Download SNPs Detection of Tomato Lycopersicum esculentum Sucrose

WAGENINGEN UR
SNPs Detection of Tomato Lycopersicum
esculentum Sucrose Synthase 2 Gene by
TILLING Technique and Mutation Enzyme
Activities Test in Yeast
Author
Pingping Huang
Examiners:
Dr. Christian Bachem
Dr.Ir. Guusje Bonnema
SNPs Detection of Tomato Lycopersicum esculentum
Sucrose Synthase 2 Gene by TILLING Technique and
Mutation Enzyme Activities Test in Yeast
Master Thesis Plant Breeding
– Specialization Plant Breeding and Genetic Resources
Code: PBR-80436
Author
Pingping Huang
Registration No:
840425370070
Examiners:
Dr. Christian Bachem
Dr.Ir. Guusje Bonnema
Supervisors:
Antoine Gady
Dr. Christian Bachem
Chair Group
Plant Breeding
Starting - End time
14-05-2009 - 14-12-2009
II Index
Index of Tables ...................................................................................................................... VI Index of Figures.................................................................................................................... VII Acknowledgement............................................................................................................... VIII Abstract................................................................................................................................... IX Abbreviations .......................................................................................................................... X Introduction ............................................................................................................................. 1 1.1 The Function of Sucrose Synthase and Sucrose Synthase 2 in Tomato ........... 1 1.2 Artificial Mutagenesis in Tomato ............................................................................... 1 1.3 TILLING technique with High Resolution Melting (HRM) Analysis Method ........ 2 1.3 Mutated Susy2 gene and Yeast Expression System ............................................. 2 1.4 Goal ............................................................................................................................... 3 2. Material and Method.......................................................................................................... 4 2.1 SNPs of Sucrose Synthase 2 Detected by TILLING Technique .......................... 4 2.1.1 Four Times Pooled DNA Platform ..................................................................... 4 2.1.2 Primer Design and PCR Reaction..................................................................... 4 2.1.2 Mutation Screening ............................................................................................. 5 2.1.3 DNA Sequencing ................................................................................................. 5 2.1.4 SNPs Analysis...................................................................................................... 6 2.2 Sucrose Synthase 2 Enzyme Activity Test on Yeast ............................................. 7 2.2.1 Sucrose Synthase 2 RNA Isolation................................................................... 7 2.2.2 DNase and Sucrose Synthase 2cDNA Synthesis........................................... 7 2.2.3 PCR Amplification of Susy2 cDNA.................................................................... 7 2.2.4 Purify Susy2 PCR Products ............................................................................... 7 2.2.5 Putting A-tailing on the end of Susy2 PCR Products ..................................... 7 III 2.2.6 Ligation and Insertion.......................................................................................... 7 2.2.7 Transformation and Selection ............................................................................ 8 2.2.8 Small scale DNA isolation .................................................................................. 8 2.2.9 Cloning PCR Reaction ........................................................................................ 9 2.2.10 Restriction Enzyme Digestion and Sequencing ............................................ 9 3. Results............................................................................................................................... 10 3.1 SNPs of Sucrose Synthase 2 Detected by TILLING Technique ........................ 10 3.1.1 Mutation Screening by Using HRM Analysis Method................................... 10 3.1.2 SNPs Identification ............................................................................................ 13 3.1.3 Genotyping Sequencing ................................................................................... 14 3.2 Susy2 Enzyme Activities Tested in Yeast ............................................................. 15 3.2.1 Susy2 Fragment Amplification ......................................................................... 15 3.2.2 Transformation and Selection .......................................................................... 15 3.2.3 Cloning PCR and Restriction Enzyme Digestion of Sucrose Synthase 2
Fragment....................................................................................................................... 16 3.2.4 Plasmid Sequencing.......................................................................................... 17 4. Discussion......................................................................................................................... 18 4.1 SNPs of Sucrose Synthase 2 Detected by TILLING Technique ........................ 18 4.1.1 HRM Analysis and TILLING technique........................................................... 18 4.1.2 Artificial Mutagenesis Method .......................................................................... 18 4.1.3 After Genotyping Sequencing .......................................................................... 19 4.2 Susy2 Enzyme Activities Tested in Yeast ............................................................. 20 4.2.1 Susy2 gene amplification.................................................................................. 20 4.2.2 Ligation, Transformation and sequencing...................................................... 20 5. Conclusion ........................................................................................................................ 21 References:........................................................................................................................... 22 IV Appendix................................................................................................................................ 25 V Index of Tables
Table 1 Primers design for PCR reaction ................................................................... 5 Table 2: Exons with specific primers, selected pools and individual lines, and the
number of lines that send to sequencing .......................................................... 11 Table 3 SNPs that found on Susy2 gene and the effect on protein function....... 13 Table 4 Genotyping result of selected plant ............................................................. 14 Table 5 mutation type of individual plant of each selected line. ............................ 27 Table 6 shows a conclusion of TILLING sub-project .............................................. 24 VI Index of Figures
Figure 1 metabolism pathway and the correlation between sucrose, UDPglucose and Fructose .................................................................................................................... 1 Figure 2 after heating the plate, double strand DNA starts melting and releases fluorescence that is recorded by lightscanner instruments as a curve, and heteroduplex start melting at low temperature..................................................... 12 Figure 3 the gel pictures of Susy2 PCR products. ............................................................ 15 Figure 4 E.coli cultures and pellets were incubated separately at 37℃ for 24 hours on selection medium,................................................................................................... 15 Figure 5 E.coli cultures and pellets were incubated separately at 37℃ for 24
hours on selection medium, ................................................................................ 16 Figure 6. The result of restriction enzyme digestion by using EcoRI enzyme, multiple bands showed in figure6B which indicate the success of transformation.............. 17 Figure 7 represents genomic DNA of Susy2. Green color marked as Intron and yellow color indicate exon. Dark blue color represents forward primer and light blue color shows the location of reverse primers.................................................................... 25 Figure 8 represents Susy2 cDNA with SNPs (pink color) and one SNPs turns amino acid into stop codon (yellow color) ................................................................................ 26 Figure 9 represents Susy2 cDNA with UTR region (purple color), forward and reverse primers (orange color) that used for amplification................................................. 25 Figure 10: Cloning PCR of plasmids that gave white color and blue color. ....................... 1 Figure 11 the sequence of PGMT-­‐easy vector (white part) and Susy2 cDNA (grey part). Red color indicate restriction cutting site of EcoRI. .................................................. 2 Figure 12 two days work output of PCR plate of TILLING by using HRM analysis and Lighscanner instrument ............................................................................................ 1 VII Acknowledgement
I would like to give thanks my thesis daily supervisor Antoine Gady for guidance and
support. He has been very patient to me and he always had time for me when it was
needed.
