Download pcr_lab_handout_-_bio1_part_1_updated_3_31_16

Biol-M01 – PCR Lab: Part 1 – Isolating and Amplifying Human DNA
 Amplification of an Intron from the PLAT Locus Using the Polymerase Chain Reaction (PCR)
Introduction
The polymerase chain reaction (PCR) is one of the most important technological
developments in the field of molecular biology. This technique allows one to
dramatically increase the amount of DNA by orders of magnitude. From a few
molecules of DNA, one can obtain measurable (micrograms) quantities of DNA in a
short reaction. This has allowed investigators to take a sample of DNA that is too small
to work with and increase the amount so that there is enough to analyze. After a 1½
hour PCR reaction, an investigator will have enough DNA to do nucleotide sequencing,
restriction analysis, cloning, etc.
Today, you will isolate DNA from the nuclei of your own Buccal Epithelial (cheek) cells
and then prepare it for amplification. During the week, your DNA will be put in a thermal
cycler to amplify a short region of the DNA on chromosome #8.Then during next lab
period, we will look at everyone’s DNA on an agarose gel to investigate differences at
this specific region of chromosome #8.
ЮЮЮ
dNTPs
Background Information
The DNA of any organism can be isolated from cells in a test tube. We can then choose
one specific segment of the DNA molecule along a chromosome and amplify it to make
billions of copies of just that segment of DNA.
As we have learned, each person inherits two copies of every chromosome – 23 from
each parent. Thus, every person inherits two versions of each gene: one from the
mother and one from the father. For example, the PLAT gene is located in a specific
location on human chromosome #8. Since both the mother (egg) and the father (sperm)
each contribute a copy of chromosome #8 to the child, the child carries two versions of
the PLAT gene. Recall that different versions of a gene are called alleles. If the gene
donated by the mother and the father are the same, we say the child is homozygous
(AA or aa). However, if the alleles donated by the mother and father are different, we
say the child is heterozygous (Aa) for that gene.
PLAT
gene
The locus we will amplify is located in
the PLAT gene which codes for a
tissue plaminogen activator (tPA). This
gene is carried on chromosome eight.
The gene codes for a protein (tPA)
that is involved with dissolving blood
clots. tPA is a protein administered to
heart attack victims to reduce the
incidence of strokes. The region we
will be amplifying, however, is located
in an intron (non-translated region), of
the PLAT gene.
The intron that we will be targeting for
amplification is dimorphic, which
means the locus has two forms. One
form carries a 300 bp DNA fragment
known as an Alu element and the
second form of the locus does not
carry this fragment. Therefore, when
we examine this locus, we find that it
may or may not carry an alu element.
The figure indicates the intron we will
be targeting for PCR.
Fig. 1 PCR target intron. (from Amgen-Bruce Wallace Program)
Alu is a remnant of a retrovirus that moved about and accumulated in primate genomes
over time. The haploid (single chromosome set) human genome contains about
500,000 copies of this Alu sequence scattered thoughout all the chromosomes and
constitutes about 5% of human DNA. Thus, Alu sequences are found on average about
once every 5,000 base pairs in the human genome, and are found in every person’s
DNA. Work on the PLAT gene suggests that Alu inserted itself into this gene about one
million years ago. Thus, We are the only primate with an Alu insertion in the PLAT gene.
However, a million years ago Alu (presumably) inserted itself into one person’s PLAT
gene. So, the only people today who carry this Alu insertion in their PLAT gene are
descendants of this person who lived a million years ago. That is, some people carry
the insertion and some do not.
Ethnic Variations in Allelic and Genotypic Frequencies for
the PLAT Intron 8-9 alu Locus
Ethnic Group
Chinese
Ethiopians
Europeans
Japanese
Nasioi
Ticuna
Allelic Frequency
alu+
alu0.47
0.13
0.57
0.56
0.05
0.92
0.53
0.87
0.43
0.44
0.95
0.08
Genotypic Frequencies
alu+ alu+
alu+ alualu- alu0.221
0.017
0.325
0.314
0.003
0.846
0.498
0.226
0.490
0.246
0.095
0.147
0.281
0.757
0.185
0.099
0.903
0.006
Table 1. The allelic and genotypic frequencies for the PLAT alu element in different human ethnic groups
are shown.
In this exercise, we will amplify a region of your PLAT gene to determine if you are
homozygous for the Alu insertion, if you are homozygous for the absence of the Alu
insertion, or if you are heterozygous. Remember you have two chromosomes that carry
the PLAT gene. The Alu insertion is about 300 bp long. If your DNA contains the
insertion, the amplified DNA segment will be about 400 bp in length. If your DNA does
not contain the Alu insesrtion, then amplified DNA segment will be about 100 bp in
length.
During this lab, you will accomplish four processes:
1. Learn how to use a micropipettor to accurately dispense very small quantities of
liquid reagents.
2. Isolate and purify a sample of your own DNA.
3. Set up and carry out a PCR reaction using your purified DNA sample.
4. Visualize the results of your PCR reaction using gel electrophoresis.
Working with Micropipettors
Even large quantities of DNA are very small by everyday standards. Special tools have
been developed to allow us to work with these small quantities. One of these tools is the
micropipettor. In this exercise, we will be measuring fluid in microliters (µL), which is
one-one thousandth of a milliliter.
Micropipettors come in sizes of P-10, P-20, P-100, P-200 and P-1000 and others. Each
size has a range that the pipettor can measure.
Model Size
Adjustable Range
P-10
0.5 - 10 µL
P-20
2 – 20 µL
P-100
10 – 100 µL
P-200
20 – 200 µL
P-1000
100 – 1000 µL
Before picking up the micropipettor please read the following precautions:





