Download Increased gene expression of adrenomedullin

Clinical Science (2000) 99, 541–546 (Printed in Great Britain)
Increased gene expression of adrenomedullin
and adrenomedullin-receptor complexes,
receptor-activity modifying protein (RAMP)2
and calcitonin-receptor-like receptor (CRLR) in
the hearts of rats with congestive heart failure
Kazuhito TOTSUNE*, Kazuhiro TAKAHASHI†, Harald S. MACKENZIE‡,
Osamu MURAKAMI*, Zenei ARIHARA*, Masahiko SONE†, Toraichi MOURI§,
Barry M. BRENNER‡ and Sadayoshi ITO*
*Second Department of Internal Medicine, Tohoku University School of Medicine, Seiryo-machi, Aoba-ku, Sendai, Miyagi
980-8574, Japan, †Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai,
Miyagi 980-8575, Japan, ‡Renal Division, Department of Medicine, Brigham and Women’s Hospital and
Harvard Medical School, Boston, MA 02115, U.S.A., and §Division of Neuroendocrinology, Mouri Clinic, Natori,
Miyagi 981-1224, Japan
A
B
S
T
R
A
C
T
Adrenomedullin is a vasodilator peptide produced in various organs, including heart and kidney.
A novel adrenomedullin receptor complex has recently been identified, namely the calcitonin
receptor-like receptor (CRLR) and receptor-activity modifying protein (RAMP) 2. In the present
study, we have examined gene expression of RAMP2, CRLR and adrenomedullin in hearts and
kidneys of rats with congestive heart failure caused by coronary artery ligation. Partial cloning
was performed to determine the rat RAMP2 nucleotide sequence. Messenger RNA levels were
then determined using competitive, quantitative reverse transcription-PCR techniques.
Significantly increased expression levels (meanspS.E.) of RAMP2, CRLR and adrenomedullin
mRNA were found in the atrium (1.8p0.2-fold, 1.8p0.2-fold and 2.1p0.1-fold, respectively,
compared with sham operated rats) and in the ventricle (1.4p0.1-fold, 1.3p0.03-fold and
3.0p0.5-fold respectively). On the other hand, expression levels of RAMP2, CRLR and
adrenomedullin mRNAs were not significantly changed in the kidney. These findings suggest
potential roles of locally-produced and locally-acting adrenomedullin in the failing heart.
INTRODUCTION
Adrenomedullin is a novel vasodilator peptide with
diuretic action [1,2]. Adrenomedullin is produced by
various kinds of cells, including vascular endothelial cells
[3], vascular smooth muscle cells [4], cardiomyocytes [5],
fibroblasts [6], mesangial cells [7], macrophages [8],
neurons [9,10], astrocytes [11] and some tumour cells
[9,12–14]. Adrenomedullin is highly expressed in the
heart and kidney [2,15]. Recently, several reports have
suggested that adrenomedullin plays an important role in
the pathophysiology of heart failure. Plasma adreno-
Key words : adrenomedullin, calcitonin-receptor-like receptor, heart failure, kidney, receptor-activity modifying protein 2.
Abbreviations : CRLR, calcitonin-receptor-like receptor ; CRS DNA, competitive reference standard DNA ; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase ; RAMP, receptor-activity modifying protein ; RT, reverse transcription ; SO, sham
operated.
Correspondence : Dr. Kazuhito Totsune (e-mail tkazu2i!mail.cc.tohoku.ac.jp).
The nucleotide sequence data reported will appear in DDBJ, EMBL and GenBank Nucleotide Sequence Databases under the
accession number AB028934.
# 2000 The Biochemical Society and the Medical Research Society
541
542
K. Totsune and others
medullin levels were elevated in patients with heart
failure [16,17], and levels of adrenomedullin expression
were upregulated in the hearts of animals with experimental congestive heart failure [18–20].
McLatchie et al. [21] reported novel receptor complexes, consisting of calcitonin-receptor-like receptor
(CRLR) and receptor-activity modifying proteins
(RAMPs). Three isoforms of RAMPs have been identified. The two major forms, RAMP1 and RAMP2,
together with CRLR, are important for the generation of
receptors specific for calcitonin gene-related peptide and
adrenomedullin respectively. The RAMP1–CRLR complex generates the calcitonin gene-related peptide specific
receptor, and the RAMP2–CRLR complex generates the
adrenomedullin-specific receptor. Another isoform of
RAMP, RAMP3, also forms an adrenomedullin receptor
in vitro in combination with CRLR [21], but RAMP3
expression is very low in rat tissues, including the heart
[22]. Furthermore, adrenomedullin binding showed a
tendency to vary with RAMP2 mRNA levels, but not
with RAMP3 mRNA levels in various rat tissues [22].
