* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download formativeassessment - the Biology Scholars Program Wiki
Survey
Document related concepts
Silencer (genetics) wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding DNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
Genetic code wikipedia , lookup
DNA supercoil wikipedia , lookup
Community fingerprinting wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Point mutation wikipedia , lookup
Biochemistry wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Transcript
Formative Assessments JiTT Quiz Think-pair-share 1-minute paper Clickers with peer discussion Group work followed by report-out Jigsaw Concept maps Homework Projects Many others! Formative assessments have multiple roles in the classroom 1. Assessments help confront misconceptions (http://www.learner.org/resources/series26.html) A small acorn grows into a large tree. What contributes most to this biomass? a. sun b. water c. air d. soil 2. Assessments help students distinguish between what they know and what they don’t know. Genetic diseases, like Phenlyketonuria (PKU), confirm that there is a link between an individual’s DNA and that individual’s proteins. Below is a DNA molecule and the amino acid sequence that would result from translating the DNA sequence. 3’CGTTTTACCAAACCGAGTACTGAG 5’GCAAAATGGTTTGGCTCATGACTC TRP-PHE-GLY-SER Which nucleotides are responsible for this particular sequence of amino acids? As a group, write down what you know about DNA and proteins on one side of the white board. On the other side, write what else you need to know to be able to answer this question. 3. Assessments can provide a gauge of progress Feedback from clickers informs you and your students Value of peer discussion Clicker example dominant Unattached earlobes are due to the dominant allele (top picture) Attached earlobes are due to the recessive allele (bottom picture) recessive Initial Imagine that earlobe attachment is dictated by a single gene (a simplification), yielding two traits: unattached and attached. After discussion From this information, you can conclude: a. Attached earlobes are seen less frequently than unattached earlobes in a population b. Attached earlobes are seen more frequently than unattached earlobes in a population c. Either phenotype could be seen more frequently in a population: you need more information 4. Formative assessment can aid construction of new knowledge Darwin at the Olympics (For this exercise, pretend you are a student who is just learning about natural selection) • Work with your group to modify the 100-meter dash such that it would become an example of natural selection. Which are actual examples of natural selection, and why?