* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download pcr_lab_handout_-_bio1_part_1_updated_3_31_16
DNA replication wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA profiling wikipedia , lookup
DNA polymerase wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Biol-M01 – PCR Lab: Part 1 – Isolating and Amplifying Human DNA Amplification of an Intron from the PLAT Locus Using the Polymerase Chain Reaction (PCR) Introduction The polymerase chain reaction (PCR) is one of the most important technological developments in the field of molecular biology. This technique allows one to dramatically increase the amount of DNA by orders of magnitude. From a few molecules of DNA, one can obtain measurable (micrograms) quantities of DNA in a short reaction. This has allowed investigators to take a sample of DNA that is too small to work with and increase the amount so that there is enough to analyze. After a 1½ hour PCR reaction, an investigator will have enough DNA to do nucleotide sequencing, restriction analysis, cloning, etc. Today, you will isolate DNA from the nuclei of your own Buccal Epithelial (cheek) cells and then prepare it for amplification. During the week, your DNA will be put in a thermal cycler to amplify a short region of the DNA on chromosome #8.Then during next lab period, we will look at everyone’s DNA on an agarose gel to investigate differences at this specific region of chromosome #8. ЮЮЮ dNTPs Background Information The DNA of any organism can be isolated from cells in a test tube. We can then choose one specific segment of the DNA molecule along a chromosome and amplify it to make billions of copies of just that segment of DNA. As we have learned, each person inherits two copies of every chromosome – 23 from each parent. Thus, every person inherits two versions of each gene: one from the mother and one from the father. For example, the PLAT gene is located in a specific location on human chromosome #8. Since both the mother (egg) and the father (sperm) each contribute a copy of chromosome #8 to the child, the child carries two versions of the PLAT gene. Recall that different versions of a gene are called alleles. If the gene donated by the mother and the father are the same, we say the child is homozygous (AA or aa). However, if the alleles donated by the mother and father are different, we say the child is heterozygous (Aa) for that gene. PLAT gene The locus we will amplify is located in the PLAT gene which codes for a tissue plaminogen activator (tPA). This gene is carried on chromosome eight. The gene codes for a protein (tPA) that is involved with dissolving blood clots. tPA is a protein administered to heart attack victims to reduce the incidence of strokes. The region we will be amplifying, however, is located in an intron (non-translated region), of the PLAT gene. The intron that we will be targeting for amplification is dimorphic, which means the locus has two forms. One form carries a 300 bp DNA fragment known as an Alu element and the second form of the locus does not carry this fragment. Therefore, when we examine this locus, we find that it may or may not carry an alu element. The figure indicates the intron we will be targeting for PCR. Fig. 1 PCR target intron. (from Amgen-Bruce Wallace Program) Alu is a remnant of a retrovirus that moved about and accumulated in primate genomes over time. The haploid (single chromosome set) human genome contains about 500,000 copies of this Alu sequence scattered thoughout all the chromosomes and constitutes about 5% of human DNA. Thus, Alu sequences are found on average about once every 5,000 base pairs in the human genome, and are found in every person’s DNA. Work on the PLAT gene suggests that Alu inserted itself into this gene about one million years ago. Thus, We are the only primate with an Alu insertion in the PLAT gene. However, a million years ago Alu (presumably) inserted itself into one person’s PLAT gene. So, the only people today who carry this Alu insertion in their PLAT gene are descendants of this person who lived a million years ago. That is, some people carry the insertion and some do not. Ethnic Variations in Allelic and Genotypic Frequencies for the PLAT Intron 8-9 alu Locus Ethnic Group Chinese Ethiopians Europeans Japanese Nasioi Ticuna Allelic Frequency alu+ alu0.47 0.13 0.57 0.56 0.05 0.92 0.53 0.87 0.43 0.44 0.95 0.08 Genotypic Frequencies alu+ alu+ alu+ alualu- alu0.221 0.017 0.325 0.314 0.003 0.846 0.498 0.226 0.490 0.246 0.095 0.147 0.281 0.757 0.185 0.099 0.903 0.006 Table 1. The allelic and genotypic frequencies for the PLAT alu element in different human ethnic groups are shown. In this exercise, we will amplify a region of your PLAT gene to determine if you are homozygous for the Alu insertion, if you are homozygous for the absence of the Alu insertion, or if you are heterozygous. Remember you have two chromosomes that carry the PLAT gene. The Alu insertion is about 300 bp long. If your DNA contains the insertion, the amplified DNA segment will be about 400 bp in length. If your DNA does not contain the Alu insesrtion, then amplified DNA segment will be about 100 bp in length. During this lab, you will accomplish four processes: 1. Learn how to use a micropipettor to accurately dispense very small quantities of liquid reagents. 