Thus CRLR is a component common to the both
receptors, whereas RAMP2 is a major component specific
for the adrenomedullin receptor.
However, regulation of adrenomedullin receptor expression in pathophysiological states has not been studied
in detail. Further, the main target organ of adrenomedullin in heart failure remains unclear. In the present
study, we examined gene expression of RAMP2, CRLR
and adrenomedullin in the heart and kidney of rats with
congestive heart failure induced by coronary ligation.
METHODS
Animals
Animal experiments were performed in accordance with
the National Institutes of Health guide for the Care and
Use of Laboratory Animals and were approved by the
Animal Care Committee of Harvard Medical School.
Studies were performed on representative rats from
groups which had been used for a separate study [23].
Briefly, in the experimental animals, coronary ligation
was performed on male Munich–Wistar rats weighing
250–270 g (n l 4) under methohexital anaesthesia
(50 mg\kg). Sham operated (SO) rats (n l 4) underwent
thoracotomy and closure of the thorax only. Rats
received standard rat chow and water ad libitum for 3–4
weeks after surgery. All rats were then anaesthetized and
the cardiac atria, ventricles and kidneys were harvested,
snap-frozen in liquid nitrogen and maintained at k80 mC
until RNA extraction. The profiles of SO rats and rats
with congestive heart failure have been summarized
previously [23], and increased plasma atrial natriuretic
peptide levels (approx. 14-fold compared with SO rats)
and left ventricular diastolic pressure (approx. 4-fold
# 2000 The Biochemical Society and the Medical Research Society
Table 1
Primers used in RT-PCR analysis
Gene
Primer sequences (5h
RAMP2
Sense
Antisense
GCAACTGGACTTTGATTAGCAG
GGCCAGAAGCACATCCTCT
194 bp
GCAGCAGAGTCGGAAGAAGG
GCCACTGCCGTGAGGTGA
535 bp
TTCGAGTCAAACGCTACCGC
ATCAGGCGCTCTCCACCTTA
856 bp
CRLR
Sense
Antisense
Adrenomedullin
Sense
Antisense
3h)
PCR products
Reference
Accession no.
AB028934
[25]
[2]
compared with SO rats) were reported for the rats
with heart failure.
Competitive and quantitative reverse
transcription (RT)-PCR
Total RNA was extracted by the guanidinium isothiocyanate\CsCl method and 4 µg of total RNA were
reverse transcribed with 400 units of Moloney murine
leukaemia virus reverse transcriptase (M-MLV RT ; Life
Technologies, Rockville, MD, U.S.A.) using an oligo(dT)
primer in a total volume of 20 µl, as described previously
[24]. Expression of RAMP2, CRLR, adrenomedullin and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
mRNAs was determined using competitive, quantitative
RT-PCR methods.
For rat RAMP2 PCR, a partial cloning of rat RAMP2
was performed because the nucleotide sequence of rat
RAMP2 has not, to our knowledge, been previously
reported. A sense primer, corresponding to nt 300–319,
and an antisense primer, corresponding to nt 516–534 of
human RAMP2 (accession number AJ001015), were used
in a PCR to amplify rat RAMP2 at low stringency as
follows : 35 cycles at 94 mC for 45 s, 38 mC for 45 s, 72 mC
for 1.5 min and a final cycle at 72 mC for 5 min. PCR was
performed in a total volume of 20 µl containing 1 µl of
the first strand cDNA reverse transcribed from rat atrial
total RNA, 10 mM Tris\HCl (pH 8.30), 50 mM KCl,
2 mM MgCl , 0.001 % (w\v) gelatin, 0.2 mM of each
#
deoxynucleotide triphosphate, 0.25 µM of each primer
and 0.4 units of Taq DNA polymerase (Pharmacia,
Piscataway, NJ, U.S.A.). A 235-bp PCR product was
obtained, ligated into pGEM-T vector (Promega, Madison, WI, U.S.A.) and sequenced using an autosequencer
(Model 310, Applied Biosystems).
