Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Artificial gene synthesis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA silencing wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Non-coding RNA wikipedia , lookup
INFORMATION ON MASTER’THESIS 1. Full name: Tran Thi Tinh 2. Sex: Female 3. Date of birth: 15/10/1982 4. Place of birth: Tuyen Quang 5. Admission decision number: Dated 6. Changes in academic process: No 7. Official thesis title: “The study of rapid detection of avian influenza virus (A/H5N1) in clinical samples by multiplex reverse transcription polymerase chain reaction”. (This study were carried out in the laboratory of Thai Binh Medical University) 8. Major: Experimental Biology 9. Code: 60 42 30 10. Supervisors: Prof. Luong Xuan Hien - Thai Binh Medical University 11. Summary of the finding of the thesis: I. Introduction: Avian influenza (AI) is a highly contagious disease cause by type A influenza virus, a member of the Orthomyxoviridae family. Influenza A virus causes major and frequently fatal in birds, as well as in mammals including humans. At times of influenza A virus subtype H5N1 outbreaks, control of further outbreaks and re-emergence prevention are very important. Therefore, rapid accurate and sensitive molecular diagnostic methods is crucical for large-scale screening of this virus. So that, we study objective with aim: 1. Design and select appropriate primers for detection of avian influenza virus by multiplex reverse transcription polymerase chain reaction. 2. Optimize conditions for multiplex RT-PCR: appropriated time and temperature for primer annealing, concentration of participated components,.. 3. Test some collected clinical samples with multiplex RT-PCR for detection of avian influenza virus. II. Materials and methods Source of Viruses: RNA of influenza A virus subtype H5N1 obtained from The Institute of Biotechnology(IBT). Positive samples were (N=14) collected for from H5N1 subtype diseased of avian influenza and A viruses human; samples (N=30) were collected from diseased avian in influenza pandemic which outbreak in 2009. RNA extraction: RNA extraction was performed using the QIAmp Viral RNA mini Kit according to the manufacturer’s specifications. Primer Designs: Nucleotide sequences of the matrix (M), hemagglutinin (HA) and neuraminidase (NA) genes were taken from the Influenza Virus Resource of the NCBI database (http://www.ncbi.nlm.nih.gov/genomes/FLU/FLU.html). These sequences were aligned using the ClustalX 2.0.11 program. The primers were designed and analyzed by using the PCR primer software: BioEid, FastPCR 5.4 to ascertain that they could be combined in a mutiplex RT-PCR format. Mutiplex RT-PCR optimality: The multiplex RT-PCR reaction was performed with the Qiagen OneStep RT-PCR Kit according to the manufacturer’s specifications in a Master cycler C1000 (Biorad). The multiplex RT-PCR were tested and optimized in different conditions on primer concentrations, annealing temperature… After PCR amplification, 10 µl of PCR products were subjected to 2% agarose gel electrophoresis. Gel stained with 0.5 µg/ml ethidium bromide solution for 15 min and visualized on a UVP. The expected sizes of each PCR product are compare to standar DNA maker. Specificity test of mutiplex RT-PCR: For positive specificity test, RNA extracted from specimens positive for influenza A virus subtype H1N1, subtype H3, influenza B virus (National Institute of Hygiene and Epidemiology provides), influenza A virus subtype H5 (National centre for veterinary diagnostics provides) and DNA, RNA samples being in our lab were amplified by the mutiplex RT-PCR to check cross reaction occurred against other specimens. Sensitivity test of mutiplex RT-PCR: The genes of influenza A virus subtype H5N1 were used to construct plasmid DNAs by insertion of the M, HA and NA genes in to the pJET1.2/blunt Vector (Fermentas) by CloneJETTM PCR Cloning Kit #K1231, #K1232. In vitro transcription was performed by using TranscriptAid™ T7 High Yield Transcription Kit (Fermentas) following the manufacturer’s recommendations. The concentration of the transcribed RNAs was calculated by measuring absorbance at 260 nm. The RNAs were then serially diluted 10-fold, ranging from stock concentration to 10 copies/ µl to perform sensitivity tests. III. Result Primer Designs: After analysis sequences of M, HA, NA gen in influenenza A virus subtype H5N1 optained from GenBank by design softwares, three primer pairs were chose to perform mutiplex RT-PCR for detecting influenza A virus subtype: Primers Sequences (5’-3’) Position Tm DiagMF GTCTTCTAACCGAGGTCGAAAC 5-26 55.1 DiagMR GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA 794-775 55.4 Size 154 bp 371 bp 292 bp Mutiplex RT-PCR: RT-PCR reaction to each grade separately primer were conducted to determine the conditions (primer concentration, temperature for primer annealing, extensible time, the number of cycles) the most appropriate for each primer. Then, RT-PCR reaction tested with all of 3 primer sets to determine the optimal conditions for reaction. The results of the test showed that mutiplex RT-PCR for the best result in the primer concentration for the M, HA and NA gene respectively 0.3 µM, 0.5 µM and 0.4 µM; reaction is performed with thermal program: reverse transcription at 50°C for 30 min; initial denaturation at 95oC for 15 minutes followed by 45 cycles (94oC: 30 seconds; 57oC: 30 seconds; 72oC: 30 seconds) ; 72oC in 5 minutes. Specificity test of mutiplex RT-PCR: The mutiplex RT-PCR were performed with RNA of some specimens (influenza virus and RNA, DNA sample in Lab). As a result, rection only amplify genes of influenza A virus subtype H5N1 (M, H5 and N1). Specificity test of mutiplex RT-PCR: The multiplex RT-PCR were performed with standard samples having different concentration from 10 to 109 copies/µl and 10 µl of PCR product subjected to 2% agarose gel electrophoresis. Amplified products visible at RNA concentrations as low as 101 copies/ µl Applying the technique of mutiplex RT-PCR detects influenza A/H5N1 in the clinical samples: Mutiplex RT-PCR technique tested on 14 positive samples for A/H5N1 influenza virus. As a result, mutiplex RT-PCR reactions were detected A/H5N1 influenza virus in all 14 samples. Mutiplex RT-PCR technique identified H5N1 influenza in 30 samples (collected from infected poultry during outbreaks of influenza). Findings are 9 samples positive for H5N1 influenza (30%) and 21 negative samples for H5N1 influenza (70%). Conclusion: - Designed to be three pairs of gene-specific primers with M, HA and NA gene used to detect avian influenza A virus H5N1 in clinical specimens by RT-PCR reactions. - Most successful construction mutiplex RT-PCR method allows rapid detection of influenza A virus H5N1 with high sensitivity and specificity and can be applied for detecting infection with influenza A virus H5N1 in avian and human. - Mutiplex RT-PCR method only specific to the influenza A virus H5N1, no crossreactivity with other species. Technique able to detect in the sample having 10 or more copies of virus. 12. Practical applicability: Applying the technique of mutiplex RT-PCR detects influenza A virus H5N1 in clinical samples in avian and human. Date: 2/12/2011 Signature: Full name:Tran Thi Tinh