Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Clinical Science (2000) 99, 541–546 (Printed in Great Britain) Increased gene expression of adrenomedullin and adrenomedullin-receptor complexes, receptor-activity modifying protein (RAMP)2 and calcitonin-receptor-like receptor (CRLR) in the hearts of rats with congestive heart failure Kazuhito TOTSUNE*, Kazuhiro TAKAHASHI†, Harald S. MACKENZIE‡, Osamu MURAKAMI*, Zenei ARIHARA*, Masahiko SONE†, Toraichi MOURI§, Barry M. BRENNER‡ and Sadayoshi ITO* *Second Department of Internal Medicine, Tohoku University School of Medicine, Seiryo-machi, Aoba-ku, Sendai, Miyagi 980-8574, Japan, †Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai, Miyagi 980-8575, Japan, ‡Renal Division, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115, U.S.A., and §Division of Neuroendocrinology, Mouri Clinic, Natori, Miyagi 981-1224, Japan A B S T R A C T Adrenomedullin is a vasodilator peptide produced in various organs, including heart and kidney. A novel adrenomedullin receptor complex has recently been identified, namely the calcitonin receptor-like receptor (CRLR) and receptor-activity modifying protein (RAMP) 2. In the present study, we have examined gene expression of RAMP2, CRLR and adrenomedullin in hearts and kidneys of rats with congestive heart failure caused by coronary artery ligation. Partial cloning was performed to determine the rat RAMP2 nucleotide sequence. Messenger RNA levels were then determined using competitive, quantitative reverse transcription-PCR techniques. Significantly increased expression levels (meanspS.E.) of RAMP2, CRLR and adrenomedullin mRNA were found in the atrium (1.8p0.2-fold, 1.8p0.2-fold and 2.1p0.1-fold, respectively, compared with sham operated rats) and in the ventricle (1.4p0.1-fold, 1.3p0.03-fold and 3.0p0.5-fold respectively). On the other hand, expression levels of RAMP2, CRLR and adrenomedullin mRNAs were not significantly changed in the kidney. These findings suggest potential roles of locally-produced and locally-acting adrenomedullin in the failing heart. INTRODUCTION Adrenomedullin is a novel vasodilator peptide with diuretic action [1,2]. Adrenomedullin is produced by various kinds of cells, including vascular endothelial cells [3], vascular smooth muscle cells [4], cardiomyocytes [5], fibroblasts [6], mesangial cells [7], macrophages [8], neurons [9,10], astrocytes [11] and some tumour cells [9,12–14]. Adrenomedullin is highly expressed in the heart and kidney [2,15]. Recently, several reports have suggested that adrenomedullin plays an important role in the pathophysiology of heart failure. Plasma adreno- Key words : adrenomedullin, calcitonin-receptor-like receptor, heart failure, kidney, receptor-activity modifying protein 2. Abbreviations : CRLR, calcitonin-receptor-like receptor ; CRS DNA, competitive reference standard DNA ; GAPDH, glyceraldehyde-3-phosphate dehydrogenase ; RAMP, receptor-activity modifying protein ; RT, reverse transcription ; SO, sham operated. Correspondence : Dr. Kazuhito Totsune (e-mail tkazu2i!mail.cc.tohoku.ac.jp). The nucleotide sequence data reported will appear in DDBJ, EMBL and GenBank Nucleotide Sequence Databases under the accession number AB028934. # 2000 The Biochemical Society and the Medical Research Society 541 542 K. Totsune and others medullin levels were elevated in patients with heart failure [16,17], and levels of adrenomedullin expression were upregulated in the hearts of animals with experimental congestive heart failure [18–20]. McLatchie et al. [21] reported novel receptor complexes, consisting of calcitonin-receptor-like receptor (CRLR) and receptor-activity modifying proteins (RAMPs). Three isoforms of RAMPs have been identified. The two major forms, RAMP1 and RAMP2, together with CRLR, are important for the generation of receptors specific for calcitonin gene-related peptide and adrenomedullin respectively. The RAMP1–CRLR complex generates the calcitonin gene-related peptide specific receptor, and the RAMP2–CRLR