Primers used for RT-PCR analysis are summarized in
Table 1 [2,25]. PCR protocols were as follows. For
RAMP2 : 20 cycles at 94 mC for 15 s, 61 mC for 1 min,
72 mC for 1 min ; for CRLR : 24 cycles at 94 mC for 15 s,
61 mC for 30 s, 72 mC for 1 min ; for adrenomedullin : 24
cycles at 94 mC for 15 s, 58 mC for 30 s, 72 mC for 1 min ;
each was then subjected to a final cycle at 72 mC for 5 min.
Adrenomedullin and adrenomedullin receptors in the failing heart
To determine the equivalent concentration point, the
PCR products were separated by PAGE (5 % polyacrylamide gel), stained with 1.3 µmol\l ethidium bromide,
revealed using a UV transluminator and photographed.
The photograph was digitized using a flat-bed scanner
(ScanJet Iicx ; Hewlett Packard), the image was inverted
(Figure 1), and densitometric analysis was performed as
reported previously [24].
RAMP2, CRLR and adrenomedullin mRNA concentrations were corrected for GAPDH mRNA expression
and reported respectively as mmol\mol of GAPDH.
Statistical analyses
Data are given as meanpS.E.M. mRNA concentration
data were analysed by one-way ANOVA followed by
Fisher’s protected least-squares difference test for comparisons of differences between SO and heart failure
groups. Statistical significance was accepted at P 0.05.
RESULTS
Figure 1 Polyacrylamide gels of competitive, quantitative
RT-PCR for RAMP2 (top panel), CRLR (middle panel) and
adrenomedullin (AM) (bottom panel) using increasing
amounts of CRS DNA
Lane 1, standard DNA ladder ; lanes 2–9, PCR products using 200 ng total RNA
from normal rat kidney and increasing amounts of CRS-DNA/tube as templates ;
lane 10, normal kidney sample treated similarly but in the absence of reverse
transcriptase, used as a negative-control template in the PCR.
Competitive, quantitative RT-PCR for GAPDH was
performed as reported previously [24]. The competitive
reference standard (CRS) DNA for RAMP2 was prepared using a PCR by deleting 40-bp (22–54 and 168–174)
from a 194-bp RAMP2 cDNA fragment. The CRS DNA
for the competitive, quantitative RT-PCR of CRLR was
prepared with a PCR by deleting 138-bp (762–837 and
1195–1256) from the 533-bp CRLR cDNA fragment.
The CRS DNA for adrenomedullin was obtained using a
PCR MIMIC Construction Kit (Clontech, Palo Alto,
CA, U.S.A.) according to manufacturer’s instructions.
The CRS DNA measured 596-bp, 260-bp shorter than
the objective PCR product. In the competitive, quantitative RT-PCR, a constant amount of wild-type cDNA
and increasing amounts of CRS DNA (0.63i10' to
40i10' molecules for RAMP2, 0.13i10' to 8.0i10'
molecules for CRLR and 0.06i10' to 4.0i10' molecules
for adrenomedullin, each in a 1 : 2 dilution) were added to
each tube, which was then subjected to PCR.
Sequence analysis of the rat RAMP2 homologue obtained
by partial cloning showed 83 % similarity in nucleotide
sequence and 77 % in amino acid sequence when compared with human RAMP2.
Amplification products of 194 bp of rat RAMP2,
533 bp of rat CRLR and 856 bp of adrenomedullin were
detectable in all cardiac and kidney samples. RAMP2
mRNA levels in heart failure rats were significantly increased by 1.8p0.2-fold (63.1p7.9 mmol\mol
GAPDH, P 0.05) in the atrium and by 1.4p0.1-fold
(33.0p2.3 mmol\mol GAPDH, P 0.05) in the ventricle when compared with SO rats. Conversely, there
was no significant change in kidney samples (1.1p0.1fold, 25.5p1.9 mmol\mol GAPDH) when compared
with SO rats (Figure 2).
CRLR mRNA levels in heart failure rats were significantly increased by 1.8p0.2-fold (1.05p0.12 mmol\mol
GAPDH, P 0.05) in the atrium and 1.33p0.03-fold
(0.84p0.02 mmol\mol GAPDH, P 0.05) in the ventricle when compared with SO rats. There was no
significant elevation in CRLR mRNA levels in the kidney
(1.2p0.2-fold, 1.09p0.18 mmol\mol GAPDH) when
compared with SO rats (Figure 2).
Adrenomedullin mRNA levels were significantly
increased by 2.1p0.1-fold (0.59p0.02 mmol\mol
GAPDH, P 0.01) in the atrium and 3.0p0.5-fold
(1.88p0.30 mmol\mol GAPDH, P 0.05) in the ventricle, when compared with SO rats (Figure 2). No
significant upregulation of adrenomedullin mRNA expression was observed in the kidney of heart failure rats
(Figure 2).
