Download Functional Characterization of the Arabidopsis Eukaryotic

Functional Characterization of the Arabidopsis
Eukaryotic Translation Initiation Factor 5A-2 That
Plays a Crucial Role in Plant Growth and Development
by Regulating Cell Division, Cell Growth, and
Cell Death1[OA]
Haizhong Feng, Qingguo Chen, Jian Feng, Jian Zhang, Xiaohui Yang, and Jianru Zuo*
State Key Laboratory of Plant Genomics and National Center for Plant Gene Research, Institute of
Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China
The eukaryotic translation initiation factor 5A (eIF-5A) is a highly conserved protein found in all eukaryotic organisms.
Although originally identified as a translation initiation factor, recent studies in mammalian and yeast (Saccharomyces cerevisiae)
cells suggest that eIF-5A is mainly involved in RNA metabolism and trafficking, thereby regulating cell proliferation, cell
growth, and programmed cell death. In higher plants, the physiological function of eIF-5A remains largely unknown. Here, we
report the identification and characterization of an Arabidopsis (Arabidopsis thaliana) mutant fumonisin B1-resistant12 ( fbr12).
The fbr12 mutant shows an antiapoptotic phenotype and has reduced dark-induced leaf senescence. Moreover, fbr12 displays
severe defects in plant growth and development. The fbr12 mutant plant is extreme dwarf with substantially reduced size
and number of all adult organs. During reproductive development, fbr12 causes abnormal development of floral organs and
defective sporogenesis, leading to the abortion of both female and male germline cells. Microscopic studies revealed that these
developmental defects are associated with abnormal cell division and cell growth. Genetic and molecular analyses indicated
that FBR12 encodes a putative eIF-5A-2 protein. When expressed in a yeast mutant strain carrying a mutation in the eIF-5A
gene, FBR12 cDNA is able to rescue the lethal phenotype of the yeast mutant, indicating that FBR12 is a functional eIF-5A. We
propose that FBR12/eIF-5A-2 is fundamental for plant growth and development by regulating cell division, cell growth, and
cell death.
The eukaryotic translation initiation factor 5A (eIF5A) has been found in all eukaryotic organisms and is
structurally and functionally conserved across different kingdoms. Biochemical and molecular studies
revealed that eIF-5A is synthesized as an inactive
precursor that is activated by a posttranslational modification mechanism. This modification is involved in a
two-step reaction to convert an absolutely conserved
Lys into a Hpu. The first reaction, catalyzed by deoxyhypusine synthase (DHS; EC 1.1.1.249), is to add
a butylamine group derived from spermidine to the
conserved Lys to form a deoxyhypusine. Subsequently,
1
This work was supported by the National Natural Science
Foundation of China (NSFC; grant nos. 30330360 and 30221002),
the Ministry of Science and Technology of China (grant no.
2006AA10A112), and the Chinese Academy of Sciences (grant no.
KSCX2–YW–N–015). J.Z. is a recipient of the Outstanding Young
Investigator Award of the NSFC (grant no. 30125025).
* Corresponding author; e-mail [email protected]; fax 8610–
6487–3428.
The author responsible for distribution of materials integral to
the findings presented in this article in accordance with the policy
described in the Instructions for Authors (www.plantphysiol.org) is:
Jianru Zuo ([email protected]).
[OA]
Open Access articles can be viewed online without a subscription.
www.plantphysiol.org/cgi/doi/10.1104/pp.107.098079
the deoxyhypusine residue is converted into a Hpu,
catalyzed by deoxyhypusine hydroxylase (EC1.14.99.29;
Park and Wolff, 1988; Wolff et al., 1990; Park et al.,
1993, 1997). The hypusination of eIF-5A is essential for
viability of yeast (Saccharomyces cerevisiae) cells (Kang
et al., 1993) and highly specific, as demonstrated by the
observation that a Lys-to-Arg mutation abolishes hypusination of eIF-5A (Jin et al., 2003). In addition, this
unusual modification thus far has only been found in
eIF-5A proteins (Park et al., 1997; Thompson et al., 2004).
At the cellular level, Hpu-containing eIF-5A has been
shown to be involved in the control of cell proliferation
and apoptosis (Park et al., 1997; Tome and Gerner, 1997;
Caraglia et al., 2001; Thompson et al., 2004). More recently, eIF-5A was found to function as a regulator of
p53 and p53-dependent apoptosis (Li et al., 2004).
The eIF-5A protein was initially identified as a
translation initiation factor from rabbit reticulocytes
in an in vitro assay (Kemper et al., 1976). The eIF-5A
function in protein translation is partly supported by
the observation that the putative translation initiation
factor interacts with the ribosomal protein L5 (Schatz
et al., 1998) and the translating 80S ribosomal complex (Jao and Chen, 2006). However, accumulating evidence suggests that eIF-5A is not required for protein
synthesis in vivo because of the lack of correlation
between eIF5A and the general protein synthesis (Park
Plant Physiology, July 2007, Vol. 144, pp. 1531–1545, www.plantphysiol.org Ó 2007 American Society of Plant Biologists
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
1531
Feng et al.
et al., 1993, 1997; Kang and Hershey, 1994). Instead,
Hpu-containing eIF-5A has been shown to stabilize
mRNA and transport of specific subsets of mRNA
from the nucleus to the cytoplasm (Bevec and Hauber,
1997; Zuk and Jacobson, 1998). In yeast, a temperaturesensitive mutant ts1159, which carries a mutation in
the eIF-5A/TIF51A gene, causes the accumulation of
uncapped mRNAs at the nonpermissive temperature,
suggesting that eIF-5A is critical for mRNA turnover,
possibly acting downstream of decapping (Zuk and
Jacobson, 1998). The involvement of eIF-5A in the
translocation of RNA has also been documented (Bevec
and Hauber, 1997; Rosorius et al., 1999; Caraglia et al.,
2001). In agreement with these observations, the solved
crystal structure of eIF5A is characteristic of some
RNA-binding proteins (Murzin, 1993), such as cold
shock protein CspA (Schindelin et al., 1994) and the
Escherichia coli translation initiation factor IF1 (Sette
et al., 1997). Moreover, binding of eIF-5A to RNA requires Hpu on the protein and appears to be sequence
specific to two core motifs of the targets (Xu and Chen,
2001). On the other hand, eIF5A was also found to interact with distinctive cellular proteins, including the
exportin protein CHROMOSOME REGION MAINTE-
NANCE1 (Rosorius et al., 1999), exportin 4 (Lipowsky
et al., 2000), nucleoporins (Hofmann et al., 2001), tissue
transglutaminase II (Singh et al., 1998), syntenin (Li
et al., 2004), DHS, and Lia1 (for ligand of eIF5A;
Thompson et al., 2003). On the basis of these observations, eIF5A was proposed to function as a bimodular
protein capable of binding to both RNA and proteins
(Liu et al., 1997; Jao and Chen, 2006), thus involved in
multiple aspects of cellular signaling activities.
In plants, genes encoding eIF-5A and DHS have
been cloned from several species. Similar to its mammalian and yeast counterparts, a tomato (Lycopersicon
esculentum) eIF-5A recombinant protein can be deoxyhypusine modified by a DHS recombinant protein
(Wang et al., 2001). Whereas direct functional analysis
of eIF-5A in planta has not been reported, suppression
of DHS expression, which presumably causes partial
inactivation of eIF-5A, has gained important information on the eIF-5A function. In Arabidopsis (Arabidopsis
thaliana), constitutive overexpression of an antisense
DHS cDNA causes delayed senescence and resistance
to drought stress (Wang et al., 2003). Similarly, in
tomato, overexpression of an antisense DHS construct
results in delayed fruit softening and leaf senescence
Figure 1. The fbr12 mutant shows an FB1-resistant phenotype and reduced PR gene expression. A, Two-week-old seedlings
of wild type (Ws) and fbr12 germinated and grown in Murashige and Skoog medium in the absence or presence of 0.8 mM FB1.