2. Isolate and purify a sample of your own DNA. 3. Set up and carry out a PCR reaction using your purified DNA sample. 4. Visualize the results of your PCR reaction using gel electrophoresis. Working with Micropipettors Even large quantities of DNA are very small by everyday standards. Special tools have been developed to allow us to work with these small quantities. One of these tools is the micropipettor. In this exercise, we will be measuring fluid in microliters (µL), which is one-one thousandth of a milliliter. Micropipettors come in sizes of P-10, P-20, P-100, P-200 and P-1000 and others. Each size has a range that the pipettor can measure. Model Size Adjustable Range P-10 0.5 - 10 µL P-20 2 – 20 µL P-100 10 – 100 µL P-200 20 – 200 µL P-1000 100 – 1000 µL Before picking up the micropipettor please read the following precautions: Micropipettors are precision instruments. Please handle them carefully. Never adjust a pipettor for a volume less than or greater than the range for which it was designed. Do not use the micropipettor without a disposable tip in place. Do not lay the micropipettor down while there is fluid in the plastic tip. Do not let the plunger “snap back” – depress it and release it gently with your thumb. tip ejector sample plunger volume adjustment wheel disposable tips Pick up the micropipettor and look to see the maximum and minimum volumes that it can hold. Observe the current setting in the window on the body of the micropipettor. Notice that you can change the number in the window by rotating the volume adjustment wheel in the handle. Be sure you know how to “read” the setting. Place a disposable tip onto the end of the pipette barrel. Check to see if the tip is firmly seated onto the barrel. Avoid touching the pointed end, as this will contaminate the tip. Remember you must have a tip in place when using the pipette. Place your thumb on the sample plunger and slowly push down and notice that it has a “first stop” position. The first stop allows you to retrieve the desired volume of sample. If you exert a little more pressure, the plunger goes to the “second stop.” The second stop pushes a small volume of air into the tip to eject the solution When aspirating (drawing-up) a solution, push the plunger to the first stop and lower the pipette tip below the level of the solution that you are sampling. You should be holding the tube containing the solution in your hand about eye-level. It’s important to actually see the solution enter the pipette tip. Slowly release the plunger and allow the liquid to move into the pipette tip. Be certain you are not aspirating air into the tip. When dispensing (pushing out) the liquid, place the pipette tip into the tube that will receive the solution. Position the tip so that it touches the side near the bottom of the tube. Slowly push down on the plunger to the first stop and then to the second stop. Keep your thumb on the plunger and remove the tip from the tube into which you are dispensing the liquid. This will avoid re-aspirating the liquid into the pipette tip. Be certain that you see the solution leaving the tip. Use the eject button to eject the tip into a waste container. Always use a fresh tip to avoid contamination. Pipetting Exercise 1. Use a permanent marker to label three microfuge tubes A, B, and C. 2. Use the table below as a checklist while adding reagents to each tube. Refer to the detailed directions that follow. Tube A B C 3. 4. 5. 6. 7. 8. 9. Solution 1 2 µL 2 µL 2 µL Solution 2 4 µL ----- Solution 3 --8 µL --- Solution 4 4 µL --8 µL Total Volume 10 µL 10 µL 10 µL Set the P-20 micropipettor to 2 µL and dispense Solution 1 into tubes A, B, C. Eject the tip into the plastic waste container and replace with a fresh tip. Dispense 4 µL of Solution 2 into tube A. Use a fresh tip and dispense 4 µL of Solution 4 into tube A. Use a fresh tip and dispense 8 µL of Solution 3 into tube B. Use a fresh tip and dispense 8 µL of Solution 4 into tube C. Close the tubes and place tubes in the microcentrifuge and spin briefly to collect solutions in the bottom of the tube. Make sure tubes are in a BALANCED configuration in the microcentrifuge. Checking the Accuracy and Consistency of Pipeting Tubes A, B and C should each contain 10 µL of solution. Set your P-20 micropipettor to 10 µL and place a fresh tip on to the barrel. Slowly withdraw the solution from tube A. Is there fluid left in the tube? Is the tip filled or is there an air space left in the end? 5. Repeat steps 3 & 4 for tubes B and C. 1. 