complex generates the adrenomedullin-specific receptor. Another isoform of RAMP, RAMP3, also forms an adrenomedullin receptor in vitro in combination with CRLR [21], but RAMP3 expression is very low in rat tissues, including the heart [22]. Furthermore, adrenomedullin binding showed a tendency to vary with RAMP2 mRNA levels, but not with RAMP3 mRNA levels in various rat tissues [22]. Thus CRLR is a component common to the both receptors, whereas RAMP2 is a major component specific for the adrenomedullin receptor. However, regulation of adrenomedullin receptor expression in pathophysiological states has not been studied in detail. Further, the main target organ of adrenomedullin in heart failure remains unclear. In the present study, we examined gene expression of RAMP2, CRLR and adrenomedullin in the heart and kidney of rats with congestive heart failure induced by coronary ligation. METHODS Animals Animal experiments were performed in accordance with the National Institutes of Health guide for the Care and Use of Laboratory Animals and were approved by the Animal Care Committee of Harvard Medical School. Studies were performed on representative rats from groups which had been used for a separate study [23]. Briefly, in the experimental animals, coronary ligation was performed on male Munich–Wistar rats weighing 250–270 g (n l 4) under methohexital anaesthesia (50 mg\kg). Sham operated (SO) rats (n l 4) underwent thoracotomy and closure of the thorax only. Rats received standard rat chow and water ad libitum for 3–4 weeks after surgery. All rats were then anaesthetized and the cardiac atria, ventricles and kidneys were harvested, snap-frozen in liquid nitrogen and maintained at k80 mC until RNA extraction. The profiles of SO rats and rats with congestive heart failure have been summarized previously [23], and increased plasma atrial natriuretic peptide levels (approx. 14-fold compared with SO rats) and left ventricular diastolic pressure (approx. 4-fold # 2000 The Biochemical Society and the Medical Research Society Table 1 Primers used in RT-PCR analysis Gene Primer sequences (5h RAMP2 Sense Antisense GCAACTGGACTTTGATTAGCAG GGCCAGAAGCACATCCTCT 194 bp GCAGCAGAGTCGGAAGAAGG GCCACTGCCGTGAGGTGA 535 bp TTCGAGTCAAACGCTACCGC ATCAGGCGCTCTCCACCTTA 856 bp CRLR Sense Antisense Adrenomedullin Sense Antisense 3h) PCR products Reference Accession no. AB028934 [25] [2] compared with SO rats) were reported for the rats with heart failure. Competitive and quantitative reverse transcription (RT)-PCR Total RNA was extracted by the guanidinium isothiocyanate\CsCl method and 4 µg of total RNA were reverse transcribed with 400 units of Moloney murine leukaemia virus reverse transcriptase (M-MLV RT ; Life Technologies, Rockville, MD, U.S.A.) using an oligo(dT) primer in a total volume of 20 µl, as described previously [24]. Expression of RAMP2, CRLR, adrenomedullin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNAs was determined using competitive, quantitative RT-PCR methods. For rat RAMP2 PCR, a partial cloning of rat RAMP2 was performed because the nucleotide sequence of rat RAMP2 has not, to our knowledge, been previously reported. A sense primer, corresponding to nt 300–319, and an antisense primer, corresponding to nt 516–534 of human RAMP2 (accession number AJ001015), were used in a PCR to amplify rat RAMP2 at low stringency as follows : 35 cycles at 94 mC for 45 s, 38 mC for 45 s, 72 mC for 1.5 min and a final cycle at 72 mC for 5 min. PCR was performed in a total volume of 20 µl containing 1 µl of the first strand cDNA reverse transcribed from rat atrial total RNA, 10 mM Tris\HCl (pH 8.30), 50 mM KCl, 2 mM MgCl , 0.001 % (w\v) gelatin, 0.2 mM of each # deoxynucleotide triphosphate, 0.25 µM of each primer and 0.4 units of Taq DNA polymerase (Pharmacia, Piscataway, NJ, U.S.A.). A 235-bp PCR product was obtained, ligated into pGEM-T vector (Promega, Madison, WI, U.S.A.) and sequenced using an autosequencer (Model 310, Applied Biosystems). Primers used for