Bar 5 5 mm. B, Cell death induced by FB1 in wild-type and fbr12 plants. Three-week-old seedlings were treated with dimethyl
sulfoxide (DMSO; 0.05%; control) or 2 mM FB1 for 24 h. Leaves were collected and stained with Trypan blue. Black staining
represents dead or dying cells. C, Nuclear DNA fragmentation induced by FB1 in wild type and fbr12. Protoplasts prepared from
wild-type and fbr12 leaves were treated with DMSO (0.002%; control) or 50 nM FB1 for 12 h and then analyzed by TUNEL
staining as described in ‘‘Materials and Methods.’’ TUNEL-positive cells were counted under a fluorescent microscope (n .
1,000 in each experiment). Data presented were mean values of three independent experiments. Bars represent SEs. D,
FB1-induced expression of PR1 and PR5 genes. Total RNA was prepared from 3-week-old seedlings treated with 3 mM FB1 for
various times as indicated and used for northern-blot analysis. Each lane contains 15 mg of RNA. The blot was hybridized with a
full-length PR1 or PR5 cDNA probe, respectively.
1532
Plant Physiol. Vol. 144, 2007
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Characterization of the Arabidopsis eIF-5A-2 Gene
(Wang et al., 2005). In addition, because expression of
both DHS and eIF-5A appears to be correlated with
senescence or stress (Wang et al., 2001, 2003, 2005), it has
been proposed that different isoforms of eIF-5A may
facilitate the translation of mRNAs required for cell
division and cell death, thereby regulating plant growth
and development (Thompson et al., 2004). In this study,
we report functional characterization of an Arabidopsis
eIF-5A gene. A loss-of-function mutation in the eIF-5A-2
gene causes severe developmental defects throughout
the life cycle, characteristics of abnormal cell division,
cell growth, and cell death. These results demonstrate
the biological importance of eIF-5A in plant growth and
development.
RESULTS
Identification and Genetic Analysis of the
fumonisin B1-resistant12 Mutant
The fumonisin B1-resistant12 (fbr12) mutant was identified from a genetic screen of a T-DNA-mutagenized
population of approximately 5,000 independent lines
in the pga22 mutant background (Sun et al., 2003,
Figure 2. Defective growth and development in fbr12. A, Four-day-old seedlings of wild type (Ws; left) and fbr12 (right)
germinated and grown in Murashige and Skoog medium under continuous white light. No substantial difference between wild
type and fbr12 is observed at this stage. Bar 5 1 mm. B, Ten-day-old seedlings of wild type (Ws; left) and fbr12 (right) germinated
and grown in Murashige and Skoog medium under continuous white light. Bar 5 5 mm. C, Four-week-old plants of wild type
(Ws; left) and fbr12 (right) germinated and grown in soil under continuous white light. Bar 5 5 mm. D, Rosette leaves collected
from 4-week-old plants of wild type (Ws; top) and fbr12 (bottom) germinated and grown in soil under continuous white light.
Bar 5 5 mm. E, Seven-week-old plants of wild type (Ws; left) and fbr12 (right) germinated and grown in soil under continuous
white light. Bar 5 2 cm. F, Enlarged view of an fbr12 plant shown in E. The plant was germinated and grown in soil under
continuous white light for approximately 7 weeks. Bar 5 2 cm. G, Comparison of wild-type (left) and fbr12 (right) floral
inflorescences derived from 6-week-old plants germinated and grown in soil under continuous white light. Bar 5 2 mm. H,
Analysis of growth rates of adult organs of wild-type and fbr12 plants germinated and grown in soil under continuous white light.
Leaf initiation rate was calculated as the number of new leaves produced per day between the second and the seventh true
leaves. Total number of leaves refers to rosette leaves 40 d after germination. Total number of flowers refers to flowers at stage 12
and above (flower development stages are defined according to Sanders et al. [1999]). At least 30 plants were analyzed in each
experiment and average values were shown. Bars 5 SEs.
Plant Physiol. Vol. 144, 2007
1533
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Feng et al.
2005). The pga22 mutant (Wassilewskija [Ws] accession) carries an estradiol-inducible T-DNA transcription activation tag (Zuo et al., 2000) upstream from
the ISOPENTENYL TRANSFERASE8 (AtIPT8/PGA22)
gene. Expression of the AtIPT8/PGA22 gene is highly
inducible by the chemical inducer estradiol, which
causes overproduction of cytokinin in planta. However, the pga22 mutant shows a phenotype indistinguishable from wild-type plants in the absence of
estradiol (Sun et al., 2003). We have generated a T-DNA
insertion population by transforming pga22 mutant
plants with a second binary vector pTA231 (Sun et al.,
2005). To screen fbr mutants, pooled T2 seeds (20 lines/
pool) were germinated on Murashige and Skoog medium (Murashige and Skoog, 1962) containing 0.8 mM
fumonisin B1 (FB1). The fbr12 mutant was identified
from this screen and showed strong resistance to FB1
(Fig. 1A). The original mutant (T3) was backcrossed
with the wild type (Ws) twice and the resulting F2 or F3
progeny that did not contain the pga22 mutation were
used for all experiments described below except for
initial genetic analysis.
Because fbr12 was infertile (see below), we crossed
putative fbr12/1 plants (in the pga22 background)
with the wild type (Ws). In F2 progeny derived from
self-pollinated F1 plants, the FB1-resistant phenotype
segregated in a 1:3 ratio (FB1 resistant:sensitive 5
72:225; x 2 5 0.055; P , 0.01). When grown under
normal growth conditions in the absence of FB1, fbr12
displayed severe defects in plant growth and development (Fig. 1A; see below for details), and this pheno-
type also segregated in a 1:3 ratio ( fbr12:wild type 5
75:288; x 2 5 3.58; P , 0.05). These results indicate that
the fbr12 mutation is recessive in a single nuclear locus.
Because of lethality of the mutation, fbr12 was maintained as heterozygous.
The fbr12 Mutation Alters FB1-Mediated Programmed
Cell Death
To investigate the cellular and molecular alterations
induced by FB1 in fbr12, we first compared toxininduced cell death by Trypan blue staining. In wildtype leaves, FB1 induced massive cell death. However,
substantially reduced cell death was observed in fbr12
leaves (Fig. 1B). In some cases, no cell death was found
in the mutant leaves treated by FB1 (data not shown).
We next examined nuclear DNA fragmentation, a
molecular hallmark of apoptotic cells, in protoplasts
treated by FB1 using the TUNEL method. In untreated
protoplasts derived from both the wild type and fbr12,
TUNEL-positive signal was rarely detected. However,
upon FB1 treatment, whereas more than 90% of wildtype protoplasts showed TUNEL-positive signals,
,25% of fbr12 protoplasts displayed distinctive positive
signals under the identical assay conditions (Fig. 1C).
At the molecular level, FB1 is known to induce the
expression of PATHOGEN-RELATED (PR) genes, and
the induction is compromised in fbr1 and fbr2 mutants
(Stone et al., 2000). Similar to that of fbr1 and fbr2, FB1induced expression of PR1 and PR5 was reduced in
fbr12 (Fig. 1D). Collectively, data presented in Figure 1
Figure 3. Developmental defects in the fbr12 floral
organs. A, Comparison of wild-type and fbr12 flowers
at different development stages. Bar 5 5 mm. B,
Comparison of wild-type and fbr12 siliques. Bar 5
5 mm. C, Reduced numbers of floral organs in the
fbr12 mutant. The x axis indicates distribution of
floral organ numbers in the examined fbr12 flowers
(n 5 105). Floral organ numbers of wild-type flowers
are marked by asterisks above corresponding bars.
1534
Plant Physiol. Vol. 144, 2007
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Characterization of the Arabidopsis eIF-5A-2 Gene
suggest that FB1-elicited PCD and/or defense response
is altered by the fbr12 mutation.
The fbr12 Mutation Causes Pleiotropic Phenotype during
Plant Growth and Development
The fbr12 mutant phenotype became apparent shortly
after germination. Compared to the wild type, fbr12 was
substantially smaller and more slender, with significantly
shorter roots. However, all embryonic organs, including
roots, hypocotyls, and cotyledons, appeared to be well
defined (Fig. 2, A and B). The initiation of true leaves was
substantially delayed in fbr12 (Fig. 2B). During later
growth stages, fbr12 displayed a stunted phenotype (Fig.
