Download formativeassessment - the Biology Scholars Program Wiki

Formative Assessments
JiTT
Quiz
Think-pair-share
1-minute paper
Clickers with peer discussion
Group work followed by report-out
Jigsaw
Concept maps
Homework
Projects
Many others!
Formative assessments have
multiple roles in the classroom
1. Assessments help confront
misconceptions
(http://www.learner.org/resources/series26.html)
A small acorn grows into a large
tree. What contributes most to
this biomass?
a. sun
b. water
c. air
d. soil
2. Assessments help students
distinguish between what they know
and what they don’t know.
Genetic diseases, like Phenlyketonuria (PKU), confirm that
there is a link between an individual’s DNA and that
individual’s proteins.
Below is a DNA molecule and the amino acid sequence
that would result from translating the DNA sequence.
3’CGTTTTACCAAACCGAGTACTGAG
5’GCAAAATGGTTTGGCTCATGACTC
TRP-PHE-GLY-SER
Which nucleotides are responsible for this particular
sequence of amino acids?
As a group, write down what you know about DNA and proteins
on one side of the white board.
On the other side, write what else you need to know to be able
to answer this question.
3. Assessments can provide a gauge
of progress
Feedback from clickers informs
you and your students
Value of peer discussion
Clicker example
dominant
Unattached earlobes are due to the
dominant allele (top picture)
Attached earlobes are due to the
recessive allele (bottom picture)
recessive
Initial
Imagine that earlobe attachment is
dictated by a single gene (a
simplification), yielding two traits:
unattached and attached.
After discussion
From this information, you can
conclude:
a. Attached earlobes are seen less
frequently than unattached
earlobes in a population
b. Attached earlobes are seen more
frequently than unattached
earlobes in a population
c. Either phenotype could be seen
more frequently in a population:
you need more information
4. Formative assessment can
aid construction of new
knowledge
Darwin at the Olympics
(For this exercise, pretend you are a student who is just learning about
natural selection)
• Work with your group to modify the
100-meter dash such that it would
become an example of natural selection.
Which are actual examples of natural selection,
and why?