RAMP2 mRNA levels were markedly higher than
CRLR mRNA levels ; approx. 27- to 60-fold in heart and
kidney of both SO and heart failure rats (Figure 2).
# 2000 The Biochemical Society and the Medical Research Society
543
544
K. Totsune and others
Figure 2 mRNA levels of RAMP2 (top panel), CRLR (middle panel) and adrenomedullin (AM) (bottom panel) in rat atrium
(left), ventricle (centre) and kidney (right)
$ Indicates individual data ; # shows meanspS.E.M. CHF, congestive heart failure. *P
DISCUSSION
The present study has shown that cardiac RAMP2 and
CRLR gene expression is enhanced in rats with heart
failure. In addition, we confirmed increased cardiac
expression of adrenomedullin mRNA in heart failure
rats, which is consistent with previous reports [18–20].
Kaiser et al. [20] reported only a modest (40 %) increase
in the left ventricle of rats with post-infarction heart
failure by coronary artery ligation. The increase in
adrenomedullin mRNA levels in their experiments was
smaller than that in the present study (about 3-fold
increase). This difference may be explained by the
difference in the regions of the heart studied (the left
ventricle in their study and the right and left ventricles
in our study), or by differences in the strain of the
rats used (Wistar rats and Munich-Wistar rats). The
findings in the present study indicate that expression of
both adrenomedullin receptors (RAMP2–CRLR) and
adrenomedullin peptide is upregulated in failing
hearts. Adrenomedullin is present in plasma, and plasma
concentrations of adrenomedullin have been found to be
elevated in patients with heart failure [16,17]. The levels,
however, were relatively low when compared with the
# 2000 The Biochemical Society and the Medical Research Society
0.05 and **P
0.01 versus SO rats.
concentrations of adrenomedullin required to cause
biological effects, e.g. vasodilatation [1]. It therefore
seems likely that adrenomedullin acts as an autocrine or
paracrine factor in various organs, including the heart.
Our findings suggest a potential role for locally produced
adrenomedullin in the failing heart.
Intravenous administration of adrenomedullin reduced
ventricular preload and afterload, and improved cardiac
output in sheep with heart failure [26]. Adrenomedullin
has a potent vasodilatory action [1] and, therefore,
adrenomedullin produced in the heart may dilate coronary arteries. Further, positive inotropic effects of
adrenomedullin have been observed in vivo [27] and in
vitro [28] in isolated perfused rat hearts. Moreover, it has
been reported that adrenomedullin has an inhibitory
effect on cardiac myocyte hypertrophy in vitro [29].
Thus increased expression of adrenomedullin receptors
(RAMP2 and CRLR) and adrenomedullin mRNA in the
failing heart may have beneficial effects on cardiac
performance and may represent a defence mechanism
against heart failure.
By contrast, there were no significant changes in the
expression levels of RAMP2, CRLR or adrenomedullin
mRNA in the kidney of heart failure rats. The direct
Adrenomedullin and adrenomedullin receptors in the failing heart
haemodynamic consequences of heart failure or the
accompanying myocardial ischaemia might elevate the
expression levels of RAMP2, CRLR and adrenomedullin
mRNAs in the heart. It has been reported that hypoxia
induced expression of adrenomedullin in cultured cardiac
myocytes [30] and in cultured coronary artery endothelial cells [31] ; however, the haemodynamics of the
kidney in heart failure are quite different. Also, increased
levels of cytokines in the cardiac tissues with infarction
may affect the expression levels of adrenomedullin in the
heart, because cytokines, such as tumour necrosis factorα, are known to induce adrenomedullin expression in
various kinds of cells [4,6,11].
Øie et al. [32] have recently shown increased mRNA
expression of adrenomedullin and RAMP2 in the myocardium of heart failure rats by Northern-blot analysis,
which is consistent with findings in the present study. In
contrast, we used competitive, quantitative RT-PCR for
the measurement of adrenomedullin, RAMP2 and CRLR
mRNAs and were able to quantitate expression levels of
CRLR mRNA, which were much lower than the levels
of RAMP2 mRNA both in heart and kidney. Buhlmann
et al. [33] reported that adrenomedullin binding was
inhibited by co-expression of RAMP1 in CRLR-transfected cells, and suggested the presence of competitive
interactions among the different RAMP–CRLR complexes. It seems likely that RAMPs compete with each
other for CRLR, which is expressed in much smaller
amounts in heart and kidney. Thus our findings may
explain, in part, the competitive interactions of RAMP1
and RAMP2 with CRLR, although further studies are
required to clarify this issue.