2, C, E, and F), producing less rosette and cauline leaves
that were smaller than those of the wild type (Fig. 2, D
and E). In addition, fbr12 plants also had few flowers that
were abnormally developed (Fig. 2, F and G). Overall,
fbr12 affected the growth rate and organogenesis charac-
teristics of dwarfism, a reduced leaf initiation rate and
reduced numbers of adult organs (Fig. 2H).
In fbr12, development of the floral organs was severely affected by the mutation. Compared to the wild
type, fbr12 plants produced fewer flowers (Fig. 2, G and
H) in which all floral organs displayed various developmental defects. In general, all fbr12 floral organs were
smaller than those of the wild type (Fig. 3A). Compared
to that of the wild type, sepals in fbr12 flowers were often
misshapen and occasionally fused together. Petals in
fbr12 flowers were smaller than that of the wild type
(Fig. 3A). Stamens and stigmas appeared to be morphologically normal. However, two lateral stamens
were usually absent in the mutant and the gynoecium
stigmatic papillae was shorter than that of the wild type
(see also below for more details on germline cell development). In wild-type Arabidopsis, a flower consists
of four sepals, four petals, six stamens, and a carpel.
Whereas a carpel was often found in fbr12 flowers,
Figure 4. Delayed development of the SAM in
fbr12. A to E, Light microscopy of longitudinal
sections of wild-type and fbr12 seedlings. A, Fourday-old wild-type seedling. B, Six-day-old wildtype seedling. C, Four-day-old fbr12 seedling.
The dome-structured SAM is smaller than that of
wild type in the same stage shown in A, although
apparent morphological alterations are not observed at this stage (see also Fig. 2A). D, Six-dayold fbr12 seedling. Compared to wild type at the
same developmental stage shown in B, delayed
initiation of true leaf projections is observed. E,
Nine-day-old fbr12 seedling showing a development stage equivalent to that of 6-d-old wild-type
seedlings shown in B. F to J, Scanning electron
microscopy of the SAMs of wild type and fbr12. F,
Four-day-old wild-type seedling. G, Six-day-old
wild-type seedling. H, Four-day-old fbr12 seedling. I, Six-day-old fbr12 seedling showing a
phenotype similar to that of 4-d-old wild type in
F. J, Nine-day-old fbr12 seedling that appears to
be in a developmental stage equivalent to that of
6-d-old wild-type seedlings shown in G. Bar 5
20 mm (A–E) and 50 mm (F–J).
Plant Physiol. Vol. 144, 2007
1535
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Feng et al.
other floral organ components had significantly reduced numbers in the mutant compared to the wild
type (Fig. 3C). In particular, the number of petals and
stamens was altered more dramatically by the fbr12
mutation, with ,30% and 10% of flowers producing
correct numbers of these organs, respectively (Fig. 3C).
Approximately 50% of flowers formed the correct
number (four) of sepals. As a result of these defects,
fbr12 siliques were markedly shorter and did not contain any seeds (Fig. 3B).
The fbr12 Mutation Affects Cell Proliferation
and Cell Growth
To investigate the cellular basis of the fbr12 mutant
phenotype, we analyzed the mutant by microscopy.
Light microscopy revealed that the structure of the
shoot apical meristem (SAM) was unaffected in fbr12,
but SAM development was delayed compared to that
of the wild type (Fig. 4, A–E). Notably, 9-d-old fbr12
SAM appeared to be equivalent to that of 6-d-old
wild type. A similar observation was made by scanning electron microscopy (Fig. 4, F–J). These results
suggest that the fbr12 mutation may cause a slow division or growth rate of the meristem cells.
Transverse sections of stems revealed that fbr12,
similar to that of the wild type, contained three distinctive layers of cell files that include, from outside
to inside, the epidermis, cortex, and central cylinder.
Development of epidermal cells appeared to be unaffected in the fbr12 mutant. This result suggests that
radial patterning remains relatively normal in fbr12. In
Figure 5. Cellular defects in the fbr12
mutant. A to D, Light microscopy of transverse sections of wild-type (A and C) and
fbr12 (B and D) stems. C and D, Enlarged
views of A and B, respectively. X, Xylem; P,
phloem; C, cortex; E, epidermis. Bars 5
100 mm (A and B) and 30 mm (C and D). E,
Analysis of cell numbers (y axis) in different tissues of wild-type and fbr12 stems.
Data presented were average values obtained from 10 sections derived from different plants. Bars 5 SEs.
1536
Plant Physiol. Vol. 144, 2007
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Characterization of the Arabidopsis eIF-5A-2 Gene
the cortex, however, cells were substantially enlarged
in fbr12 compared to the wild type (Fig. 5, A–D). By
contrast, the mutant had smaller cells in the central
cylinder than those of the wild type (Fig. 5, A–D). The
central cylinder contained the vascular bundles consisting of phloem and xylem. In xylem, fbr12 had an
increased number of cells that were smaller, presumably representing a group of incompletely differentiated cells. Compared to that of the wild type, no
distinctive cell layers were observed in the fbr12
phloem. Moreover, both the number and the size of
the phloem cells were greatly reduced (Fig. 5, C and
D). Quantitative analysis also indicated that fbr12 had
increased cell numbers in xylem and parenchyma, but
reduced cell numbers in phloem and cortex (Fig. 5E).
Scanning electron microscopy indicated that, in fbr12
petals, whereas the cell number remains unaltered,
the cell size is smaller than that of the wild type (Fig. 6,
A and B). Quantitative analysis of cell numbers in
petals revealed that the total cell numbers remained
nearly unaltered, but the cell size was reduced in fbr12
(Fig. 6C), thus causing smaller petals. Collectively,
these observations indicate that the fbr12 mutation affects cell proliferation, cell growth, and cell differentiation in both vegetative and reproductive organs/
tissues.
FBR12 Is Essential for Male and Female Sporogenesis
The fbr12 mutant could grow and develop into
mature plants with significantly smaller size, which
could not set any seeds. Reciprocal crosses between
the wild type and fbr12 did not yield any F1 seeds,
suggesting that the mutant was both male and female
sterile. To reveal the cellular basis of the sterile phenotype, we followed the entire reproductive developmental stages by light microscopy and scanning
electron microscopy.
During male germline cell development, no apparent defects were found in fbr12 before stage 7 (anther development stages were defined according to
Sanders et al. [1999]). In the wild type, at this stage,
microspores are generated from pollen mother cells by
meiosis and are confined as tetrads in a wall rich in
callose, which, in turn, are contained in tapetum (Fig.
7A). In fbr12, tetrad cells appeared to be correctly
generated (Fig. 7D). At stage 8, a wild-type pollen sac
contains three layers of well-defined cell files, from
outside to inside, epidermis, middle layer, and the
tapetum. Inside the wild-type pollen sac, microspores
are released from tetrads (Fig. 7B). At the same developmental stage, the middle layer and tapetum of the
fbr12 pollen sac became disorganized with excessive
numbers of cells that are irregularly shaped and
stained darker compared to those in the wild type
(Fig. 7, B and E). More severe defects were observed
in later stages. In contrast to that of the wild type, no
vacuole formation was found in fbr12 microspores;
instead, microspores appeared to collapse and eventually formed dark-stained debris inside the disorganized tapetum (Fig. 7, C and F). Consequently, in
mature anthers, no viable pollen grains were found in
fbr12 by either toluidine blue O staining (Fig. 7, G and
H) or scanning electron microscopy (Fig. 7, I–K).
Figure 6. Reduced cell numbers in fbr12
petals. A and B, Scanning electron microscopy of wild-type (A) and fbr12 (B) petals.
Compared to that of the wild type, the
fbr12 petals have smaller cells. Bar 5
100 mm. C, Defective cell growth in fbr12
petals. In each image, the average values of
the wild type (obtained by analyzing
20 petals derived from nine flowers) were
set at 100% and the values of fbr12 relative
to those of the wild type were given in
the histogram. Bars 5 SEs.