I would like to thank my thesis supervisor Dr. Christian Bachem for kindly providing
me this interesting research topic. I won t forget our discussions about TILLING and
Susy2 amplification.
I would like to express my thanks to Dr. Anne Kortstee for the very helpful advice on
my thesis project.
I would like to acknowledge the entire group for their generous help throughout my
thesis project. Thanks to Efstathios Roumeliotis for the help of primer design and
thanks to Bjorn kloosterman for the discussion of ligation check.
And a special thanks goes to Guillaume Bauchet for helpful discussion on my thesis
project.
In the end, Thanks to all people in the student room, especially Elske, Victoria,
Berend Jan, Izan, Tulipan, Ada and Georgios, thanks for the helpful discussion and
relax support.
VIII Abstract
Tomato (Solanum Lycopersicum L.) has been demonstrated with high commercial
value; it contains high nutrition value and is rich in sugars. Sucrose is a kind of sugar
that accumulates at high levels in green tomato fruit, and the import capacity of
Sucrose is controlled by Susy enzyme. Susy enzyme associated with plant cell
membrane and cell wall synthesis, furthermore, this enzyme also contributes to
abiotic stress tolerant. Susy enzyme has two isoforms: Susy2 and Susy3. This thesis
project only focuses on mutated Susy2 gene.
This research project combined two sub-projects: SNPs of Susy2 identification by
TILLING technique, and testing mutated Susy2 enzyme activity in yeast.
In the TILLING sub-project, 8025 tomato families mutated by treatment with EMS,
and TILLING technique combing with HRM analysis used to identify point mutation
on Susy2 gene. In the end, 5 tomato lines containing positive SNPs were identified
among 8025 families.
In the Enzyme activity test sub-project, mutated Susy2 genes were amplified and
transformed into plasmids. However, due to some difficulties in the gene amplification
progress and insufficient transformation, this project did not reach to yeast
transformation stage.
In conclusion, TILLING technique combined with HRM analysis provides a fast and
efficient way to identify point mutation, however, this technique is not the only way
can be applied on point mutation identification; other alternative can be KeypointTM
technique. Additionally, although EMS mutagenesis results in many possible mutants,
it brings many undesired characters in plant material. Other options can be using
target mutagenesis such as keyBaseTM and ZFNs, these two mutagenesis technique
enables to induce point mutation on in desired location on DNA of interests in plant.
In enzyme activities sub-project, Susy2 gene is hardly to be amplified, and the
reason may relate to RNA quality. Positive colonies of transformation were less, and
enzyme digestion result shows that there were false positive exists.
IX Abbreviations
EMS
Ethyl Methane Sulphonate
TILLING
Targeting Induced Local Lesions in Genomes
PCR
Polymerase Chain Reaction
SIFT
Sorting Intolerant From Tolerant
Susy
Sucrose Synthase
Susy2
Sucrose Synthase 2
Susy3
Sucrose Synthase 3
HRM
High Resolution Melting
X Introduction
1.1 The Function of
Synthase 2 in Tomato
Sucrose
Synthase
and
Sucrose
Tomato (Solanum Lycopersicum L.) is a member of the Solanaceae that has been
demonstrated to contain high nutrition value, and is rich in sugars (Fructose, glucose,
sucrose). Green tomato fruit accumulate high levels of sucrose, and ripe tomato fruit
contain high amounts of fructose and glucose, but with little or no accompanying
sucrose (Stommel JR, 1991). Sucrose import capacity in green tomato fruit is
controlled the by Sucrose Synthase
(Susy) enzyme (D Aoust et al, 1999).
This enzyme is regulated and can
catalyze in a reversible conversion of
sucrose to a nucleoside diphosphate
into the corresponding nucleoside
diphosphate glucose and fructose
(Fernández et al, 2009). As figure 1
shows, sucrose is cleaved by Susy
enzyme into UDP-Glucose and
Fructose (German et al, 2002). Susy
activity is consistently related to
increase in fruit sink strength and
yield in both wild and commercial
tomatoes (Sun et al, 1991). In some
Figure 1 metabolism pathway and the correlation cases, the enzyme may be
between sucrose, UDPglucose and Fructose associated with the cell membrane
and be responsible for providing substrates
for cell wall synthesis (Ruan et al, 1997).
Furthermore, research indicates that at lower temperature, sucrose accumulates and
sucrose Synthase activity increases in wild tomato species (Crespi et al, 1991). Two
isoforms of Susy are found in tomato: The gene coding for Sucrose Synthase 2
(Susy2) peaks in expression at day 20 after pollination in green tomato fruit (Kortstee
et al, 2007), and Sucrose Synthase 3 (Susy3) reaches its peak before fruit ripening.
The research described here focuses on the Susy2 enzyme, and is a combination of
two sub-projects: SNPs of Susy2 identification by TILLING technique, and testing
mutated Susy2 enzyme activity in yeast.
1.2 Artificial Mutagenesis in Tomato
Mutation is one of the most direct ways to determine gene function by analyzing the
changes
forward
that
happened
in
the
organism.
And
it
has
two
approaches:
genetics approach to identify mutated genes based on phenotype
observation, and reverse genetics approach is based on the mutagenesis of the
target gene and to identify various mutation genotypes. Random mutagenesis
methods such as using chemical Ehylemthane Sulfonate (EMS) can be used to
generate large, saturated mutant populations. EMS has been used frequently to
1 / 43 induce point mutation in tomato, and this method results in many viable mutants per
line and it provides a broad range of alleles that can be obtained within a small
population. The populations can be reverse screened based on gene sequence for
mutations in the target gene (Emmanuel and levy, 2002). In this project, the target
mutated gene is Susy2.
1.3 TILLING technique with High Resolution Melting (HRM)
Analysis Method
Targeting Induced Local Lesions in Genomes (TILLING) is a reverse-genetic
technique, which provides a fast and efficient way to identify induced point mutations
(SNPs) in genes of interest. Targeted mutations in tomato can provide useful material
for further study. Tomato Solanum Lycopersicum seeds mutated with EMS cause
C/G to T/A point mutations (Till et al, 2003). DNA was extracted individually from
individuals of the M2 population, pooled four times and arrayed in microtiter plates.