RT-PCR analysis are summarized in Table 1 [2,25]. PCR protocols were as follows. For RAMP2 : 20 cycles at 94 mC for 15 s, 61 mC for 1 min, 72 mC for 1 min ; for CRLR : 24 cycles at 94 mC for 15 s, 61 mC for 30 s, 72 mC for 1 min ; for adrenomedullin : 24 cycles at 94 mC for 15 s, 58 mC for 30 s, 72 mC for 1 min ; each was then subjected to a final cycle at 72 mC for 5 min. Adrenomedullin and adrenomedullin receptors in the failing heart To determine the equivalent concentration point, the PCR products were separated by PAGE (5 % polyacrylamide gel), stained with 1.3 µmol\l ethidium bromide, revealed using a UV transluminator and photographed. The photograph was digitized using a flat-bed scanner (ScanJet Iicx ; Hewlett Packard), the image was inverted (Figure 1), and densitometric analysis was performed as reported previously [24]. RAMP2, CRLR and adrenomedullin mRNA concentrations were corrected for GAPDH mRNA expression and reported respectively as mmol\mol of GAPDH. Statistical analyses Data are given as meanpS.E.M. mRNA concentration data were analysed by one-way ANOVA followed by Fisher’s protected least-squares difference test for comparisons of differences between SO and heart failure groups. Statistical significance was accepted at P 0.05. RESULTS Figure 1 Polyacrylamide gels of competitive, quantitative RT-PCR for RAMP2 (top panel), CRLR (middle panel) and adrenomedullin (AM) (bottom panel) using increasing amounts of CRS DNA Lane 1, standard DNA ladder ; lanes 2–9, PCR products using 200 ng total RNA from normal rat kidney and increasing amounts of CRS-DNA/tube as templates ; lane 10, normal kidney sample treated similarly but in the absence of reverse transcriptase, used as a negative-control template in the PCR. Competitive, quantitative RT-PCR for GAPDH was performed as reported previously [24]. The competitive reference standard (CRS) DNA for RAMP2 was prepared using a PCR by deleting 40-bp (22–54 and 168–174) from a 194-bp RAMP2 cDNA fragment. The CRS DNA for the competitive, quantitative RT-PCR of CRLR was prepared with a PCR by deleting 138-bp (762–837 and 1195–1256) from the 533-bp CRLR cDNA fragment. The CRS DNA for adrenomedullin was obtained using a PCR MIMIC Construction Kit (Clontech, Palo Alto, CA, U.S.A.) according to manufacturer’s instructions. The CRS DNA measured 596-bp, 260-bp shorter than the objective PCR product. In the competitive, quantitative RT-PCR, a constant amount of wild-type cDNA and increasing amounts of CRS DNA (0.63i10' to 40i10' molecules for RAMP2, 0.13i10' to 8.0i10' molecules for CRLR and 0.06i10' to 4.0i10' molecules for adrenomedullin, each in a 1 : 2 dilution) were added to each tube, which was then subjected to PCR. Sequence analysis of the rat RAMP2 homologue obtained by partial cloning showed 83 % similarity in nucleotide sequence and 77 % in amino acid sequence when compared with human RAMP2. Amplification products of 194 bp of rat RAMP2, 533 bp of rat CRLR and 856 bp of adrenomedullin were detectable in all cardiac and kidney samples. RAMP2 mRNA levels in heart failure rats were significantly increased by 1.8p0.2-fold (63.1p7.9 mmol\mol GAPDH, P 0.05) in the atrium and by 1.4p0.1-fold (33.0p2.3 mmol\mol GAPDH, P 0.05) in the ventricle when compared with SO rats. Conversely, there was no significant change in kidney samples (1.1p0.1fold, 25.5p1.9 mmol\mol GAPDH) when compared with SO rats (Figure 2). CRLR mRNA levels in heart failure rats were significantly increased by 1.8p0.2-fold (1.05p0.12 mmol\mol GAPDH, P 0.05) in the atrium and 1.33p0.03-fold (0.84p0.02 mmol\mol GAPDH, P 0.05) in the ventricle when compared with SO rats. There was no significant elevation in CRLR mRNA levels in the kidney (1.2p0.2-fold, 1.09p0.18 mmol\mol GAPDH) when compared with SO rats (Figure 2). Adrenomedullin mRNA levels were significantly increased by 2.1p0.1-fold (0.59p0.02 mmol\mol GAPDH, P 0.01) in the atrium and 3.0p0.5-fold (1.88p0.30 mmol\mol GAPDH, P 0.05) in the ventricle, when compared with SO rats (Figure 2). No significant upregulation of adrenomedullin mRNA expression was observed in the kidney of heart failure rats (Figure 2). RAMP2 mRNA levels were markedly higher than CRLR mRNA levels ; approx. 