Plant Physiol. Vol. 144, 2007
1537
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Feng et al.
Figure 7. Male-sterile phenotype of the fbr12 mutant. A to F, Light microscopy of cross-sections of pollen sacs derived from wildtype (A–C) and fbr12 (D–F) anthers. The images show anthers at different developmental stages (anther developmental stages are
defined according to Sanders et al. [1999]): stage 7 (A and D), stage 8 (B and E), and stage 9 (C and F). At stage 7, no apparent
developmental abnormality was observed in pollen sacs of fbr12 (D) compared to that of wild type (A). After entering stage 8, the
tapetum of fbr12 had an excess of cell layers that encompassed degenerated pollen grains (E and F). E, Epidermis; En,
endothecium; ML, middle layer; MSp, microspores; T, tapetum; Tds, tetrads. Bar 5 10 mm. G and H, Anthers of wild-type (G) and
fbr12 (H) plants stained by toluidine blue O. Mature pollen grains are stained as dark blue. Bar 5 2 mm. I to K, Scanning electron
microscopy of anthers of wild type (I) and fbr12 (J and K). Note the empty pollen sacs in fbr12 anthers. Bar 5 40 mm.
1538
Plant Physiol. Vol. 144, 2007
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Characterization of the Arabidopsis eIF-5A-2 Gene
During female gametophyte development, the fbr12
mutation also appears to express after meiosis, approximately at stage 2-III (ovule development stages
are defined according to Schneitz et al. [1995]). In the
wild type at this stage, meiosis is completed to give
rise to four megaspores of which only one survives
and undergoes three rounds of nuclear divisions to
eventually form a mature embryo sac. Meanwhile, the
developing ovule grows toward the septum and the
base of the carpel, whereas both the inner and outer
integuments are initiated (Fig. 8, A and G). In fbr12,
no apparent defects were observed at this stage and a
megaspore appeared to be normally formed in the ovule
(Fig. 8, D and H). In the wild type, whereas the inner
integument continues to grow symmetrically, the outer
integument starts asymmetric growth throughout development (Fig. 8B), eventually leading to the formation
of a hook-shaped, mature embryo sac (Fig. 8, C and G).
By contrast, both inner and outer integuments stopped
further growth in fbr12 ovules (Fig. 8, E and H). Therefore, ovule development was completely arrested at
this stage.
We have also followed the entire reproductive development in fbr12/1 heterozygous plants. An fbr12/1
plant should give rise to haploid germline cells carrying a mutant or a wild-type allele, with approximately
50% of each genotype, respectively. On the other hand,
the diploid sporophytic tissues (e.g. tapetum and ovules)
should normally be developed because of the recessive
nature of the mutation. No abnormally developed germline cells were observed in fbr12/1 plants, which showed
no difference in fertility compared to wild type (data
not shown). Moreover, in progeny derived from selfpollinated fbr12/1 plants, the mutation was segregated
in a 1:3 ratio (mutant:wild type; see above) characteristic
of sporophytic mutations (Yang et al., 1999; McCormick,
2004). These results suggest that the fbr12 mutation only
affects sporogenesis, but not gametogenesis. Similarly,
no abnormality was observed in developing embryos
of fbr12/1 plants. Taken together, these results suggest
that FBR12 is essential for sporophytic development,
but dispensable for gametogenesis and embryogenesis,
and that defective gametogenesis is likely caused by
abnormal development of sporophytic tissues in the
fbr12 mutant.
Molecular Cloning of the FBR12 Gene
The fbr12 mutant was identified from a T-DNAmutagenized population and the mutant genome
appears to contain a single T-DNA insertion. We identified the genomic sequences flanking the left border
by thermal asymmetric interlaced (TAIL)-PCR (Liu et al.,
1995). DNA sequencing analysis indicated that the left
border was inserted in the coding sequence region of
At1g26630, 9 bp upstream from the stop codon, whereas
the right border faced the 5#-end of the gene (Fig. 9A).
Northern-blot analysis did not reveal any expression of
At1g26630 in the mutant plants (Fig. 9B), suggesting that
fbr12 is likely a null mutation.
To verify the identity of FBR12, we carried out a
molecular complementation experiment. A 2.5-kb wildtype genomic DNA fragment, which encompassed
the promoter region, 5#-untranslated region (UTR), the
coding sequence, and part of the 3#-UTR of At1g26630,
was cloned into binary vector pER8 (Zuo et al., 2000).
The resulting construct was then transformed into fbr12/1
heterozygous plants via Agrobacterium tumefaciensmediated transformation (Bechtold et al., 1993). Multiple independent transgenic lines were obtained by
double selection with BASTA (carried by the fbr12
mutant) and hygromycin (carried by pER8). In the 20
tested T2 lines, all hygromycin-resistant plants displayed normal phenotype. In T3 lines derived from
BASTA- and hygromycin-resistant T2 plants, we analyzed four families that did not show segregation of
either the selective markers (BASTA and hygromycin)
or the fbr12 phenotype. PCR analysis revealed that all
tested plants (24) were homozygous for the T-DNA insertion at the At1g26630 locus. In these transgenic
plants, the transgene fully rescued the developmental
defects (Fig. 9, D and F) and restored the sensitivity of
the mutant to FB1 (Fig. 9E). These data suggest that the
At1g26630 transgene was able to fully complement the
fbr12 mutant phenotype, thus representing FBR12.
FBR12 Encodes a Functional eIF-5A-2
Database search identified a full-length FBR12 cDNA
clone (accession no. NM_102425). Comparison of the
cDNA and genomic sequences revealed an open reading frame (ORF) interrupted by four introns (Fig. 9A).
The ORF encodes a polypeptide of 159 amino acid
residues, with a predicted molecular mass of 17.1 kD
and a pI of 5.8. Sequence comparison revealed that
FBR12 encodes a putative eIF-5A-1 (accession no.
NP_173985; also annotated by The Arabidopsis Information Resource [TAIR]) or eIF-5A-2 (accession nos.
Q93VP3 and BE039424; Thompson et al., 2004). Hereafter, we refer to this protein as FBR12 or eIF-5A-2
according to Thompson et al. (2004).
Consistent with the pleiotropic phenotype of fbr12,
FBR12 appears to be ubiquitously expressed in all
examined tissues and organs (Fig. 9C). Members of
the eIF-5A family are highly conserved across different
kingdoms of eukaryotic organism cells (Jenkins et al.,
2001). The Arabidopsis genome contains two additional
FBR12/eIF-5A-like genes, At1g69410 and At1g13950,
which encode proteins sharing 86% and 82% identity
with FBR12, respectively. In addition, FBR12 shares
significant homology with representative eIF-5A proteins from other species, including rice (Oryza sativa;
79%; accession no. AAK1617679), mammals (human
and mouse; 51%–54%), Drosophila (54%; accession no.
AAG17032), Caenorhabditis elegans (55%; accession no.
NP_499152), yeast (57%; accession no. NP_012581), and
fission yeast (Schizosaccharomyces pombe; 52%; accession
no. CAB16195).
To functionally characterize FBR12, we carried out a
genetic complementation experiment in a yeast mutant
Plant Physiol. Vol. 144, 2007
1539
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Feng et al.
Figure 8. Ovule development of fbr12 mutant plants. A to E, Scanning electron microscopy of wild-type and fbr12 ovules. A,
Wild-type ovules at stage 2-III (ovule developmental stages are defined according to Schneitz et al. [1995]). The nucellus (nu),
funiculus (fu), and inner (ii) and outer (oi) integument primordia are visible. B, Wild-type ovules at stage 3-I. The outer
integument encompassed most of the inner integument and nucellus. C, Wild-type ovules at stage 4-I. The outer integument
completely covers the inner integument and nucellus. D, fbr12 ovules at stage 2-III. Compared to the wild type, no apparent
abnormality is observed. E, fbr12 ovules at stage 3-I. The outer integument and the inner integument stop development. F to H,
Differential interference contrast observations of embryo sacs prepared from wild-type (F and G) and fbr12 (H) flower buds.