Polymerase Chain Reaction (PCR) is performed on the target gene and products are
denatured and reannealed to form heteroduplexes between the mutated sequence
and the wild-type counterpart. As opposed to the classical analysis method of
TILLING that is based on endonuclease enzyme (CEL1 or ENDO1), which cleaves at
the mutation point by recognizing mismatches in double strand DNA molecules
(Comai et al, 2004), we used a novel SNP identification method in this project.
Mutations are detected with High Resolution Melting (HRM) curve analysis using the
LightScannerTM instrument (Idaho Technology Inc.). This method uses the double
stranded DNA-binding LC Green plus dye (Idaho Technology Inc.), which detects the
presence of heteroduplexes that formed during annealing of wild type and mutant
PCR products. Double strand DNA starts to melt when heated at a particular
temperature determined by its nucleotide composition. As melting occurs, LC Green
plus dye is released from the heteroduplex and the fluorescent intensity of the
sample decreases proportionally. Fluorescence values for each sample are collected
by LightScanner instrument and transformed into a melting curve. Heteroduplexes
denature at lower temperature compared to homoduplexes giving rise to different
melting curves for each four times pool sample (Gady et al, 2009). Positive pools that
contain putative SNPs are sequenced using Sanger sequencing method to identify
whether the G/C or A/T point mutation is indeed present in the pool. Such identified
SNPs changes can lead to amino acid changes and may affect protein function. In
this project we use a program for identifying non-tolerated from tolerated mutations
(SIFT) to distinguish whether the amino acid substitution are likely to affect protein
function (Ng and Henikoff, 2003).
1.3 Mutated Susy2 gene and Yeast Expression System
In order to test the effects of mutations on enzymatic function, mutant genes are to
be cloned in expression vectors designed for yeast. Yeast is an ideal experiment
expression system for testing mutated Susy2 enzyme activities expression; it can
grow on defined media giving the investigator complete control over environmental
parameters (Feldmann 1999). In additional, this system is highly productive, giving
stable production strains and lower protein production cost.
2 1.4 Goal
The goal of this project is accomplished by two parts: Combing TILLING and HRM
analysis method to identify SNPs in mutated Susy2 gene of tomato, and amplifying
mutated Susy2 gene and test the enzyme activities in yeast.
3 2. Material and Method
2.1 SNPs of Sucrose Synthase 2 Detected by TILLING
Technique
2.1.1 Four Tim es Pooled DNA Platform
Stock DNA was obtained from a tomato Solaumn Lycopersicum M2 population that
was composed of 8025 families; therefore, in total 84 96-wells DNA plates were
obtained. Positive control DNA was isolated from tomato Solaumn Pimpenellifolium
that was grown in the field along with the M2 lines. The control DNA was added into
one well of each stock DNA platform at a specific position (A1 for plate number 1, B2
for plate number 2, etc). All DNA samples were arrayed and pooled 4 fold in 96-wells
plates for experimental use and 21 four times pooled plates were obtained.
2.1.2 Prim er Design and PCR Reaction
Primer design based on published sequence of tomato Solanum Esculentum
genomic DNA for Susy2 gene (AJ011535), 6 pairs of primers were designed partly in
the intron in order to amplify full exons (table 1). However, the amplicon with primer
Sus2_P8 contains intron2. The size of amplified fragment was smaller than 400bps
with the aim to fit High-resolution melt analysis (HRM) methods and the
LightScannerTM System (Idaho Technology Inc). The total volume of PCR reaction
mix was 10μl, with 0.25μl both forward and reverse primers (1μM/μl), 1μl LC green
plus dye (Idaho Technology Inc), 0.4 μl dNTPs (5μM), 2 μl 5χ PhireTM Reaction
Buffer, 0.1 μl PhireTM Hot Start DNA Polymerase (Finnzymes) and sterilized water.
PCR reaction was 35 cycles, 5 seconds at 94ºC, 20 seconds at 67ºC and 20 seconds
at 72ºC.
4 Table 1 Primers design for PCR reaction
1
2
3
Primer Direction Sequence Position Size Exons Sus2_F8 5'to 3' TGGTTTTGGTTATTACAGGATTGAAAGCC 376 Sus2_R8 5'to 3' CACATAAAAGTCTAAAACGTACGCTCCG 733 357 exon2 exon3 intron2 Sus2_F9 5'to 3' AAGTGTGTGCTTTTCCCTGATGCAG 822 Sus2_R9 5'to 3' CAAATTACCTTGCCCTTATAATGGTGAGC 994 Sus2_F10 5'to 3' TCTTGTTCACAGACAATGATGCTGAATG 1303 Sus2_R10 5'to 3' ATGATGATTTTAGGTAATGCACCTGGCC 1617 Sus2_F11 5'to 3' GCTAATGTCATTCACCCCTTGTTGTGTAG 1702 Sus2_R11 5'to 3' AGGAAACACTAACAATAAGAATACGGGGG 1782 Sus2_F12 5'to 3' TGTGTTATTTGTCTTTTGCAGTGCACC 2389 Sus2_R12 5'to 3' AAGCAAATTGATGCTAATACCTTCCTGC 2542 Sus2_F13 5'to 3' CCGCTCTTAATCCTTGTTGTTTTTCCAG 2627 Sus2_R13 5'to 3' ACCACTAATGTAGAAACTTACAGATGATCGTC 2841 1:
primers position on genomic DNA
2:
the size of amplified fragment
3:
the exons that are being amplified
172 exon4 314 exon5 80 exon6 153 exon9 214 exon10 2.1.2 M utation Screening
In this sub-project, mutation screening was performed in two rounds after the original
PCR reaction. Screening method was based on High-resolution melt analysis (HRM)
by using instrument LightScanner® System The first round of mutation screening was
for positive-pool selection; melting temperature range was set from 75ºC to 95ºC,
and only melting curves with high fluorescent intensity (above 800) were chosen for
further analysis. Different genotypes were distinguished by plotting the fluorescence
differences between normalized melting curves. Positive pools that showed lower
melting temperature were selected. In the second round of screening, DNA from
individual lines that formed part of the positive pool in the first round were positive
after PCR reaction (PCR reaction mix content see chapter 2.1.2). Lines that showed
lower melting temperature were selected, and the PCR products were prepared for
sequencing.
2.1.3 DNA Sequencing
DNA sequencing was based on Sanger method using ddNTPs as chain terminator,
and the analysis was done by Greenomics (www.greenomics.com). The sequencing
mix contains 4μl DETT mix (1μl DETT dye and3μl DETT buffer), 1μl 1μM primer,
100ng PCR products, and sterilized water that end up total volume as 10μl. PCR
5 reaction for sequencing was 25 cycles, 20 seconds at 94ºC, 15 seconds at 50ºC and
60 seconds at 60ºC.