Micropipettors are precision instruments. Please handle them carefully.
Never adjust a pipettor for a volume less than or greater than the range for
which it was designed.
Do not use the micropipettor without a disposable tip in place.
Do not lay the micropipettor down while there is fluid in the plastic tip.
Do not let the plunger “snap back” – depress it and release it gently with
your thumb.
tip ejector
sample plunger
volume adjustment
wheel
disposable tips
Pick up the micropipettor and look to see the
maximum and minimum volumes that it can hold.
Observe the current setting in the window on the
body of the micropipettor. Notice that you can
change the number in the window by rotating the
volume adjustment wheel in the handle. Be sure
you know how to “read” the setting.
Place a disposable tip onto the end of the pipette
barrel. Check to see if the tip is firmly seated onto
the barrel. Avoid touching the pointed end, as this
will contaminate the tip. Remember you must
have a tip in place when using the pipette.
Place your thumb on the sample plunger and
slowly push down and notice that it has a “first
stop” position. The first stop allows you to retrieve
the desired volume of sample. If you exert a little
more pressure, the plunger goes to the “second
stop.” The second stop pushes a small volume of
air into the tip to eject the solution
When aspirating (drawing-up) a solution, push the
plunger to the first stop and lower the pipette tip below
the level of the solution that you are sampling. You
should be holding the tube containing the solution in
your hand about eye-level. It’s important to actually
see the solution enter the pipette tip.
Slowly release the plunger and allow the liquid to move into the pipette tip. Be certain
you are not aspirating air into the tip.
When dispensing (pushing out) the liquid, place the pipette tip into the tube that will
receive the solution. Position the tip so that it touches the side near the bottom of the
tube. Slowly push down on the plunger to the first stop and then to the second stop.
Keep your thumb on the plunger and remove the tip from the tube into which you are
dispensing the liquid. This will avoid re-aspirating the liquid into the pipette tip. Be
certain that you see the solution leaving the tip. Use the eject button to eject the tip into
a waste container. Always use a fresh tip to avoid contamination.
Pipetting Exercise
1. Use a permanent marker to label three microfuge tubes A, B, and C.
2. Use the table below as a checklist while adding reagents to each tube. Refer to
the detailed directions that follow.
Tube
A
B
C
3.
4.
5.
6.
7.
8.
9.
Solution 1
2 µL
2 µL
2 µL
Solution 2
4 µL
-----
Solution 3
--8 µL
---
Solution 4
4 µL
--8 µL
Total Volume
10 µL
10 µL
10 µL
Set the P-20 micropipettor to 2 µL and dispense Solution 1 into tubes A, B, C.
Eject the tip into the plastic waste container and replace with a fresh tip.
Dispense 4 µL of Solution 2 into tube A.
Use a fresh tip and dispense 4 µL of Solution 4 into tube A.
Use a fresh tip and dispense 8 µL of Solution 3 into tube B.
Use a fresh tip and dispense 8 µL of Solution 4 into tube C.
Close the tubes and place tubes in the microcentrifuge and spin briefly to collect
solutions in the bottom of the tube. Make sure tubes are in a BALANCED
configuration in the microcentrifuge.
Checking the Accuracy and Consistency of Pipeting
Tubes A, B and C should each contain 10 µL of solution.
Set your P-20 micropipettor to 10 µL and place a fresh tip on to the barrel.
Slowly withdraw the solution from tube A.
Is there fluid left in the tube? Is the tip filled or is there an air space left in the
end?
5. Repeat steps 3 & 4 for tubes B and C.
1.
2.
3.
4.
The Polymerase Chain Reaction (PCR)
Objectives