Preparations were cleared by Herr’s solution (Herr, 1971). F, Wild-type ovule at stage 2-III. G, Wild-type ovule at stage 4-I. F,
fbr12 ovule 2-III. fu, Funiculus; ii, inner integument; iip, inner integument primordium; nu, nucellus; oi, outer integument; oip,
outer integument primordium; ov, ovule. Bar 5 100 mm (A–E) and 10 mm (F–H).
strain PSY1249. This strain carries a temperaturesensitive mutation in an eIF-5A gene TIF51A that allows
the mutant to grow only under the permissive temperature (25°C; Valentini et al., 2002). An FBR12 cDNA
containing the entire ORF was cloned into a yeast
expression vector under the control of the GAL1 promoter that can be induced by Gal, but repressed by
Glc. The resulting construct pYES2-FBR12 was transformed into PSY1249. The transformed PSY1249 cells
were able to grow at the nonpermissive temperature
(36°C) in the presence of the Gal inducer, but not the
Glc repressor (Fig. 10). Therefore, inducible expression
of FBR12 cDNA is able to rescue the growth defects of
PSY1249 caused by a mutation in the yeast eIF-5A
gene. This result demonstrates that FBR12 is a functional eIF-5A.
The fbr12 Mutation Delays Dark-Induced
Leaf Senescence
Previous studies showed that overexpression of
antisense DHS in Arabidopsis and tomato resulted in
delayed leaf senescence. Because DHS is essential for
hypusination of eIF5A proteins, this transgenic phenotype was attributed to the inactivation of eIF5A
proteins by knocking down DHS expression (Wang
et al., 2003, 2005). To investigate the possible role of
FBR12/eIF5A-2 in regulating senescence, we compared
dark-induced leaf senescence in mutant and wild-type
plants.
Fully expanded leaves detached from fbr12 and
wild-type plants were placed in the dark and their
senescence rates were analyzed. Under assay conditions, leaves derived from wild-type plants showed an
1540
Plant Physiol. Vol. 144, 2007
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Characterization of the Arabidopsis eIF-5A-2 Gene
growth conditions, the chlorophyll level was slightly
lower in fbr12 leaves compared to that of the wild type.
However, dark treatment caused a greater loss of chlorophyll in wild-type leaves (37% at day 4, 47% at day 7,
and 80% at day 10) compared to that of fbr12 mutant
leaves at the same stages (17% at day 4, 33% at day 7,
and 48% at day 10; Fig. 11B). Taken together, these
results suggest that FBR12/eIF5A-2 is involved in the
regulation of senescence-type PCD in Arabidopsis.
DISCUSSION
Figure 9. Molecular characterization of the FBR12 gene. A, Schematic
map showing the T-DNA insertion site in the fbr12 mutant genome.
Black boxes denote exons and lines indicate untranslated sequences
and introns. B, Northern-blot analysis of FBR12 expression in wild-type
and fbr12 plants. Fifteen micrograms of total RNA prepared from
3-week-old plants were used for northern-blot analysis using an FBR12
cDNA probe. C, Quantitative analysis of FBR12 expression in different
tissues/organs by real-time RT-PCR. Bars 5 SEs. D, Ten-day-old seedlings germinated and grown on Murashige and Skoog medium. From
left to right, Wild type, fbr12, and fbr12 carrying an FBR12 transgene.
Bar 5 5 mm. E, Fourteen-day-old seedlings germinated and grown on
Murashige and Skoog medium containing 0.8 mM of FB1. From left to
right, Wild type, fbr12, and fbr12 carrying an FBR12 transgene. Bar 5
5 mm. F, Seven-week-old plants germinated and grown in soil. From
left to right, Wild type, fbr12, and fbr12 carrying an FBR12 transgene.
Bar 5 2 cm.
apparent dark-induced senescence syndrome at day 7
and became completely bleached at day 10. Under the
identical assay conditions, leaves derived from fbr12
mutant plants displayed a slower senescence rate
(Fig. 11A). To quantitatively analyze the senescence
rate, we measured the chlorophyll levels in fully expanded leaves of wild type and fbr12. Under normal
In this study, we present evidence showing that the
Arabidopsis FBR12 gene encodes a functional eIF5A
that is involved in the regulation of cell proliferation,
cell growth, and cell death. FBR12 shares significant
homology with eIF-5A proteins characterized across
different kingdoms. Moreover, an FBR12 cDNA clone
was able to complement the temperature-sensitive
lethal phenotype of yeast PSY1249 cells carrying a
mutation in the TIF51A/eIF-5A gene. These results
demonstrate that FBR12 is a functional eIF-5A.
The eIF-5A protein was originally characterized as a
component of the translation initiation complex. However, recent studies suggest that this class of highly
conserved proteins is involved in RNA metabolism
and RNA trafficking (Bevec and Hauber, 1997; Zuk
and Jacobson, 1998; Thompson et al., 2004), although
very limited evidence is available for the proposed
biochemical function of eIF-5A proteins. Nevertheless,
because of its fundamental cellular function, eIF-5A
has been shown to be required for growth and development in several organisms. In both yeast and mammalian cells, eIF-5A is essential for cell proliferation
(Park et al., 1993, 1997; Kang and Hershey, 1994). In
C. elegans, two copies of eIF-5A homologs, IFF-1 and
IFF-2, were identified. Knockout of iff-2 results in slow
Figure 10. FBR12 is a functional eIF-5A protein. An FBR12 cDNA fragment containing the entire ORF was placed under the control of the
yeast GAL1 promoter in a pYES2 vector. The resulting construct pYESFBR12 was transformed into the yeast mutant strain PSY1249, which
carries a temperature-sensitive mutation in the TIF51A/eIF-5A gene
(Valentini et al., 2002). A wild-type yeast strain W303 (TIF51A) was
used as a positive control and an empty pYES2 vector (vector) served as
a negative control. The transformed cells were serially diluted and then
inculcated on yeast peptone dextrose medium containing 2% (w/v) of
Glc (Glu in figure) or 2% (w/v) of Gal. Plates were incubated at 24°C or
36°C for 2 (24°C) or 4 (36°C) d, respectively.
Plant Physiol. Vol. 144, 2007
1541
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Feng et al.
larval growth and disorganized somatic gonadal structures in hermaphrodites, whereas lack of IFF-1 activity
causes sterility with underproliferated germline cells.
Double mutants of iff-1/iff-2 displayed a slightly stronger phenotype than single mutants, but did not affect
the viability of the animal (Hanazawa et al., 2004). In
Arabidopsis, we found that a loss-of-function mutation in the FBR12/eIF-5A-2 gene causes more severe
defects, including an underdeveloped SAM, reduced
sizes and numbers of all adult organs, defective development of floral organs, and abnormal sporogenesis. Nevertheless, the loss of eIF-5A activity in both
organisms shows some phenotypical similarities characteristic of slow growth and defects in reproductive
development. On the other hand, we notice that
gametogenesis and embryogenesis appear to be unaffected by the fbr12 mutation, suggestive of the presence of germline- and/or embryo-specific eIF-5A
activity. A similar view is also shared by Thompson
et al. (2004), who proposed that different isoforms of
eIF-5A function distinctively in the regulation of cell
divisions and cell death. This notion is reinforced by
the observation that a null mutation in an Arabidopsis
homologous gene eIF-5A-3 (SALK_022515) does not
have substantial effects on plant growth and development (H. Feng, J. Feng, and J. Zuo, unpublished data).
These results suggest that FBR12 represents major
eIF-5A-2 activity during plant growth and development.
The extreme dwarf phenotype of the fbr12 mutant
may be caused by reduced cell division and/or cell
growth. Microscopic studies suggest that both cell
division and cell growth are affected by the fbr12
mutation. However, the regulatory roles of FBR12 in
cellular activity appear to be cell type- or tissue-specific
with distinctive mechanisms. In stem development, for
example, no apparent abnormality was observed in the
epidermal cell layer, but various defects were found in
the cortex and the central cylinder. More strikingly, the
FBR12 gene appears to function differently, characteristically by inhibiting cell growth in the cortex, but promoting cell growth in the central cylinder. In a similar
mode, the fbr12 mutation causes increased cell numbers
in xylem and parenchyma, but reduced cell numbers in
phloem and cortex. These observations suggest that
FBR12 regulates cell division and cell growth in a
tissue- and development-specific manner. We notice
that fbr12 shows some phenotypic similarity with fbr6,
whose wild-type allele encodes a transcription activator AtSPL14 (Stone et al., 2005). In particular, both fbr6
and fbr12 affect vascular tissue development, suggesting that they may act in a linear pathway. It will be
interesting to analyze the possible interaction of these
two loci.