2.1.4 SNPs Analysis
The Susy2 DNA sequence was translated into amino acids sequence on line
(http://www.expasy.ch/). The amino acid sequences were analyzed by on line using
SIFT (http://sift.jcvi.org/) to predict affects on protein function. Tomato plant lines with
predicted effects on enzyme function were grown from seed and DNA was exacted
from young leaves followed with PCR reaction (chapter 2.1.2). PCR products were
sequenced (chapter 2.1.4) and the DNA sequence analyzed by using SeqMan
module of Lasergene package (DNAstar Inc) to visualize the mutation is
heterozygote or homozygote.
6 2.2 Sucrose Synthase 2 Enzyme Activity Test on Yeast
2.2.1 Sucrose Synthase 2 RNA Isolation
RNA was isolated from green fruit of tomato Solamun Lycopersicum with 5 different
lines that named as 1:1285_1, 2:1285_3, 3:LA121_3, 4:LA121_6 and 5:LA121_7 by
using RNeasy Plant Mini Kit (QIAGEN). The procedure was done according to the
protocol supplied by the manufacture.
2.2.2 D Nase and Sucrose Synthase 2 cDNA Synthesis
cDNA synthesis was done using iScriptTM cDNA synthesis kit (BIO-RAD); the reaction
mix contains 4μl 5 x iScript reaction mix, 11μl Nuclease-free water, 1μl iScript reverse
transcriptase, and 4μl DNA that up to total volume 20μl. Reaction was 5 minutes at
25ºC, 30 minutes at 42ºC and 5 minutes at 85ºC.
2.2.3 PCR Am plification of Susy2 cDNA
Primers for the amplification of the Susy2 gene were designed on sequence of
tomato Solanum Esculentum genomic DNA for Sucrose Synthase 2 gene
(AJ011535). 5 -primer (Sus2 FW4 ‒ CTGCTGAATCAACTATAATGGCTGAACG) and
3 -primer (Sus2 RV4 - ACAGGTACCTCTACTTGTCAAAGACTT). Both primers were
designed at the junction of the UTR region. Sus2 FW4 includes start codon ATG and
Sus2 RV4 contains the stop codon TGA. PCR was carried out with tomato Solamun
Lycopersicum cDNA of the 5 different lines. Amplification was for 40 cycles, 5
seconds at 94 ºC, 20 seconds at 59 ºC and 180 seconds at 72 ºC. The resulting
fragment of approximately 2498bp was extracted from gel by using QIAquick Gel
Extraction Kit Protocol (QIAGEN).
2.2.4 Purify Susy2 PCR Products
Sucrose Synthase 2 fragments were excised from Agrose gel and this procedure was
done according to the protocol supplied by the manufacture.
2.2.5 Putting A -tailing on the end of Susy2 PCR Products
Before inserting the purified PCR products into pGEM-T easy plasmid vector
(Promega), A-tailing was added to the Susy2 PCR products since the PhireTM Hot
Start DNA Polymerase (Finnzymes) produces blunt-ended DNA fragments. 5 μ l
purified Sucrose Synthase 2 PCR products mixed with 1μl Taq DNA polymerase 10x
Reaction Buffer with MgCl2; dATP added to a final concentration of 0.2mM, 5 units of
Taq DNA polymerase and Sterilized MILI-Q were added to a final reaction volume of
10μl. Reaction mix was incubated at 70ºC for 30 minutes, and samples that the
concentration less than 42ng/μl were taken for ligation reaction.
2.2.6 Ligation and Insertion
Before starting ligation procedure, the insertion ratio was counted in order to get the
optimizing insertion. Appropriate amounts of Sucrose Synthase 2 PCR products
(insert) to include in the ligation reaction were calculated by using the following
equation:
7 The size of Susy2 fragment was 2498bp and the insert ratio was 1:1. In the end, the
maximum amount of insertion was 42ng. There were 3 reaction mixes in this
procedure: The standard reaction, a positive control and Background mix. The
ligation reaction for standard reaction group contains 5μl 2x Rapid Ligation Buffer ‒
T4 DNA ligase, 1μl pGEM-T easy vector (50ng), samples concentration that less than
42ng, 1μl T4 DNA ligase (3 Weiss unites/μl) and nuclease-free water to a final
volume of 10μl. For positive control group, the ligation was 5μl 2x Rapid Ligation
Buffer ‒ T4 DNA ligase, 1μl pGEM-T easy vector (50ng), 2μl control insert DNA, 1μl
T4 DNA ligase (3 Weiss unites/μl) and nuclease-free water to a final volume of 10μl.
The ligation reaction for Background control group contains 5μl 2x Rapid Ligation
Buffer ‒ T4 DNA ligase, 1μl pGEM-T easy vector (50ng), 1μl T4 DNA ligase (3 Weiss
unites/μl) and nuclease-free water to a final volume of 10μl. Each ligation reaction
mix incubated at room temperature for 1 hour, and 16 hour at 4ºC
2.2.7 Transform ation and Selection
5μl of each ligation reaction were transferred into sterilized 1.5ml microcentrifuge
tubes that were placed on ice. 50μl E.coli DH5-α competent cells was added. Tubes
were flicked gently and placed on ice for 20 minutes at room temperature. After this,
heat-shock was applied for 45 seconds at 42ºC. Tubes were returned on ice for 2
minutes immediately after heat-shock, and 950μl room-temperature LB added. Tubes
were incubated at 37ºC for 1.5 hours with shaking (220rpm). 100 μ l of each
transformation culture was placed on LB/Ampicillin/X-Gal medium; plates marked as
Plate 1 . After this, tubes were centrifuged at maximum speed for 1 minute, and 100
μl pellet from each transformation culture placed on LB/Ampicillin/X-Gal medium;
plates marked as Plate 2 . All the plates were incubated overnight at 37ºC. All the
colonies from Plate 1 were selected and incubated overnight at 37ºC with 2ml liquid
LB/Amplicilin medium and shaking at 220rpm. In total, 10 colonies (all white colonies
and few blue colonies) were selected from Plate 2 , and incubated overnight at 37ºC
with 2ml liquid LB/Amplicillin medium and shaking at 220rpm.