2. 3. 4. The Polymerase Chain Reaction (PCR) Objectives Understand that a DNA Thermal Cycler is a machine that performs the PCR reaction. Understand the sequence of reactions that are repeated many times in the PCR reaction. Understand that DNA polymerase enzyme can be used to replicate the desired segment many times over. Understand that DNA primers can be used to amplify a desired segment of DNA on a chromosome. The DNA molecule is a double helix. This structure results from the pairing of nucleotides along each strand of the DNA double helix. The nucleotide adenine (A) will always pair with the nucleotide thymine (T). Likewise, the nucleotide guanine (G) will always pair with the nucleotide cytosine (C). The arrangement of these nucleotide “base pairs” allows a perfect molecule to be duplicated. To make a copy of the DNA molecule, the two strands of DNA separate, and a new strand is synthesized from each “template” of the original molecule. Original DNA Molecule *****ATGCTTGACTAGCCTAGCTGA***** *****TACGAACTGATCGGATCGACT***** *****ATGCTTGACTAGCCTAGCTGA***** ←TCGACT***** Separation and Synthesis *****ATGCTT→ *****TACGAACTGATCGGATCGACT***** *****ATGCTTGACTAGCCTAGCTGA***** *****TACGAACTGATCGGATCGACT***** Two New DNA Molecules *****ATGCTTGACTAGCCTAGCTGA***** *****TACGAACTGATCGGATCGACT***** Diagram 1 – Duplication of DNA Molecule from Original Double Helix Amplification of the DNA in the PCR follows this same process. It uses a thermal cycler to separate the DNA strands and control the process. All that is needed to get the PCR reaction going in the test tube is the enzyme DNA polymerase which catalyzes the reaction, sufficient quantities of each nucleotide (dATP, dTTP, dGTP, and dCTP) and specific primers. Amplification of DNA by PCR is dependent upon primers that target specific loci. The two primers that we will be using have unique nucleotide sequences that are complementary to only one locus in the human genome. The primer sequences are: Forward primer: 5’ GTAAGAGTTCCGTAACAGGACAGCT 3’ Reverse primer: 5’ CCCCACCCTAGGAGAACTTCTCTTT 3’ The DNA polymerase used is called Taq polymerase. It was originally isolated from the hot springs bacterium Thermus aquaticus which allows it to function at the elevated temperatures used in the PCR. Protocol: Isolating DNA from Buccal Epithelial Cells (Cheek Cells) 1. Obtain a 1.5 ml microfuge tube of NaCl2 solution. Label the tube with your initials. Be sure to use a waterproof pen. 2. Get a tube of sterile toothpicks. Gently scrape the inside of your cheek with the blunt end of a toothpick. Dip end of toothpick into tube of NaCl2 solution and swirl to dislodge cheek cell sample. Repeat cell collection 2 to 3 times with fresh toothpicks. 3. Centrifuge the microfuge tube for 2 minutes at 10,000 rpm to pellet the cells. Make sure tubes are “balanced.” 2 minutes at 10,000 rpm 4. Carefully pour off the supernatant (liquid). Be careful not to lose the cell pellet stuck to bottom of the tube. 5. Get 1.5 mL microfuge tube containing 0.1 mL Chelex. Quickly transfer all the chelex solution to the tube containing the cells. 6. Close tube containing cells and chelex. 7. Vortex the tube to resuspend the cheek cells. 8. Put tube in float rack in 90C water bath for 10 minutes. 10 minutes 9. Store on ice until DNA is needed. *While on being stored on ice, the chelex will settle to bottom of tube. Your DNA will be in the supernatant – the upper liquid layer in your tube. Be careful not to shake tube and resuspend the chelex. Protocol: PCR Set-up for the PLAT alu Locus 1. Get a PCR tube containing a Ready-to-Go bead. Make sure the bead is at the bottom of the tube. If not, gently tap on counter to drop bead down. 2. To side of PCR tube just above the bead, Add 22 L of MM (master mix containing primers and water). Do not touch the bead with the pipette. Use the P200 pipettor with tip. What should be displayed in the P200 window? 3. To side of PCR tube just above the bead, Add 3 L of DNA template from the supernatant of your boiled Chelex/cell tube. Be sure to remove the DNA from the upper (supernatant) chelex-free portion of your sample. Use P20 pipettor with tip. What should be displayed in the P20 window? 4. Allow a moment for the bead to dissolve, and then gently “flick” the tube with your finger to mix. Try to avoid making bubbles. 5. Spin the PCR tube in the pico-fuge” to collect the reaction in the bottom of the tube. Make sure tubes are “balanced.” 6. Put your PCR tube in one of the numbered holes in the PCR rack on the ice. On the PCR sign up sheet, initial the corresponding square on the grid. Be sure you label the correct location on the sign up sheet. *Later, the PCR tubes will be placed in the thermocycler, which will alternately heat and cool the tubes to produce many fragments of the specific DNA sequence that is being tested.