Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genus species
Document related concepts
Transcript
Kingdom Review Archaebacteria: Cell type: Prokaryotic (no nucleus, simple, unicellular, no membrane bound organelles, Do have Ribosomes for making proteins) Unicellular; Most are autotrophs (Chemosynthesis) Habitat: Extreme environments Methanogens, thermoacidophiles, halophiles Reproduction: binary fission(asexual), conjugation(sexual) Eubacteria Cell type: Prokaryotes, Unicellular, most are heterotrophs (some are autrotrophs – ex: cyanobacteria found in the ocean) Role: Recycle Matter, Make natural fertilizer for plants, used in many types of industry, help regulate our bodies (food, industrial, clean-up) Some cause disease: E. coli, salmonella, Staph and many more… Reproduction: binary fission(asexual), conjugation(sexual) Protista: Cell type:Eukaryotic (have nucleus, larger and more complex than prokaryotes, have membrane bound organelles such as mitochondria, ER, chloroplast…) Most are unicellular with exception to some multicellular algae. Common Examples: Amoeba (pseuopods), Euglena (flagella), Paramecium (Cilia) Habitat: Mostly aquatic Role = Base of food chain (Plankton) Reproduction: Binary Fission (asexual), Conjugation (sexual) conjugation Fungus: Cell type- eukaryotics Most are multicellular, exception is yeast. 100% heterotrophic – secrete digestive enzymes and then absorb nutrients (absorptive heterotrophs) Hyphae – thin filament Mycellium – network of filaments Reproduction – sexual or asexual spores --yeast use budding: some fungus cause disease!! Role: Decomposer Plants: Cell type: Eukaryotic All are multicellular, all are autotrophic Highly specialized cells, tissues, organs, organ systems, many adaptations Reproduction: Pollination (sexual), budding (Asexual), Regeneration (asexual) Budding Animalia: Cell type: Eukaryotic Mulitcellular, Heterotrophic (digest internallyIngest or digest food rather than absorbing) Highly evolved: specialized cells, tissues, organs and organ systems. Reproduction: Fertilization (egg + sperm = zygote) Asexual reproduction: Fragmentation and regeneration, budding Hydra Planarian Anemone and starfish Hydra(budding) Planarian/starfish/anemone (fragmentation and regeneration) Viruses – Not a kingdom, not alive, cannot reproduce on their own. Invade other cells and take over their machinery to make more viruses. Made of a protein coat (capsid) and nucleic acid inside (DNA virus or RNA viruses) HIV is an RNA virus. bacteriophage animal virus Linnaeans system of classification: Hierarchal Kingdom Phylum Class Order Family Genus Genus species Binomial Nomenclature: two latin word naming system – Genus species Phylogeny – Evolutionary history of organism Cladograms – family trees Example DNA sequences: Species 1: AATTCGTACGTCAAGCTAGATG Species 2: AAATCGTACCTCAAGCTATATG Species 3: ATTTGGTACGACAAGGTAGATA Which species have the closest common ancestor? Which species are most distant? Identify common ancestors and evolutionary relationships.