2.2.8 Sm all scale DNA isolation
Plasmid DNA was purified using the QIAprep Spin Miniprep Kit and a Microcentrifuge
(QIAGEN). 1.5ml transformed E.coli DH5-α competent cells were transferred from
liquid LB/Amplicillin medium to a 1.5ml micro-centrifuge tube. All tubes were
centrifuged at maximum speed for 1minute, and supernatant decanted. 250μl icecold TE/RNAse buffer (P1, QIAGEN) were added and vortexed at low speed. 250μl
lysis solution (P2, QIAGEN) were added, and sample solutions were mixed by 3
times invert. All tubes were incubated at room temperature for 5 minute, and 300μl
ice-cold KAc buffer (P3, QIAGEN) added. Sample solutions were mixed by 10 times
invert and all tubes centrifuged at maximum speed for 20 minutes. After this 500μl
cleared lysate was transferred into another sterilized micro-centrifuge tube that filled
with 350μl ice-cold isopropanol. All tubes were kept at 4oC for 15 minute and
centrifuged at maximum speed for 15 minutes. Supernatant was decanted, and 250μl
70% Ethanol were added. Tubes were centrifuged at maximum speed for 10
minutes, and pellet dissolved with 50μl sterilized MILI-Q water. All tubes were stored
at -20ºC.
8 2.2.9 Cloning PCR Reaction
Plasmid DNA was diluted 10 times and 1μl used for PCR reaction. M13 forward and
reverse primers were used for the reaction (M13 forward prime ‒
GTAAAACGACGGCCAG, M13 reverse primer ‒ CAGGAAACAGCTATGAC). PCR
reaction mix contains 1μl plasmid DNA, 0.25μl forward and 0.25μl reverse primers (1
μM/μl), 0.4 μl dNTPs (5μM), 2 μl 5x PhireTM Reaction Buffer, 0.1 μl PhireTM Hot Start
DNA Polymerase (Finnzymes) and sterilized water that filled total volume up to 10μl.
PCR reaction was 40 cycles, 5 seconds at 94ºC, 30 seconds at 55ºC and 180
seconds at 72ºC.
2.2.10 Restriction Enzym e Digestion and Sequencing
Plasmid DNA was digested by restriction enzyme in order to check if the
transformation was successful. Enzyme EcoRI used and the digestion temperature
was 37ºC for 3 hours. Digestion mix contains 2μ EcoRI buffer, 0.5μl EcoRI enzyme,
2μl Plasmid PCR products, and 15.5μl sterilized demineralised water to a total
volume of 20μl. Samples that showed the expected fragment pattern were chosen
for sequencing in order to check the SNPs changes. For the sequencing method, see
chapter 2.1.3.
9 3. Results
3.1 SNPs of Sucrose Synthase 2 Detected by TILLING
Technique
3.1.1 M utation Screening by Using HRM Analysis M ethod
This step involved with 2 times mutation screening with gene specific primers for
different exons, and figure 2 explains how the screening procedure can be done.
Table 2 showed the exons and intron2 that were screened with the gene specific
primers for different exons. After the first round of screening the following pools were
found to have variant melting curve characteristic: 18 pools for exon2, exon3 and
intron2, 10 pools for exon4, 22 pools for exon5, 16 pools for exon6, 15 pools for
exon9 and 14 pools for exon10. DNA of Individual lines that from positive pools were
then used in PCR reactions and these were rescreened for mutations. After
confirmation of the variant melting curves from the first screen, Sequence analysis
was carried out on the PCR products to identify the type of point mutation (G/C to
A/T)). As shown in Table2, after first PCR reaction with primer Sus2_P8, 18 positive
pools were found. It turned out that 72 DNA of individual lines taken for PCR reaction
and mutation screening. After the second screening of the individual lines, 9 lines out
of 72 that contain SNPs on exon2 exon3 and intron2 chosen for sequencing.
Therefore, 9 lines for exon2, exon3 and intron2, 10 lines for exon4, 12 lines for exon5,
8 lines for exon9 and 8 lines for exon10 send to sequencing. Sequencing was not
successful for exon6 probably due to small size of fragment (80bp).
10 Table 2: Exons with specific primers, selected pools and individual lines, and the
number of lines that send to sequencing
1
2
3
Primers Exons Pools individual lines For Sequencing Sus2_P8 2 ,3 and intron2 18 72 9 Sus2_P9 4 10 40 10 Sus2_P10 5 22 88 12 Sus2_P11 6 16 62 / Sus2_P12 9 15 60 8 Sus2_P13 10 14 54 8 1:
The numbers of positive pools that start melt at low temperature
2:
The number of individual lines that from the positive pools
3:
The number of individual lines for sequencing
11 Figure 2 after heating the plate, double strand DNA starts melting and releases fluorescence that is recorded by lightscanner instruments as a curve, and heteroduplex start melting at low temperature. This figure take a four times pool that constructed by DNA box 21 (B21), 22 (B22), 23 (B23) and 24 (B24). A1 to A3 shows the procedure of population screening of four times pooled plate and B1 to B3 shows the individual lines screening. A1 represents fluorescence data capture by the lightscanner and 3 curves start melt at lower temperature compare with majority curve melting temperature; A2 represents curves that start melt at low temperature release fluorescence earlier compare with majority curve; A3 represents the specific location on four times pooled plate of curves with low melting temperature; B1 represents 1 curve from the selected four times pool melt at low temperature; B2 represents the curve with low temperature also start release fluorescence early. B3 represent the location of individual lines with low melting temperature that from selected pool. 12 3.1.2 SNPs Identification
Table 3 shows the number of lines that were sent to sequencing, the number of lines
contain SNPs (each line contains 1 SNP), and the location of the SNPs. All the SNPs
in the region that can be amplified by primer Sus2_P8 were in intron2, 4 out of 10
lines contain SNPs in exon4, 2 out of 12 lines contain SNPs in exon5, 1 out of 8
lines contains SNP in exon9 and 2 out of 8 lines contain SNPs in exon10.
In this step, SIFT was used to predict if the single nucleotide changes are likely to
have an effect on protein function, and the changes of protein function were called
Deleterious. As table 3 shows the number of SNPs in the region that can be amplified
by primer Sus2_P8 were in intron2, therefore it did not influence protein function. 2
out of 4 lines in exon4 contain SNPs that can give an effect on protein function. 1 line
contains SNPs in exon5 that give rise to stop codon. Although only 1 line contains
SNPs in exon9, this mutation gave a predicted affect on protein function. And 1 out of
2 lines that contains SNP in exon10 has an effect on protein function.