In addition to its role in cell division and cell growth,
FBR12 also appears to play a role in regulating cell
death. Similar to other fbr mutants, fbr12 shows resistance to FB1 with substantially reduced cell death
induced by the toxin. Compared to the wild type,
fbr12 protoplasts showed substantially less DNA fragmentation induced by FB1, suggesting that FBR12/
Figure 11. Reduced dark-induced leaf senescence in fbr12. A, Fully
expanded leaves detached from 4-week-old seedlings of wild type and
fbr12 were kept at 22°C in the dark for different time (d) as indicated at
the bottom of the image. Leaves were collected from 10 to 15 seedlings
for each sample and the experiment was repeated three times. B,
Measurement of the chlorophyll content in fully expanded leaves that
were treated as described in A. Data presented were mean values from
three independent experiments. Bars 5 SEs.
eIF-5A-2, similar to its mammalian homologs, is likely
involved in the regulation of apoptotic cell death.
Because FB1 is known to inhibit ceramide synthase,
thereby perturbing sphingolipid metabolism (Wang
et al., 1991; Abbas et al., 1994; Gilchrist et al., 1994),
FBR12 may be involved in the regulation of a subset of
RNA responsible for sphingolipid metabolism or signaling. In addition to the antiapoptotic phenotype
induced by FB1, fbr12 also shows delayed leaf senescence induced by dark, another form of PCD in plant
cells. This phenotype is consistent with two earlier
observations made in Arabidopsis (Wang et al., 2003)
and tomato (Wang et al., 2005) in which antisense
suppression of DHS, which presumably inactivates
eIF-5A by blocking hypusination, leads to delayed
senescence and tolerance to stresses. However, because
fbr12 grows slower than wild-type plants, we could not
exclude the possibility that delayed senescence in the
mutant is partly attributed to slower initiation of the
developmental program induced by dark. Nevertheless, in parallel to these findings in plants, the hypusination activity on eIF-5A was significantly reduced
during senescence of IMR-90 human diploid fibroblasts
(Chen and Chen, 1997). Taken together, these observations suggest that FBR12 and/or other eIF-5A genes
may be directly or indirectly involved in the regulation
of distinctive forms of cell death in plants.
In conclusion, FBR12/eIF-5A-2 plays a critical role in
plant growth and development by regulating cell division, cell growth, and cell death. Identification of the
1542
Plant Physiol. Vol. 144, 2007
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Characterization of the Arabidopsis eIF-5A-2 Gene
fbr12 mutant provides unique materials to functionally
characterize this class of highly conserved proteins in
eukaryotic organisms. Clearly, identification and characterization of direct targets of FBR12/eIF-5A-2 will be
critical to better understand its function.
MATERIALS AND METHODS
Plant Materials, Growth Conditions, and Genetic
Screen for fbr Mutants
The Ws ecotype of Arabidopsis (Arabidopsis thaliana) was used in this study
unless otherwise indicated. Plants were grown under a 16-h-light/8-h-dark
cycle (white light; 120 mmol m22 s21) at 22°C in soil or on Murashige and
Skoog medium (13 Murashige and Skoog salts, 3% Suc, 0.8% agar) as
described previously (Sun et al., 2003).
A T-DNA-mutagenized population of approximately 5,000 independent
lines was generated in the pga22 (Ws) background (Sun et al., 2003, 2005).
These T-DNA insertion lines were screened for FB1-resistant fbr mutants
as described (Stone et al., 2000). T2 seeds were germinated and grown on
Murashige and Skoog medium containing 0.8 mM FB1 (purchased from Sigma)
under continuous white light for 1 to 2 weeks. Putative fbr mutants were
identified and then transferred onto fresh Murashige and Skoog medium
without FB1. From this screen, two fbr mutants were identified. The fbr12
mutant (originally named p250) was outcrossed with wild-type plants (Ws)
twice to segregate out the pga22 mutation, and F2 or F3 progeny in the Ws
background lacking the pga22 mutation were used in all experiments.
Protoplast Preparation, Detection of Nuclear DNA
Fragmentation, and Detection of Cell Death
Leaves were collected from 4- to 5-week-old seedlings and protoplasts
were prepared according to Danon and Gallois (1998). In situ detection of
nuclear DNA fragmentation was performed as described (Danon and Gallois,
1998) with minor modifications. The TUNEL reaction was carried out in an
Eppendorf tube by using an in situ cell death detection kit (Roche Diagnostics)
according to the manufacturer’s instructions. Nuclear DNA was stained with
Hoechst 33342 (5 mg/mL; Sigma). After staining, the samples were mounted
on a polylysine slide and visualized using a fluorescent microscope.
Cell death was analyzed by Trypan blue staining as described (Mou et al.,
2000).
Light and Electron Microscopic Analyses
Semithin sections were prepared and analyzed as described with minor
modifications (Yang et al., 1999). Briefly, samples were fixed in 2.5% glutaraldehyde, 0.2 M sodium phosphate buffer, pH 7.2, at 4°C overnight and then
postfixed in 1% osmium tetroxide for 2 h at 4°C. After dehydration in an
acetone and graduated ethanol series, samples were embedded in Spurr’s
resin (Sigma). Semithin sections (2 mm) were stained with 0.1% (w/v)
toluidine blue O and observed under a light microscope. For differential
interference contrast observations, young flower buds were cleared with
Herr’s solution (Herr, 1971), and then analyzed under an inverted light
microscope. Pollen grains were stained by 0.1% (w/v) toluidine blue O.
For scanning electron microscopic analysis, samples were fixed, postfixed,
and dehydrated as described above. After being critical point dried in liquid CO2
and mounted, samples were sputter-coated with gold in an E-100 ion sputter and
then observed under a scanning electron microscope (model S-570; Hitachi).
For comparison of cell size and numbers, the distal portion of the petal
epidermis or stem sections was analyzed as described (Mizukami and Ma, 1992;
Mizukami and Fischer, 2000). For statistical analysis, images were photographed
with an Olympus digital camera and then analyzed using Image-Pro Plus 5.1.
Statistical calculations were performed with Microsoft Excel.
Analysis of Leaf Senescence and
Measurement of Chlorophyll
Fully expanded leaves collected from 4-week-old wild-type or fbr12 plants
were used for the analysis of dark-induced leaf senescence essentially as
described (Guo and Crawford, 2005). Total chlorophyll was extracted from
dark-treated or not-treated leaves and analyzed as described (Lichtenthaler,
1987).
Molecular Complementation of the fbr12
Mutant Phenotype
The T-DNA-tagged genomic sequence in the fbr12 genome was identified
by TAIL-PCR as previously described (Liu et al., 1995; Sun et al., 2003). For
molecular complementation, a 2.5-kb FBR12 genomic clone was obtained by
PCR using primer pairs (FBR12F1, 5#-CCTCGAGGTGGGGCCGCATGGAATGCA-3#; and FBR12B1, 5#-CACTAGTCACTCTTGAATCGTGCA-3#) and
PWO DNA polymerase (Roche Diagnostics). The genomic clone included a
1.1-kb sequence upstream from the translation start codon and 0.3 kb of the
3#-UTR sequence. The PCR fragment, digested with XhoI and SpeI, was cloned
into the same sites of pER8 (Zuo et al., 2000). The resulting construct was
transformed into Agrobacterium tumefaciens strain GV3101, which was used
for transformation of fbr12/1 heterozygous plants by vacuum infiltration
(Bechtold et al., 1993).
