /. Embryol. Exp. Morph. 80, 289-319.
Slack, J. M. W., Darlington, B. G., Heath, J. K. and Godsave, S. F.
(1987). Mesoderm induction in early Xenopus embryos by heparinbinding growth factors. Nature 326, 197-200.
Slack, J. M. W. and Isaacs, H. V. (1989). Presence of basic fibroblast
growth factor in the early Xenopus embryo. Development 105,147153.
Slack, J. M. W., Isaacs, H. V. and Darlington, B. G. (1988). Inductive
effects of fibroblast growth factor and lithium ion on Xenopus
blastula ectoderm. Development 103, 581-590.
Smith, J. C. (1989). Mesoderm induction and mesoderm-inducing
factors in early amphibian development. Development 105, 665677.
Smith, J. C , Price, B. M. J., Van Nimmen, K. and Hoylebroeck, D.
(1990). Identification of a potent Xenopus mesoderm-inducing
factor as a homologue of activin A. Nature 345, 732-734.
Smith, J. C. and Slack, J. M. W. (1983). Dorsalization and neural
585
induction: properties of the organizer in Xenopus laevis. J.
Embryol. Exp. Morph. 78, 299-317.
Smith, J. C. and Watt, F. M. (1985). Biochemical specificity of
Xenopus notochord. Differentiation 29, 109-115.
Smith, W. C. and Harland, R. M. (1991). Injected Xwnt-8 RNA acts
early in Xenopus embryos to promote formation of a vegetal
dorsalizing center. Cell 67, 753-765.
Sokol, S., Christian, J. L., Moon, R. T. and Melton, D. A. (1991).
Injected Wnt RNA induces a complete body axis in Xenopus
embryos. Cell 67, 741-752.
Sokol, S., Wong, G. and Melton, D. A. (1990). A mouse macTophage
factor induces head structures and organizes a body axis in
Xenopus. Science 249, 561-564.
Stewart, R. M. and Gerhart, J. C. (1990). The anterior extent of
dorsal development of the Xenopus embryonic axis depends on the
quantity of organizer in the late blastula. Development 109, 363372.
Symes, K. and Smith, J. C. (1987). Gastrulation movements provide
an early marker of mesoderm induction in Xenopus laevis.
Development 101, 339-349.
Tannahin, D. and Melton, D. A. (1989). Localized synthesis of the
Vgl protein during early Xenopus development. Development 106,
775-785.
Thomsen, G., Wootf, T., Whitman, M., Sokol, S., Vaughan, J., Vale,
W. and Melton, D. A. (1990). Activins are expressed early in
Xenopus embryogenesis and can induce axial mesoderm and
anterior structures. Cell 63, 485-493.
van den Eijnden-Van Raalj, A. J. M., van Zoelent, E. J. J., Van
Nimmen, K., Koster, C. H., Snoek, G. T., Durston, A. J. and
Huylebroeck, D. (1990). Activin-like factor from a Xenopus laevis
cell line responsible for mesoderm induction. Nature 345, 819-822.
Wang, E. A., Rosen, V., Cordes, P., Hewick, R. M., Kriz, M. J.,
Luxenberg, D. P., Sibley, B. S. and Wozney, J. M. (1988).
Purification and characterization of other distinct bone-inducing
factors. Proc. Nad. Acad. Sci. U S A 85, 9484-9488.
Weeks, D. L. and Melton, D. A. (1987). A maternal mRNA localized
to the vegetal hemisphere in Xenopus eggs codes for a growth
factor related to TGF-beta. Cell 51, 861-867.
Whitman, M. and Melton, D. A. (1989). Growth factors in early
embryogenesis. Ann. Rev. Cell Biol. 5, 93-117.
Wozney, J. M., Rosen, V., Celeste, A. J., Mltsock, L. M., Whitters,
M. J., Kriz, R. W., Hewick, R. M. and Wang, E. A. (1988). Novel
regulators of bone formation: molecular clones and activities.
Science 242, 1528-34.
(Accepted 17 February 1992)
Note added in proof
The nucleotide sequence described in this paper has
been submitted to the EMBL database under the
accession number X64538.