Table 3 SNPs that found on Susy2 gene and the effect on protein function
Primers Sus2_P8 Exons For sequencing SNPs Deleterious 1
Seedlot Mutation 2
type 2 to 3, 9 Intron / / / intron2 Sus2_P9 4 10 4 2 2150 G/A 4755 C/T Sus2_P10 5 12 2 1 7165 T/A Sus2_P11 6 / / / / / Sus2_P12 9 8 1 1 1011 C/T Sus2_P13 10 8 2 1 2009 C/T 1 the Seedlot number of the tomato lines that with deleterious change 2 the change of single nucleotide 3 the change of amino acids due to the change of single nucleotide Amino acids 3
Change / G/R L/F Stop A/V P/L 13 3.1.3 Genotyping Sequencing
10 Tomato plants from each selected line that contained SNPs showing a predicted
effect on protein function were grown at Nunhems (Bayer Crop-Science), and DNA
was extracted from young leaves. Some plants did not grow; therefore, we had 5
plants for Seedlot 2150, 7 plants for seed lot 4755, 8 plants for Seedlot 7165, 5
plants for Seedlot 1011, and 4 plants for Seedlot 2009 (Appendix 1). Sequencing was
done for DNA to confirm if the mutation is heterozygote or homozygote. Table 4
showed that there was 1 plant containing homozygote mutation for Seedlot 2150, 2
plants for Seedlot 4755, 3 plants in Seedlot 7165, 1 plants for Seedlot 1011 and 1
plant for Seedlot 2009. And 2 plant with heterozygote mutation for Seedlot 2150, and
1 plant for the rest of each Seedlot.
Table 4 Genotyping result of selected plant
Primers Exons Seedlot Mutation Type A B C Sus_P8 2, 3, intron2 Intron / / / Sus_P9 4 2150 G/A 1 2 2 4755 C/T 2 1 3 Sus_P10 5 7165 T/A 3 1 2 Sus_P11 6 / / / / Sus_P12 9 1011 C/T 1 1 3 Sus_P13 10 2009 C/T 1 1 2 A: Homozygote with mutation B: Heterozygote with mutation C: No mutation 14 3.2 Susy2 Enzyme Activities Tested in Yeast
3.2.1 Susy2 Fragm ent Am plification
Figure 3A shows the amplified mutated
Susy2 fragment (size ~2.5kb) from the
cDNA obtained from 5 tomato lines
that named as 1: 1285_1, 2: 1285_3, 3:
LA121_3, 4: LA121_6 and 5: LA121_7.
However, as the pictures show, PCR
products gave multiple bands on gel.
DNA-fragment extraction was done to
Figure 3 the gel pictures of Susy2 PCR products. isolate the Susy2 fragment only, and
3A: Susy2 fragment amplified with annealing
the result was checked on gel to insure
º
temperature 50 C; multiple bands showed up. 3B:
we got clear single bands (Figure 2B).
The results of DNA extraction indicate that the
single band of Susy2 extracted, but line LA121_7
Figure 2B showed that a single
gave very weak band. fragment of Susy2 of the 5 tomato
lines extracted from gel, but the
LA121_7 gave very weak band. Line LA121_7 excluded from further analysis in this
sub-project.
3.2.2 Transform ation and Selection
Amplified mutated Susy2 fragments were
ligated
into
PGMT-easy
vector
and
transferred into E.coli. E.coli cultures and
pellets were incubated separately at 37℃ for
24
hours
on
selection
medium
(LB/Ampicillin/X-Gal). Figure 4 shows the
results of background control group and
positive control group on selection medium.
As only blue colonies showed in background
control
group
and
most
while
colonies
showed in positive control group, therefore,
the transformation was succeeded.
Figure 5 represents E.coli cultures and pellets
that contain mutated Susy2 fragments from 4
tomato lines on selection medium. Few
colonies reproduced by using E.coli culture,
and only 1 white colony appeared in figure5
A3. Lots of colonies reproduced by using
E.coli pellets, however, there was no white
colonies appeared in plate B5. For plate B3,
Figure 4 E.coli cultures and pellets were incubated separately at 37℃ for 24 hours on selection medium, A1 and A2 use transformation culture, B1 and
B2 use pellet. A1 and B1 represent
background control which colonies have not
been transformed, and it only shows blue
colonies on selection medium, A2 and B2
represent positive control that colonies have
been transformed, and transformed colonies
show white colonies on selection medium.
B4 and B6, each plate contains 3 white
colonies
15 Figure 5 E.coli cultures and pellets were incubated separately at 37℃ for 24 hours on selection
medium,
A3 to A6 represent E.coli cultures that contain mutated Susy2 fragment from 4 tomato lines. B3
to B6 represent E.coli pellets which contain mutated Susy2 fragment from 4 tomato lines.
Cultures in A3 and pellet in B3 contain mutated Susy2 fragment from tomato line 1: 1285_1,
cultures in A4 and B4 contain mutated Susy2 fragment from tomato line 2: 1285_3, cultures in
A5 and pellets in B5 contain mutated Susy2 fragment from tomato line3: LA121_3, cultures in
A6 and pellets in B6 contain mutated Susy2 fragment from tomato line 4: LA121_6 3.2.3 Cloning PCR and Restriction Enzym e Digestion of Sucrose
Synthase
2 Fragm ent
All colonies that reproduced by E.coli cultures, and 10 colonies (include 3 white
colonies)/plate that reproduced by E.coli pellet were chosen for cloning PCR. The gel
picture of cloning PCR (see appendix) did not show big differences of all samples,
and also no differences between blue colonies and white colonies. However,
restriction enzyme EcoRI was used to determine the success of transformation, and
cloning PCR products were used. There were 3 restriction cutting sites on Susy2
gene and 2 restriction cutting site on PGMT-easy vector, therefore, multiple bands
can be observed on gel picture. All colonies used for enzyme digestion reaction
(figure6A) were reproduced by E.coli cultures, 2 colonies from one group that
cultures contain one mutated tomato Susy2 fragment. All colonies in figure 6B were
from E.coli pellets, 2 colonies (1 white and 1 blue, except 6B3) samples from one
group which pellets contain one mutated tomato Susy2 fragment. Overall, multiple
bands showed in figure 6B which proved successes transformations appear.
16 Figure 6. The result of restriction enzyme digestion by using EcoRI enzyme, multiple bands showed in figure6B which indicate the success of transformation. Figure6A 1, 6A2, 6A3 and 6A4 represent colonies that reproduced by E.coli cultures contain mutated Susy2 fragment from tomato line1: 1285_1, line2: 1285_3, line3: LA121_3, line4: LA121_6. Figure6B1, 6B2, 6B3, and 6B4 represent colonies that reproduced by E.coli pellets contain mutated Susy2 fragment from tomato line1: 1285_1, line2: 1285_3, line3: LA121_3, line4: LA121_6. 3.2.4
Plasm id Sequencing
Sequencing results confirmed the mutated Susy2 fragments were transformed into
E.coli plasmid.