27- to 60-fold in heart and kidney of both SO and heart failure rats (Figure 2). # 2000 The Biochemical Society and the Medical Research Society 543 544 K. Totsune and others Figure 2 mRNA levels of RAMP2 (top panel), CRLR (middle panel) and adrenomedullin (AM) (bottom panel) in rat atrium (left), ventricle (centre) and kidney (right) $ Indicates individual data ; # shows meanspS.E.M. CHF, congestive heart failure. *P DISCUSSION The present study has shown that cardiac RAMP2 and CRLR gene expression is enhanced in rats with heart failure. In addition, we confirmed increased cardiac expression of adrenomedullin mRNA in heart failure rats, which is consistent with previous reports [18–20]. Kaiser et al. [20] reported only a modest (40 %) increase in the left ventricle of rats with post-infarction heart failure by coronary artery ligation. The increase in adrenomedullin mRNA levels in their experiments was smaller than that in the present study (about 3-fold increase). This difference may be explained by the difference in the regions of the heart studied (the left ventricle in their study and the right and left ventricles in our study), or by differences in the strain of the rats used (Wistar rats and Munich-Wistar rats). The findings in the present study indicate that expression of both adrenomedullin receptors (RAMP2–CRLR) and adrenomedullin peptide is upregulated in failing hearts. Adrenomedullin is present in plasma, and plasma concentrations of adrenomedullin have been found to be elevated in patients with heart failure [16,17]. The levels, however, were relatively low when compared with the # 2000 The Biochemical Society and the Medical Research Society 0.05 and **P 0.01 versus SO rats. concentrations of adrenomedullin required to cause biological effects, e.g. vasodilatation [1]. It therefore seems likely that adrenomedullin acts as an autocrine or paracrine factor in various organs, including the heart. Our findings suggest a potential role for locally produced adrenomedullin in the failing heart. Intravenous administration of adrenomedullin reduced ventricular preload and afterload, and improved cardiac output in sheep with heart failure [26]. Adrenomedullin has a potent vasodilatory action [1] and, therefore, adrenomedullin produced in the heart may dilate coronary arteries. Further, positive inotropic effects of adrenomedullin have been observed in vivo [27] and in vitro [28] in isolated perfused rat hearts. Moreover, it has been reported that adrenomedullin has an inhibitory effect on cardiac myocyte hypertrophy in vitro [29]. Thus increased expression of adrenomedullin receptors (RAMP2 and CRLR) and adrenomedullin mRNA in the failing heart may have beneficial effects on cardiac performance and may represent a defence mechanism against heart failure. By contrast, there were no significant changes in the expression levels of RAMP2, CRLR or adrenomedullin mRNA in the kidney of heart failure rats. The direct Adrenomedullin and adrenomedullin receptors in the failing heart haemodynamic consequences of heart failure or the accompanying myocardial ischaemia might elevate the expression levels of RAMP2, CRLR and adrenomedullin mRNAs in the heart. It has been reported that hypoxia induced expression of adrenomedullin in cultured cardiac myocytes [30] and in cultured coronary artery endothelial cells [31] ; however, the haemodynamics of the kidney in heart failure are quite different. Also, increased levels of cytokines in the cardiac tissues with infarction may affect the expression levels of adrenomedullin in the heart, because cytokines, such as tumour necrosis factorα, are known to induce adrenomedullin expression in various kinds of cells [4,6,11]. Øie et al. [32] have recently shown increased mRNA expression of adrenomedullin and RAMP2 in the