The present study has shown elevated cardiac expression of RAMP2, CRLR and adrenomedullin mRNAs
in heart failure. Adrenomedullin produced in failing
hearts may act as a paracrine or autocrine factor and have
beneficial effects on cardiac performance in heart failure.
ACKNOWLEDGMENTS
The authors are grateful to Ms Kumi Kikuchi for her
technical assistance. This study has been supported in
part by a Research Grant from the Takeda Science
Foundation and by a Research Grant from Renal
Anaemia Research.
REFERENCES
1 Kitamura, K., Kangawa, K., Kawamoto, M., et al. (1993)
Adrenomedullin : a novel hypotensive peptide isolated
from human pheochromocytoma. Biochem. Biophys. Res.
Commun. 192, 553–560
2 Sakata, J., Shimokubo, T., Kitamura, K., et al. (1993)
Molecular cloning and biological activities of rat
adrenomedullin, a hypotensive peptide. Biochem. Biophys.
Res. Commun. 195, 921–927
3 Sugo, S., Minamino, N., Kangawa, K., et al. (1994)
Endothelial cells actively synthesize and secrete
adrenomedullin. Biochem. Biophys. Res. Commun. 201,
1160–1166
4 Sugo, S., Minamino, N., Shoji, H., et al. (1994) Production
and secretion of adrenomedullin from vascular smooth
muscle cells : augmented production by tumor necrosis
factor-α. Biochem. Biophys. Res. Commun. 203, 719–726
5 Jougasaki, M., Wei, C.-M., Heublein, D. M., Sandberg,
S. M. and Burnett, Jr., J. C. (1995) Immunocytochemical
localization of adrenomedullin in canine heart and aorta.
Peptides 16, 773–775
6 Isumi, Y., Minamino, N., Katafuchi, T., et al. (1998)
Adrenomedullin production in fibroblasts : its possible
function as a growth regulator of Swiss 3T3 cells.
Endocrinology 139, 2552–2563
7 Lai, K. N., Leung, J. C., Yeung, V. T., Lewis, L. K. and
Nicholls, M. G. (1998) Gene transcription and synthesis of
adrenomedullin by cultured human renal cells. Biochem.
Biophys. Res. Commun. 244, 567–572
8 Nakayama, M., Takahashi, K., Murakami, O., et al. (1999)
Adrenomedullin in monocytes and macrophages : possible
involvement of macrophage-derived adrenomedullin in
atherogenesis. Clin. Sci. 97, 247–251
9 Satoh, F., Takahashi, K., Murakami, O., et al. (1995)
Adrenomedullin in human brain, adrenal glands and tumor
tissues of pheochromocytoma, ganglioneuroblastoma and
neuroblastoma. J. Clin. Endocrinol. Metab. 80, 1750–1752
10 Satoh, F., Takahashi, K., Murakami, O., et al. (1996)
Immunocytochemical localization of adrenomedullin-like
immunoreactivity in the human hypothalamus and the
adrenal gland. Neurosci. Lett. 203, 207–210
11 Takahashi, K., Nakayama, M., Totsune, K., et al. (2000)
Increased secretion of adrenomedullin from cultured
human astrocytes by cytokines. J. Neurochem. 74, 99–103
12 Miller, M. J., Martinez, A., Unsworth, E. J., et al. (1996)
Adrenomedullin expression in human tumor cell lines.
J. Biol. Chem. 271, 23345–23351
13 Takahashi, K., Satoh, F., Sone, M., et al. (1998) Expression
of adrenomedullin mRNA in adrenocortical tumors and
secretion of adrenomedullin by cultured adrenocortical
carcinoma cells. Peptides 19, 1719–1724
14 Murakami, O., Takahashi, K., Satoh, F., et al. (1998)
Expression of adrenomedullin and adrenomedullin mRNA
in ectopic ACTH-secreting tumors. Eur. J. Endocrinol.
138, 436–439
15 Washimine, H., Asada, Y., Kitamura, K., et al. (1995)
Immunohistochemical identification of adrenomedullin in
human, rat, and porcine tissue. Histochemistry 103,
251–254
16 Jougasaki, M., Wei, C.-M., McKinley, L. J. and Burnett,
Jr., J. C. (1995) Elevation of circulating and ventricular
adrenomedullin in human congestive heart failure.