17 4. Discussion
4.1 SNPs of Sucrose Synthase 2 Detected by TILLING
Technique
4.1.1 HRM Analysis and TILLING technique
Comparing with classical point mutation identification method, TILLING technique
combined with HRM analysis provide a fast and efficient way to identify point
mutation in the interests gene in plant material.
With EMS mutagenesis, TILLING is a high-throughput method for detecting point
mutations and it can be applied on small populations of any plant species. However,
this technique is not the only way to identify point mutations. KeypointTM (Keygene
N.V) is another technique that is based on massive parallel sequencing of target
genes amplified from mutant populations (Rigola et al, 2009).
4.1.2 Artificial M utagenesis M ethod
Although EMS can results many viable mutants per line of tomato, in this project
most positive pools do not contain knockouts of Susy2 gene. And most of detected
mutations are silent. This problem can be solved by other methods such as target
mutagenesis. Comparing with the EMS mutagenesis result in plant, there is no other
undesired negative characters appearing in plant material. One method is using Zincfinger nucleases (ZFNs) to generate double-strand breaks at specific location in plant
genome and to induce mutations that are produced subsequently at the break site.
ZFNs gene introduced into plant genome along with a construct that driven by a heatshock promoter. Seedlings can be heated and ZFN expressed, this result in
mutations at the ZFN recognition sequence, and the mutation frequencies is about
0.2 mutations per target. The mutations can result in deletion, insertion, and deletion
accompanied by insertions (Lioyd et al., 2004). The other method is announced by
KeyGene® recently, and this technology named as KeyBaseTM. Comparing with
classical mutagenesis method, this method enables inducing point mutation in a
specific location on DNA of interests in plant.
18 4.1.3 After Genotyping Sequencing
Plants that contain heterozygote mutated Susy2 gene can be selfed, and
homozygote mutation plants can be selected from the offspring due to segregation.
Homozygote mutated Susy2 enzyme may lead to high content of sucrose in green
tomato fruit, and this may has contribute to against abiotic stresses such as cold
stress tolerance (Kaur et al, 2009), drought tolerant (Papini-Terzi, 2009), and Salt
tolerance(Rathert, 1984).
Homozygote mutated Susy2 gene can be transformed into yeast and to test its
activities under different circumstances such as low temperature. However, the
transformation of mutated Susy2 gene into plasmid was difficult to be reached in this
project. Plants that contain homozygote mutated Susy2 gene can be tested under
different conditions in vitro, by observing the phenotype of plants to analysis the
function of mutated Susy2 gene.
19 4.2 Susy2 Enzyme Activities Tested in Yeast
4.2.1 Susy2 gene am plification
Primers for Susy2 gene amplification were designed using softwares such as
Oligo6, APE, and Primer3. GC content was high and annealing temperature around
60ºC by calculation. However, the amplification met difficulties in this project. 3
forward primers and 3 reverse primers were designed in UTR region, another 1
forward primer started with start codon, and 1 reverse primer ended with stop codon.
In total, four primer pairs were designed in order to amplify Susy2 gene, and there
were 16 primer combinations. In the end, only 1 primer combination that was located
in UTR region successfully amplified Susy2 fragment. The reason may relate to
isolated RNA and cDNA quality.
Two groups of control primers which do not contain start codon and stop codon used
in this project, to insure the cDNA quality. Control primer pair 1 was tested by Dr.
Anne Kortstee, and Control primer pair 2 was tested by Antoine Gady.
- Control primer pair 1: control primers 5 -primer (Sus2 control Forward ‒
GTGTTCTGACTCGTGTTCA)
and
3 -primer
(Sus2
control
Reverse
TTCGGAGTAGATTTGCCA), amplified fragment s size is around 2.3kb
Control
primer
pair
2:
5 -primer
(Sus2
control2
Forward
‒
TCGTGTGAAGAATTTAACCGGACTTGT) and 3 primer (Sus2 control2 Reverse ‒
TTGCATTTCTCAAAGAAATCAGCTAGCA). The size of amplified fragment is around
400bp
Fragments amplification with control primers failed by using cDNA that synthesized
from RNA isolated at the first time, and there was no amplification result with any
primer combinations. However, it succeeded by using cDNA which synthesized from
RNA isolated at second time. Results showed multiple bands, it may relate to primer
specificity. Annealing temperature was tested at 55ºC, 59℃ and 62℃, in the end, 59
℃ was chosen as the most suitable annealing temperature.
4.2.2 Ligation, Transform ation and sequencing
Ligation between Susy2 gene and PGMT-easy vector was not easy to obtain.
Although background control groups and positive control groups indicate the
transformation were successes, there were less white colonies showed on selection
medium. An assumption is that there may have been false positives, therefore, white
and blue colonies were chosen and for cloning PCR, and the products used for
restriction enzyme digestion. Gel picture of enzyme digestion result (figure.6) indicate
that false positive is possible, evidence showed in figure 6B.1, white and blue
colonies gave same result on gel picture.
Sequencing performed to insure mutated Susy2 genes were transformed. After these,
mutated gene need be transformed into yeast vector to test enzyme activities.
20 5. Conclusion
EMS mutagenesis can result in many viable mutations per line of tomato; TILLING
technique combined with HRM analysis provides a fast and efficient way to identify
point mutation in Susy2 gene in tomato plants. In the end, 5 tomato lines were
identified as contain positive SNPs among 8025 families. However, EMS
mutagenesis is not the best way to create new plant products due to many undesired
negative characters appearing in plant material. Comparing with EMS mutagenesis,
targeted mutagenesis can provide a result mutation at a specific desired location on
DNA and without any other negative characters in plant material. Homozygote
mutated Susy2 gene may contribute to abiotic stress tolerance, and test experiments
can be performed by using yeast expression system, or by using in vitro plant test.
It was difficult to amplify mutated Susy2 gene, the reason may relate to the quality of
RNA and cDNA. Amplification specificity was not high, multiple bands showed on gel
picture. Ligation between mutated Susy2 gene and PGMT-easy vector was difficult
and transformation result shows false positive.
21 References:
Com ai L, Young K, Till BJ, Reynolds SH, Greene EA, Codom o CA, Enns
LC, Johnson JE, Burtner C, Odden AR, Henikoff S. (2004). Efficient
Discovery of DNA polymorphisms in Natural Populations by Ecotilling. Plant J.
Vol37:778-786.
Crespi M D, Zabaleta EJ, Pontis HG, Salerno GL. (1991). Sucrose Synthase
Expression During Cold Acclimation in Wheat. Plant Physiol. Vol96: 887-891.