All other molecular manipulations were carried out according to standard
methods (Sambrook and Russell, 2001). RNA northern-blot and real-time PCR
analyses were carried out as described previously (Sun et al., 2003; Feng et al.,
2006). Semiquantitative reverse transcription (RT)-PCR was performed as
previously described (Sun et al., 2005). Actin8 (At1g49240) was used as an
internal control in all assays. Primer pairs used in the RT-PCR analyses were
(all sequences are from the 5#-end to the 3#-end): AT1G11980F, GAGTTCTTCTTCTTCCTCCA and AT1G11980R, GAAACCGGTCGAGCCAGTGA;
AT3G59845F, GGTGAGGAATCTTTACTTGT and AT3G59845R, GTAGCTGAGAGGAACATTGA; AT5G03840F, CCATGAGCTCTTTCCTTCT and
AT5G03840R, GTGTTGAAGTGATCTCTCGA; FBR12F, TCAAAAACCGTCCCTGCAAGGT and FBR12R, CATTTGGCGTGACCGTGCTT; and Actin8F,
TTGCAGACCGTATGAGCAAAGAGA and Actin8R, TGGTGCCACGACCTTAATCTTCA.
Genetic Complementation in Yeast Cells
An FBR12 cDNA fragment was PCR amplified using primer pairs (AT1G26630F2,
5#-CCCCGGGATGTCTGACGACGAGCACCA-3#; and AT1G26630B2, 5#-CACTAGTTGACGTCCGTTGTCAAACTGGT-3#), and then cloned into a pGEM-T Easy
vector (Promega). This cDNA fragment, containing the entire ORF of FBR12
and 32 bp of the 3#-UTR, was verified by DNA sequencing. The insert was
released by SmaI and PstI digestion and cloned into the same sites of a pQE-82
L vector (Qiagen). The cDNA fragment released from pQE-FBR12 by SacI
and SpeI was cloned into the SacI and XbaI of a pYES2 vector (Invitrogen)
under the control of a GAL1 promoter. Therefore, FBR12 expression in yeast
(Saccharomyces cerevisiae) cells is inducible by Gal and repressible by Glc (West
et al., 1984; Giniger et al., 1985). Culture and transformation of yeast cells were
carried out according to standard protocols (Ausubel et al., 1994).
ACKNOWLEDGMENTS
We would like to thank the Arabidopsis Biological Resource Center
(ABRC) for providing seeds, and Dr. Allan Jacobson (University of Massachusetts Medical School) and Dr. Pamela A. Silver (Harvard Medical School)
for providing yeast strains. We would also like to thank Dr. Yongbiao Xue,
Dr. Shuhua Yang, and Dr. De Ye for critically reading the manuscript. We are
grateful to Dr. Weicai Yang for valuable advice on microscopic studies.
Received February 14, 2007; accepted May 16, 2007; published May 18, 2007.
LITERATURE CITED
Abbas HK, Tanaka T, Duke SO, Porter JK, Wray EM, Hodges L, Sessions
AE, Wang E, Merrill AH Jr, Riley RT (1994) Fumonisin- and AAL-toxininduced disruption of sphingolipid metabolism with accumulation of
free sphingoid bases. Plant Physiol 106: 1085–1093
Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA,
Struhl K (1994) Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York
Plant Physiol. Vol. 144, 2007
1543
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Feng et al.
Bechtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium-mediated
gene transfer by infiltration of adult Arabidopsis thaliana plants. CR Acad
Sci III 316: 1194–1199
Bevec D, Hauber J (1997) Eukaryotic initiation factor 5A activity and HIV-1
Rev function. Biol Signals 6: 124–133
Caraglia M, Marra M, Giuberti G, D’Alessandro AM, Budillon A, del
Prete S, Lentini A, Beninati S, Abbruzzese A (2001) The role of
eukaryotic initiation factor 5A in the control of cell proliferation and
apoptosis. Amino Acids 20: 91–104
Chen ZP, Chen KY (1997) Dramatic attenuation of hypusine formation on
eukaryotic initiation factor 5A during senescence of IMR-90 human
diploid fibroblasts. J Cell Physiol 170: 248–254
Danon A, Gallois P (1998) UV-C radiation induces apoptotic-like changes
in Arabidopsis thaliana. FEBS Lett 437: 131–136
Feng H, An F, Zhang S, Ji Z, Ling HQ, Zuo J (2006) Light-regulated, tissuespecific, and cell differentiation-specific expression of the Arabidopsis
Fe(III)-chelate reductase gene AtFRO6. Plant Physiol 140: 1345–1354
Gilchrist DG, Wang H, Bostock RM (1994) Sphingosine-related mycotoxins in plant and animal diseases. Can J Bot 73: S459–S467
Giniger E, Barnum SM, Ptashne M (1985) Specific DNA binding of GAL4,
a positive regulatory protein of yeast. Cell 40: 767–774
Guo FQ, Crawford NM (2005) Arabidopsis nitric oxide synthase1 is targeted
to mitochondria and protects against oxidative damage and darkinduced senescence. Plant Cell 17: 3436–3450
Hanazawa M, Kawasaki I, Kunitomo H, Gengyo-Ando K, Bennett KL,
Mitani S, Iino Y (2004) The Caenorhabditis elegans eukaryotic initiation
factor 5A homologue, IFF-1, is required for germ cell proliferation,
gametogenesis and localization of the P-granule component PGL-1.
Mech Dev 121: 213–224
Herr JM (1971) A new clearing-squash technique for the study of ovule
development in angiosperms. Am J Bot 58: 785–790
Hofmann W, Reichart B, Ewald A, Muller E, Schmitt I, Stauber RH,
Lottspeich F, Jockusch BM, Scheer U, Hauber J, et al (2001) Cofactor
requirements for nuclear export of Rev response element (RRE)- and
constitutive transport element (CTE)-containing retroviral RNAs. An
unexpected role for actin. J Cell Biol 152: 895–910
Jao DLE, Chen KY (2006) Tandem affinity purification revealed the
hypusine-dependent binding of eukaryotic initiation factor 5A to the
translating 80S ribosomal complex. J Cell Biochem 97: 583–598
Jenkins ZA, Haag PG, Johansson HE (2001) Human eIF5A2 on chromosome 3q25-q27 is a phylogenetically conserved vertebrate variant of
eukaryotic translation initiation factor 5A with tissue-specific expression. Genomics 71: 101–109
Jin BF, He K, Wang HX, Wang J, Zhou T, Lan Y, Hu MR, Wei KH, Yang SC,
Shen BF, et al (2003) Proteomic analysis of ubiquitin-proteasome effects:
insight into the function of eukaryotic initiation factor 5A. Oncogene 22:
4819–4830
Kang HA, Hershey JW (1994) Effect of initiation factor eIF-5A depletion on
protein synthesis and proliferation of Saccharomyces cerevisiae. J Biol
Chem 269: 3934–3940
Kang HA, Schwelberger HG, Hershey JW (1993) Translation initiation
factor eIF-5A, the hypusine-containing protein, is phosphorylated on
serine in Saccharomyces cerevisiae. J Biol Chem 268: 14750–14756
Kemper WM, Berry KW, Merrick WC (1976) Purification and properties of
rabbit reticulocyte protein synthesis initiation factors M2Ba and M2Bb.
J Biol Chem 251: 5551–5557
Li AL, Li HY, Jin BF, Ye QN, Zhou T, Yu XD, Pan X, Man JH, He K, Yu M,
et al (2004) A novel eIF5A complex functions as a regulator of p53 and
p53-dependent apoptosis. J Biol Chem 279: 49251–49258
Lichtenthaler HK (1987) Chlorophylls and carotenoids—pigments of photosynthetic biomembranes. Methods Enzymol 148: 350–382
Lipowsky G, Bischoff FR, Schwarzmaier P, Kraft R, Kostka S, Hartmann
E, Kutay U, Gorlich D (2000) Exportin 4: a mediator of a novel nuclear
export pathway in higher eukaryotes. EMBO J 19: 4362–4371
Liu YG, Mitsukawa N, Oosumi T, Whittier RF (1995) Efficient isolation
and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal
asymmetric interlaced PCR. Plant J 8: 457–463
Liu YP, Nemeroff M, Yan YP, Chen KY (1997) Interaction of eukaryotic
initiation factor 5A with the human immunodeficiency virus type 1 Rev
response element RNA and U6 snRNA requires deoxyhypusine or
hypusine modification. Biol Signals 6: 166–174
McCormick S (2004) Control of male gametophyte development. Plant Cell
(Suppl) 16: S142–S153
Mizukami Y, Fischer RL (2000) Plant organ size control: AINTEGUMENTA
regulates growth and cell numbers during organogenesis. Proc Natl
Acad Sci USA 97: 942–947
Mizukami Y, Ma H (1992) Ectopic expression of the floral homeotic gene
AGAMOUS in transgenic Arabidopsis plants alters floral organ identity.
