Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Supplementary Information Legends to supplementary figures Supplementary Figure 1. Growth inhibitory effect and of MA1. Human PCa cell lines PC3 and LNCaP were cultured at 96-well plates 24 h before treatment with 50 to 400 nM MA1 for 24 h. The viability was determined by the MTT assay. Values are means ± SD of three experiments. *P < 0.05, versus MA1-untreated control group respectively. Supplementary Figure 2. Apoptosis in PC3 and LNCaP cells as visualized by DAPI staining after MA1 treatment. Cells were exposed for indicated times to 150 nM MA1 prior to staining with DAPI for 30 min. Supplementary Figure 3. Response of fluorescence probe coumarin derived azide 51. PC3 and LNCaP cells exposed to 150 nM MA1 or vehicle for 4 h were incubated with 30 μM probe 51 for 1 h in the dark and then examined by confocal microscopy (scale bar, 10 μm). Supplementary Figure 4. Effect of MA1 on DNA damage and ER stress in PCa cells. a DNA damage mediated by MA1 was estimated through the levels of γH2AX and p-BRCA1 by western blotting assay response to MA1. b Induction of ER stress by MA1. The protein levels of GRP78, CHOP, ATF4, p-PREK were tested by western blotting. c QRT-PCR analysis of mRNA levels of GRP78, CHOP, ATF4, ATF3 and DDIT4. In a-c, PC3 and LNCaP cells were treated with 150 nM MA1 of different times as indicated. GAPDH served as a loading control. Supplementary Figure 5. Effects of MA1 treatment on lysosomal stability. PC3 and LNCaP cells were exposed to 150 nM MA1 for indicated times, and lysosomal stability was analyzed by AO-uptake methods. Supplementary Table 1. Primers for quantitative RT-PCR analysis Forward primer (5'->3') Reverse primer (5'->3') SOD2 TTCTGGACAAACCTCAGCCCTA AACCTGAGCCTTGGACACCA GSTP1 CCTGTACCAGTCCAATACCATCC TCCTGCTGGTCCTTCCCATA DJ-1 GTAGCCGTGATGTGGTCATTT CTGTGCGCCCAGATTACCT LC3B GAAGATGTCCGACTTATTCGAGAG ACTCTCATACACCTCTGAGATTGG GRP78 GAAAGAAGGTTACCCATGCAGT CAGGCCATAAGCAATAGCAGC ATF3 TTGCAGAGCTAAGCAGTCGTGGTA ATGGTTCTCTGCTGCTGGGATTCT ATF4 TGGCCAAGCACTTCAAACCT GTTGTTGGAGGGACTGACCAA CHOP GGAAACAGAGTGGTCATTCCC CTGCTTGAGCCGTTCATTCTC DDIT4 AGCGGCAGGACGCACTTGTC GGCCGATCTGGGGTGGGAGT GAPDH TGGTCACCAGGGCTGCTT AGCTTCCCGTTCTCAGCCTT