myocardium of heart failure rats by Northern-blot analysis, which is consistent with findings in the present study. In contrast, we used competitive, quantitative RT-PCR for the measurement of adrenomedullin, RAMP2 and CRLR mRNAs and were able to quantitate expression levels of CRLR mRNA, which were much lower than the levels of RAMP2 mRNA both in heart and kidney. Buhlmann et al. [33] reported that adrenomedullin binding was inhibited by co-expression of RAMP1 in CRLR-transfected cells, and suggested the presence of competitive interactions among the different RAMP–CRLR complexes. It seems likely that RAMPs compete with each other for CRLR, which is expressed in much smaller amounts in heart and kidney. Thus our findings may explain, in part, the competitive interactions of RAMP1 and RAMP2 with CRLR, although further studies are required to clarify this issue. The present study has shown elevated cardiac expression of RAMP2, CRLR and adrenomedullin mRNAs in heart failure. Adrenomedullin produced in failing hearts may act as a paracrine or autocrine factor and have beneficial effects on cardiac performance in heart failure. ACKNOWLEDGMENTS The authors are grateful to Ms Kumi Kikuchi for her technical assistance. This study has been supported in part by a Research Grant from the Takeda Science Foundation and by a Research Grant from Renal Anaemia Research. REFERENCES 1 Kitamura, K., Kangawa, K., Kawamoto, M., et al. (1993) Adrenomedullin : a novel hypotensive peptide isolated from human pheochromocytoma. Biochem. Biophys. Res. Commun. 192, 553–560 2 Sakata, J., Shimokubo, T., Kitamura, K., et al. (1993) Molecular cloning and biological activities of rat adrenomedullin, a hypotensive peptide. Biochem. Biophys. Res. Commun. 195, 921–927 3 Sugo, S., Minamino, N., Kangawa, K., et al. (1994) Endothelial cells actively synthesize and secrete adrenomedullin. Biochem. Biophys. Res. Commun. 201, 1160–1166 4 Sugo, S., Minamino, N., Shoji, H., et al. (1994) Production and secretion of adrenomedullin from vascular smooth muscle cells : augmented production by tumor necrosis factor-α. Biochem. Biophys. Res. Commun. 203, 719–726 5 Jougasaki, M., Wei, C.-M., Heublein, D. M., Sandberg, S. M. and Burnett, Jr., J. C. (1995) Immunocytochemical localization of adrenomedullin in canine heart and aorta. Peptides 16, 773–775 6 Isumi, Y., Minamino, N., Katafuchi, T., et al. (1998) Adrenomedullin production in fibroblasts : its possible function as a growth regulator of Swiss 3T3 cells. Endocrinology 139, 2552–2563 7 Lai, K. N., Leung, J. C., Yeung, V. T., Lewis, L. K. and Nicholls, M. G. (1998) Gene transcription and synthesis of adrenomedullin by cultured human renal cells. Biochem. Biophys. Res. Commun. 244, 567–572 8 Nakayama, M., Takahashi, K., Murakami, O., et al. (1999) Adrenomedullin in monocytes and macrophages : possible involvement of macrophage-derived adrenomedullin in atherogenesis. Clin. Sci. 97, 247–251 9 Satoh, F., Takahashi, K., Murakami, O., et al. (1995) Adrenomedullin in human brain, adrenal glands and tumor tissues of pheochromocytoma, ganglioneuroblastoma and neuroblastoma. J. Clin. Endocrinol. Metab. 80, 1750–1752 10 Satoh, F., Takahashi, K., Murakami, O., et al. (1996) Immunocytochemical localization of adrenomedullin-like immunoreactivity in the human hypothalamus and the adrenal gland. Neurosci. Lett. 203, 207–210 11 Takahashi, K., Nakayama, M., Totsune, K., et al. (2000) Increased secretion of adrenomedullin from cultured human astrocytes by cytokines. J. Neurochem. 74, 99–103 12 Miller, M. J., Martinez, A., Unsworth, E. J., et al. (1996) Adrenomedullin expression in human tumor cell lines. J. Biol. Chem. 271, 23345–23351 13 Takahashi, K., Satoh, F., Sone, M., et al. (1998) Expression of adrenomedullin mRNA in adrenocortical tumors and secretion of adrenomedullin by cultured adrenocortical carcinoma cells. Peptides 19, 1719–1724 14 Murakami, O., Takahashi, K., Satoh, F., et al. (1998) Expression of adrenomedullin and adrenomedullin mRNA in ectopic ACTH-secreting tumors. Eur. J. Endocrinol. 