Cell 71: 119–131
Mou Z, He Y, Dai Y, Liu X, Li J (2000) Deficiency in fatty acid synthase
leads to premature cell death and dramatic alterations in plant morphology. Plant Cell 12: 405–418
Murashige T, Skoog F (1962) A revised medium for rapid growth and
bioassays with tobacco tissue culture. Physiol Plant 15: 473–497
Murzin AG (1993) OB (oligonucleotide/oligosaccharide binding)-fold:
common structural and functional solution for non-homologous sequences. EMBO J 12: 861–867
Park MH, Lee YB, Joe YA (1997) Hypusine is essential for eukaryotic cell
proliferation. Biol Signals 6: 115–123
Park MH, Wolff EC (1988) Cell-free synthesis of deoxyhypusine. Separation of protein substrate and enzyme and identification of 1,3diaminopropane as a product of spermidine cleavage. J Biol Chem 263:
15264–15269
Park MH, Wolff EC, Folk JE (1993) Hypusine: its post-translational
formation in eukaryotic initiation factor 5A and its potential role in
cellular regulation. Biofactors 4: 95–104
Rosorius O, Reichart B, Kratzer F, Heger P, Dabauvalle MC, Hauber J
(1999) Nuclear pore localization and nucleocytoplasmic transport of
eIF-5A: evidence for direct interaction with the export receptor CRM1.
J Cell Sci 112: 2369–2380
Sambrook J, Russell DW (2001) Molecular Cloning: A Laboratory Manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Sanders PM, Bui AQ, Weterings K, McIntire KN, Hsu YC, Lee PY, Truong
MT, Beals TP, Goldberg RB (1999) Anther developmental defects in
Arabidopsis thaliana male-sterile mutants. Sex Plant Reprod 11: 297–322
Schatz O, Oft M, Dascher C, Schebesta M, Rosorius O, Jaksche H,
Dobrovnik M, Bevec D, Hauber J (1998) Interaction of the HIV-1 Rev
cofactor eukaryotic initiation factor 5A with ribosomal protein L5. Proc
Natl Acad Sci USA 95: 1607–1612
Schindelin H, Jiang W, Inouye M, Heinemann U (1994) Crystal structure
of CspA, the major cold shock protein of Escherichia coli. Proc Natl Acad
Sci USA 91: 5119–5123
Schneitz K, Hülskamp M, Pruitt RE (1995) Wild-type ovule development
in Arabidopsis thaliana: a light microscope study of cleared whole-mount
tissue. Plant J 7: 731–749
Sette M, van Tilborg P, Spurio R, Kaptein R, Paci M, Gualerzi CO,
Boelens R (1997) The structure of the translational initiation factor IF1
from E. coli contains an oligomer-binding motif. EMBO J 16: 1436–1443
Singh US, Li Q, Cerione R (1998) Identification of the eukaryotic initiation
factor 5A as a retinoic acid-stimulated cellular binding partner for tissue
transglutaminase II. J Biol Chem 273: 1946–1950
Stone JM, Heard JE, Asai T, Ausubel FM (2000) Simulation of fungalmediated cell death by fumonisin B1 and selection of fumonisin
B1-resistant ( fbr) Arabidopsis mutants. Plant Cell 12: 1811–1822
Stone JM, Liang X, Nekl ER, Stiers JJ (2005) Arabidopsis AtSPL14, a plantspecific SBP-domain transcription factor, participates in plant development and sensitivity to fumonisin B1. Plant J 41: 744–754
Sun J, Hirose N, Wang X, Wen P, Xue L, Sakakibara H, Zuo J (2005)
Arabidopsis SOI33/AtENT8 gene encodes a putative equilibrative nucleoside transporter that is involved in cytokinin transport in planta. J Integr
Plant Biol 47: 588–603
Sun J, Niu QW, Tarkowski P, Zheng B, Tarkowska D, Sandberg G, Chua
NH, Zuo J (2003) The Arabidopsis AtIPT8/PGA22 gene encodes an
isopentenyl transferase that is involved in de novo cytokinin biosynthesis. Plant Physiol 131: 167–176
Thompson GM, Cano VS, Valentini SR (2003) Mapping eIF5A binding
sites for Dys1 and Lia1: in vivo evidence for regulation of eIF5A
hypusination. FEBS Lett 555: 464–468
Thompson JE, Hopkins MT, Taylor C, Wang TW (2004) Regulation of
senescence by eukaryotic translation initiation factor 5A: implications
for plant growth and development. Trends Plant Sci 9: 174–179
Tome ME, Gerner EW (1997) Cellular eukaryotic initiation factor 5A
content as a mediator of polyamine effects on growth and apoptosis.
Biol Signals 6: 150–156
Valentini SR, Casolari JM, Oliveira CC, Silver PA, McBride AE (2002)
Genetic interactions of yeast eukaryotic translation initiation factor 5A
1544
Plant Physiol. Vol. 144, 2007
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.
Characterization of the Arabidopsis eIF-5A-2 Gene
(eIF5A) reveal connections to poly(A)-binding protein and protein
kinase C signaling. Genetics 160: 393–405
Wang E, Norred WP, Bacon CW, Riley RT, Merrill AHJ (1991) Inhibition of
sphingolipid biosynthesis by fumonisins. Implications for diseases
associated with Fusarium moniliforme. J Biol Chem 266: 14486–14490
Wang TW, Lu L, Wang D, Thompson JE (2001) Isolation and characterization of senescence-induced cDNAs encoding deoxyhypusine synthase and eucaryotic translation initiation factor 5A from tomato. J Biol
Chem 276: 17541–17549
Wang TW, Lu L, Zhang CG, Taylor C, Thompson JE (2003) Pleiotropic
effects of suppressing deoxyhypusine synthase expression in Arabidopsis thaliana. Plant Mol Biol 52: 1223–1235
Wang TW, Zhang CG, Wu W, Nowack LM, Madey E, Thompson JE (2005)
Antisense suppression of deoxyhypusine synthase in tomato delays
fruit softening and alters growth and development. Plant Physiol 138:
1372–1382
West RWJ, Yocum RR, Ptashne M (1984) Saccharomyces cerevisiae GAL1-
GAL10 divergent promoter region: location and function of the upstream activator sequence UASG. Mol Cell Biol 4: 2467–2478
Wolff EC, Park MH, Folk JE (1990) Cleavage of spermidine as the first
step in deoxyhypusine synthesis. The role of NAD. J Biol Chem 265:
4793–4799
Xu A, Chen KY (2001) Hypusine is required for a sequence-specific
interaction of eukaryotic initiation factor 5A with postsystematic evolution of ligands by exponential enrichment RNA. J Biol Chem 276:
2555–2561
Yang WC, Ye D, Xu J, Sundaresan V (1999) The SPOROCYTELESS gene of
Arabidopsis is required for initiation of sporogenesis and encodes a novel
nuclear protein. Genes Dev 13: 2108–2117
Zuk D, Jacobson A (1998) A single amino acid substitution in yeast eIF-5A
results in mRNA stabilization. EMBO J 17: 2914–2925
Zuo J, Niu QW, Chua NH (2000) An estrogen receptor-based transactivator
XVE mediates highly inducible gene expression in transgenic plants.
Plant J 24: 265–273
Plant Physiol. Vol. 144, 2007
1545
Downloaded from on August 10, 2017 - Published by www.plantphysiol.org
Copyright © 2007 American Society of Plant Biologists. All rights reserved.