Understand that a DNA Thermal Cycler is a machine that performs the PCR reaction.
Understand the sequence of reactions that are repeated many times in the PCR
reaction.
Understand that DNA polymerase enzyme can be used to replicate the desired
segment many times over.
Understand that DNA primers can be used to amplify a desired segment of DNA on a
chromosome.
The DNA molecule is a double helix. This structure results from the pairing of
nucleotides along each strand of the DNA double helix. The nucleotide adenine (A) will
always pair with the nucleotide thymine (T). Likewise, the nucleotide guanine (G) will
always pair with the nucleotide cytosine (C). The arrangement of these nucleotide “base
pairs” allows a perfect molecule to be duplicated. To make a copy of the DNA molecule,
the two strands of DNA separate, and a new strand is synthesized from each “template”
of the original molecule.
Original DNA Molecule
*****ATGCTTGACTAGCCTAGCTGA*****
*****TACGAACTGATCGGATCGACT*****
*****ATGCTTGACTAGCCTAGCTGA*****
←TCGACT*****
Separation and Synthesis
*****ATGCTT→
*****TACGAACTGATCGGATCGACT*****
*****ATGCTTGACTAGCCTAGCTGA*****
*****TACGAACTGATCGGATCGACT*****
Two New DNA Molecules
*****ATGCTTGACTAGCCTAGCTGA*****
*****TACGAACTGATCGGATCGACT*****
Diagram 1 – Duplication of DNA Molecule from Original Double Helix
Amplification of the DNA in the PCR follows this same process. It uses a thermal cycler
to separate the DNA strands and control the process. All that is needed to get the PCR
reaction going in the test tube is the enzyme DNA polymerase which catalyzes the
reaction, sufficient quantities of each nucleotide (dATP, dTTP, dGTP, and dCTP) and
specific primers.
Amplification of DNA by PCR is dependent upon primers that target specific loci. The
two primers that we will be using have unique nucleotide sequences that are
complementary to only one locus in the human genome. The primer sequences are:
Forward primer: 5’ GTAAGAGTTCCGTAACAGGACAGCT 3’
Reverse primer: 5’ CCCCACCCTAGGAGAACTTCTCTTT 3’
The DNA polymerase used is called Taq polymerase. It was originally isolated from the
hot springs bacterium Thermus aquaticus which allows it to function at the elevated
temperatures used in the PCR.
Protocol: Isolating DNA from Buccal Epithelial Cells (Cheek Cells)
1. Obtain a 1.5 ml microfuge tube of NaCl2 solution. Label the tube with your
initials. Be sure to use a waterproof pen.
2. Get a tube of sterile toothpicks. Gently scrape the inside of your cheek with
the blunt end of a toothpick. Dip end of toothpick into tube of NaCl2
solution and swirl to dislodge cheek cell sample. Repeat cell collection 2 to 3
times with fresh toothpicks.
3. Centrifuge the microfuge tube for 2 minutes at
10,000 rpm to pellet the cells. Make sure tubes
are “balanced.”

2 minutes at 10,000 rpm
4. Carefully pour off the supernatant (liquid). Be careful not to lose the cell
pellet stuck to bottom of the tube.
5. Get 1.5 mL microfuge tube containing 0.1 mL Chelex. Quickly transfer all
the chelex solution to the tube containing the cells.
6. Close tube containing cells and chelex.
7. Vortex the tube to resuspend the cheek cells.
8. Put tube in float rack in 90C water bath for 10 minutes.

10 minutes
9. Store on ice until DNA is needed.
*While on being stored on ice, the chelex will settle to bottom of tube. Your
DNA will be in the supernatant – the upper liquid layer in your tube. Be
careful not to shake tube and resuspend the chelex.
Protocol: PCR Set-up for the PLAT alu Locus
1. Get a PCR tube containing a Ready-to-Go bead. Make sure the bead is at
the bottom of the tube. If not, gently tap on counter to drop bead down.
2. To side of PCR tube just above the bead, Add 22 L of MM (master mix
containing primers and water). Do not touch the bead with the pipette.
Use the P200 pipettor with tip.
What should be
displayed in the
P200 window?
3. To side of PCR tube just above the bead, Add 3 L of DNA template
from the supernatant of your boiled Chelex/cell tube. Be sure to remove
the DNA from the upper (supernatant) chelex-free portion of your
sample. Use P20 pipettor with tip.
What should be
displayed in the
P20 window?
4. Allow a moment for the bead to dissolve, and then gently “flick” the tube
with your finger to mix. Try to avoid making bubbles.
5. Spin the PCR tube in the pico-fuge” to collect the
reaction in the bottom of the tube. Make sure
tubes are “balanced.”
6. Put your PCR tube in one of the numbered holes in the PCR rack on the
ice. On the PCR sign up sheet, initial the corresponding square on the
grid. Be sure you label the correct location on
the sign up sheet.
*Later, the PCR tubes will be placed in the thermocycler, which will alternately
heat and cool the tubes to produce many fragments of the specific DNA
sequence that is being tested.