Circulation 92, 286–289
17 Nishikimi, T., Saito, Y., Kitamura, K., et al. (1995)
Increased plasma levels of adrenomedullin in patients with
heart failure. J. Am. Coll. Cardiol. 26, 1424–1431
18 Romppanen, H., Marttila, M., Magga, J., et al. (1997)
Adrenomedullin gene expression in the rat heart is
stimulated by acute pressure overload : Blunted effect in
experimental hypertension. Endocrinology 138, 2636–2639
19 Nishikimi, T., Horio, T., Sasaki, T., et al. (1997) Cardiac
production and secretion of adrenomedullin are increased
in heart failure. Hypertension 30, 1369–1375
20 Kaiser, M., Kahr, O., Shimada, Y., et al. (1998) Differential
regulation of ventricular adrenomedullin and atrial
natriuretic peptide gene expression in pressure and volume
overload in the rat. Clin. Sci. 94, 359–365
21 McLatchie, L. M., Fraser, N. J., Matin, M. J., et al. (1998)
RAMPs regulate the transport and ligand specificity of the
calcitonin-receptor-like receptor. Nature (London) 393,
333–339
22 Chakravarty, P., Suthar, T. P., Coppock, H. A., et al.
(2000) CGRP and adrenomedullin binding correlates with
transcript levels for calcitonin receptor-like receptor
(CRLR) and receptor activity modifying proteins
(RAMPs) in rat tissues. Br. J. Pharmacol. 130, 189–195
# 2000 The Biochemical Society and the Medical Research Society
545
546
K. Totsune and others
23 Zhang, P. L., Mackenzie, H. S., Totsune, K., Troy, J. L.
and Brenner, B. M. (1995) Renal effects of high-dose
natriuretic peptide receptor blockade in rats with
congestive heart failure. Circ. Res. 77, 1240–1245
24 Totsune, K., Mackenzie, H. S., Totsune, H., Troy, J. L.,
Lytton, J. and Brenner, B. M. (1998) Upregulation of atrial
natriuretic peptide gene expression in remnant kidney of
rats with reduced renal mass. J. Am. Soc. Nephrol. 9,
1613–1619
25 Chang, C. P., Pearse, II, R. V., O ’Connel, S. and
Rosenfeld, M. G. (1993) Identification of a seven
transmembrane helix receptor for corticotropin-releasing
factor and sauvagine in mammalian brain. Neuron 11,
1187–1195
26 Rademaker, M. T., Charles, C. J., Lewis, L. K., et al. (1997)
Beneficial hemodynamic and renal effects of
adrenomedullin in an ovine model of heart failure.
Circulation 96, 1983–1990
27 Parkes, D. G. (1995) Cardiovascular actions of adrenomedullin in conscious sheep. Am. J. Physiol. 268, H2574
28 Szokodi, I., Kinnunen, P. and Ruskoaho, H. (1996)
Inotropic effect of adrenomedullin in the isolated perfused
rat heart. Acta Physiol. Scand. 156, 151–152
29 Tsuruda, T., Kato, J., Kitamura, K., et al. (1998)
Adrenomedullin : a possible autocrine or paracrine
inhibitor of hypertrophy of cardiomyocytes. Hypertension
31, 505–510
30 Cormier-Regard, S., Nguyen, S. V. and Claycomb, W. C.
(1998) Adrenomedullin gene expression is developmentally
regulated and induced in rat ventricular cardiac myocytes.
J. Biol. Chem. 273, 17787–17792
31 Nakayama, M., Takahashi, K., Murakami, O., Shirato, K.
and Shibahara, S. (1999) Induction of adrenomedullin by
hypoxia in cultured human coronary artery endothelial
cells. Peptides 20, 769–772
32 Øie, E., Vinge, L. E., Yndestad, A., Sandberg, C.,
Groggard, H. K. and Attramadal, H. (2000) Induction
of a myocardial adrenomedullin signaling system
during ischemic heart failure in rats. Circulation 101,
415–422
33 Buhlmann, N., Leuthauser, K., Muff, R., Fisher, J. A.
and Born, W. (1999) A receptor activity modifying
protein (RAMP) 2-dependent adrenomedullin receptor is
a calcitonin gene-related peptide receptor when coexpressed with human RAMP1. Endocrinology 140,
2883–2890
Received 18 April 2000/17 July 2000; accepted 8 August 2000
# 2000 The Biochemical Society and the Medical Research Society