138, 436–439 15 Washimine, H., Asada, Y., Kitamura, K., et al. (1995) Immunohistochemical identification of adrenomedullin in human, rat, and porcine tissue. Histochemistry 103, 251–254 16 Jougasaki, M., Wei, C.-M., McKinley, L. J. and Burnett, Jr., J. C. (1995) Elevation of circulating and ventricular adrenomedullin in human congestive heart failure. Circulation 92, 286–289 17 Nishikimi, T., Saito, Y., Kitamura, K., et al. (1995) Increased plasma levels of adrenomedullin in patients with heart failure. J. Am. Coll. Cardiol. 26, 1424–1431 18 Romppanen, H., Marttila, M., Magga, J., et al. (1997) Adrenomedullin gene expression in the rat heart is stimulated by acute pressure overload : Blunted effect in experimental hypertension. Endocrinology 138, 2636–2639 19 Nishikimi, T., Horio, T., Sasaki, T., et al. (1997) Cardiac production and secretion of adrenomedullin are increased in heart failure. Hypertension 30, 1369–1375 20 Kaiser, M., Kahr, O., Shimada, Y., et al. (1998) Differential regulation of ventricular adrenomedullin and atrial natriuretic peptide gene expression in pressure and volume overload in the rat. Clin. Sci. 94, 359–365 21 McLatchie, L. M., Fraser, N. J., Matin, M. J., et al. (1998) RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature (London) 393, 333–339 22 Chakravarty, P., Suthar, T. P., Coppock, H. A., et al. (2000) CGRP and adrenomedullin binding correlates with transcript levels for calcitonin receptor-like receptor (CRLR) and receptor activity modifying proteins (RAMPs) in rat tissues. Br. J. Pharmacol. 130, 189–195 # 2000 The Biochemical Society and the Medical Research Society 545 546 K. Totsune and others 23 Zhang, P. L., Mackenzie, H. S., Totsune, K., Troy, J. L. and Brenner, B. M. (1995) Renal effects of high-dose natriuretic peptide receptor blockade in rats with congestive heart failure. Circ. Res. 77, 1240–1245 24 Totsune, K., Mackenzie, H. S., Totsune, H., Troy, J. L., Lytton, J. and Brenner, B. M. (1998) Upregulation of atrial natriuretic peptide gene expression in remnant kidney of rats with reduced renal mass. J. Am. Soc. Nephrol. 9, 1613–1619 25 Chang, C. P., Pearse, II, R. V., O ’Connel, S. and Rosenfeld, M. G. (1993) Identification of a seven transmembrane helix receptor for corticotropin-releasing factor and sauvagine in mammalian brain. Neuron 11, 1187–1195 26 Rademaker, M. T., Charles, C. J., Lewis, L. K., et al. (1997) Beneficial hemodynamic and renal effects of adrenomedullin in an ovine model of heart failure. Circulation 96, 1983–1990 27 Parkes, D. G. (1995) Cardiovascular actions of adrenomedullin in conscious sheep. Am. J. Physiol. 268, H2574 28 Szokodi, I., Kinnunen, P. and Ruskoaho, H. (1996) Inotropic effect of adrenomedullin in the isolated perfused rat heart. Acta Physiol. Scand. 156, 151–152 29 Tsuruda, T., Kato, J., Kitamura, K., et al. (1998) Adrenomedullin : a possible autocrine or paracrine inhibitor of hypertrophy of cardiomyocytes. Hypertension 31, 505–510 30 Cormier-Regard, S., Nguyen, S. V. and Claycomb, W. C. (1998) Adrenomedullin gene expression is developmentally regulated and induced in rat ventricular cardiac myocytes. J. Biol. Chem. 273, 17787–17792 31 Nakayama, M., Takahashi, K., Murakami, O., Shirato, K. and Shibahara, S. (1999) Induction of adrenomedullin by hypoxia in cultured human coronary artery endothelial cells. Peptides 20, 769–772 32 Øie, E., Vinge, L. E., Yndestad, A., Sandberg, C., Groggard, H. K. and Attramadal, H. (2000) Induction of a myocardial adrenomedullin signaling system during ischemic heart failure in rats. Circulation 101, 415–422 33 Buhlmann, N., Leuthauser, K., Muff, R., Fisher, J. A. and Born, W. (1999) A receptor activity modifying protein (RAMP) 2-dependent adrenomedullin receptor is a calcitonin gene-related peptide receptor when coexpressed with human RAMP1. Endocrinology 140, 2883–2890 Received 18 April 2000/17 July 2000; accepted 8 August 2000 # 2000 The Biochemical Society and the Medical Research Society