D Aoust M A, Yelle S, Quoc BN. (1999). Antisense Inhibition of Tomato Fruit
Sucrose Synthase Decreases Fruit Setting and the Sucrose Unloading Capacity of
young Fruit. The Plant Cell. Vol11: 2407-2418.
Em m aunel E, Levya AA. (2002). Tomato Mutants as Tools for Functional
Genomics. Current Opinion in Plant Biology. Vol5:112-117.
Feldm ann H. 1999. the Yeast Saccharomyces Cerevisiae: Insights From the First
Complete Eukaryotic Genome Sequence. Edited by Richard P. Oliver and Michael
Schweizer. Molecular Fungal Biology: 78-134.
Fernández EB, M uñoz FJ, M ontero M , Etxeerria E, Sesm a M T, Ovecka
M , Bahaji A, Ezquer I, Li J, Part S, Rom ero JP. (2009). Enhancing Sucrose
Synthase Activity in Transgenic Potato (Solanum tuberosum L.) Tubers Results in
Increased Levels of Starch, ADPglucose and UDPglucose and Total Yield. Plant Cell
Physiol. Vol50: 1651-1662.
Germ an M A, Dai N, Chem lnitsky I, Sobolev I, Salts Y, Barg R, Schaffer
AA, Granot D. (2002). LeFRK4, a Novel Tomato (Lycopersicon esculentum Mill.)
Fructokinase Specifically Expressed in Stamens. Plant Science. Vol163: 607-613.
Gady ALF, Herm ans FW K, van de W al M HBJ, van Loo EN, Visser RGF,
Bachem CW B. (2009). Implementation of Two High Through-put Techniques in a
Novel Applications: Detecting Point Mutations in Large EMS Mutated Plant
Populations. Plant Method. Vol5:13
Germ an M A, Asher I, Petreikov M , Dai N, Schaffer AA, Granot D. (2004).
Cloning, Expression and Characterization of LeFRK3, the Fourth Tomato
(Lycopersicon Esculentum Mill.) gene encoding fructokinase. Plant Science. Vol166:
285-291.
Rathert G. (1984). Sucrose and Starch Content of Plant Parts as a Possible
Indicator for Salt Tolerance of Crops. Plant Physiol. Vol11: 491-495.
Rigola D, vanOeveren J, Jassen A, Bonne A, Schneiders H, van der
Poel HJA, van Orsouw J, Hogers RCJ, de Both M TJ, van Eijk M JT.
(2009). High-Throughput Detection of Induced Mutations and Natural Variation Using
KeyPoint TM Technology. PLoS ONE. Vol4.Issue3.
22 Ruan YL, Chourey PS, Delem er DP, Perez-Grau L. 1997. The Differential
Expression of Sucrose Synthase in Relation to Diverse Paterns of Carbon
Partitioning in Developing Cotton Seeds. Plant Physiol. Vol115: 375-385.
Kaur S, Gupta Ak, Kaur N, Sandhu JS, Gupta SK. (2009). Antioxidative
Enzymes and Sucrose Synthase Contribute to Cold Stress Tolerance in Chickpea.
Journal of Agronomy and Crop Science. Vol195:393-397.
Kortstee AJ, Appeldoorn NJG, Oortwijn M EP, Visser RGF. 2007.
Differences in Regulation of Carbohydrate Metabolism During Early Fruit
Development Between Domesticated Tomato and Two Wild Relatives. Planta.
Vol226: 929-939.
Lioyd A, Plalsler CL, Carroll D, Drews GN. (2004). Target Mutagenesis Using
Zinc-Finger Nucleases in Arabidopsis. PNAS. Vol102:2232-2237.
Ng PC and Henikoff S. 2003. SIFT: Predicting Amino Acid Changes that Affect
Protein Function. Nucleic Acid Research. Vol 31: 3812-3814.
Stom m el JR. (1991). Enzymic Components of Sucrose Accumulation in the Wild
Tomato Species Lycopersicon Peruvianum. Plant Physiol. Vol99: 324-328.
Sun JD, Loboda T, Sung SJS, Black CC. (1991). Sucrose Synthase in Wild
Tomato, Lycopersicon Chmielewskii, and Tomato Fruit Sink Strength. Plant Physiol.
Vol98: 1163-1169.
Papini-Terzi FS, Rocha FR, Vencio RZN, Felix JM , Branco DS,
W aclawovsky AJ, Bem LEVD, Lem bke CG, Costa M DL, Jr M YN,
Vicentini R, Vincentz M GA and Ulian EC. (2009). Sugarcan Genes
Associated with Sucrose Content. BMC Genomics. Vol10: 120-141.
23 Till BJ, Reynold SH, Greene EA, Codom o CA, Enns LC, Jonson JE,
Burtner C, Odden AR, Young K, Taylor NE, Henikoff JG, Com ai L,
Henikoff S. (2003). Large-Scale Discovery of Induced Point Mutations With Highthroughput TILLING. Cold Spring Harbor Laboratory Press. Vol13: 524-530.
KeyBastTM A New M utagenesis Technique
http://www.seedquest.com/yellowpages/europe/holland/k/keygene/articles/keybase.h
tm
24 Appendix
Figure 7 represents genomic DNA of Susy2. Green color marked as Intron and yellow color indicate exon. Dark blue color represents forward primer and light blue color shows the location of reverse primers. 25 Figure 8 represents Susy2 cDNA with SNPs (pink color) and one SNPs turns amino acid into stop codon (yellow color) 26 Table 5 mutation type of individual plant of each selected line.
Primers
Sus_P9
Sus_P10
Sus_P12
Sus_P13
Seedlot
2150_1
2150_3
2150_4
2150_5
2150_9
4755_1
4755_3
4755_4
4755_5
4755_6
4755_7
4755_8
7165_1
7165_2
7165_4
7165_5
7165_6
7165_8
7165_9
7165_10
1011_1
1011_2
1011_7
1011_8
1011_9
2009_1
2009_2
2009_3
2009_4
Mutation Type of SNPs
G/A, exon4
C/T, exon4
T/A, exon5
C/T, exon9
C/T, exon10
Mutation
Heterozygote
No mutation
Heterozygote
No mutation
Homozygote
No mutation
Homozygote
Homozygote
No mutation
Heterozygote
No mutation
Heterozygote
Homozygote
Homozygote
Heterozygote
No mutation
Homozygote
Homozygote
Homozygote
No mutation
Homozygote
No mutation
No mutation
Heterozygote
Homozygote
Homozygote
Heterozygote
Homozygote
No mutation
27