Download Establishment of a multiplex RT-PCR assay for the detection of

Detection of immune response activation by exogenous nucleic acids
by a multiplex RT-PCR method
José A. Reyes-Darias and Alfredo Berzal-Herranz*
Instituto de Parasitología y Biomedicina “López-Neyra”, CSIC (IPBLN-CSIC)
PTS Granada, Avda. del Conocimiento s/n, Armilla, 18016, Granada, Spain.
Tel: +34-958-18 16 48
Fax: +34-958-18 16 32
*Address correspondence to this author at the Instituto de Parasitología y Biomedicina
“López-Neyra” (IPBLN-CSIC), PTS Granada, Avd. del Conocimiento s/n, Armilla 18016,
Granada , Spain; Tel: +34-958-18 16 48; Fax: +34-958-18 16 32; E-mail:
[email protected]
Running title: Detection of innate immune response activation by RT-PCR
Abstract
Transfection of mammalian cells or in vivo administration of nucleic acids can induce
inflammatory cytokines and/or interferon response, which could significantly influence the
ex vivo or in vivo applications of gene-targeting strategies based on nucleic acids. Further
induction of the interferon and inflammatory related stress responses may result in offtarget effects and toxicity. This work describes an original one-step multiplex reverse
transcription polymerase chain reaction procedure, which allows testing the induction of
interferon and proinflamatory related responses by nucleic acids in the cell system of
choice. The developed procedure has been tested on mammalian cells transfected with
ssRNA,
dsRNA,
enzymatically
synthesized
siRNA
and
synthetic
oligodesoxyribonucleotides containing unmethylated cytosine-guanosine motifs. This
procedure is a rapid and convenient screening assay that could be used routinely in both
the clinical and the research laboratory to validate the stimulation of the immune system
on mammalian cells by nucleic acids.
Keywords: immune response detection, interferon, multiplex RT-PCR, CpG DNA
oligonucleotide, siRNAs, Toll-like receptors.
1. Introduction
Small interfering RNAs (siRNAs), antisense RNAs and DNAs (ODNs) that mediates
specific gene silencing are widely used to study gene function and are also being
developed for therapeutic applications [1]. However, many nucleic acids, including doublestranded RNA (dsRNA) [2], single-stranded RNA (ssRNA) [3; 4; 5], bacterial DNA and
synthetic ODN containing unmethylated cytosine-guanosine motifs (CpG ODN) [6; 7], can
stimulate innate immune response in mammals. This could significantly influence the ex
vivo and in vivo applications of these gene-targeting strategies owing to off-target effects
and toxicities associated with immune stimulation. Innate immune responses can be
triggered through a variety of so-called pattern recognition receptors, including Toll-like
receptors (TLRs) that are activated by PAMPs (pathogen-associated molecular patterns)
such as lipoproteins/lipopeptides, flagellin, lipopolysaccharides, and nucleic acids of
bacteria and viruses [8; 9]. The human TLR3 is the receptor for viral and synthetic dsRNAs
[2], TLR7 and TLR8 are the receptors for viral ssRNAs and nucleosides [3; 4; 10] and
TLR9 recognizes nomethylated CpG motifs of synthetic oligonucleotides, bacterial and
viral DNA [11]. It has been shown that human TLRs are differentially expressed in a variety
of tissues [12; 13; 14; 15].
Agonists of TLRs 3, 7, 8, and 9 have been found to be potent inducers of alpha
interferon (αINF) and the interferon-induced antiviral biomarker 2',5'-oligoadenylate
synthetase (OAS) [16]. Activation of TLR9 induces IL-8 secretion in human cells [17].
ISG56 is a member of a family of proteins whose expression is strongly induced from very
low basal levels by IFN [18].
The sensivity of different cell lines to nucleic acids activation interferon-induced
stress genes and pathways can vary significantly. Cell type, as well as growth conditions
and passage number, can affect the susceptibility, level, and extend of activation of the
interferon response. Therefore, a method that analyzes simultaneously a large number of
genes or proteins is more likely to ensure the induction of an immune response. Currently,
there are several methods available for detecting interferon response as an enzyme-linked
immunosorbent assay (ELISA) [19], western blotting, or a commercial monospecific
reverse transcription polymerase chain reaction (RT-PCR) method (Interferon Response
Detection Kit from System Biosciences). However these methods are laborious and time
consuming. A multiplex RT-PCR technique that allows determining simultaneously the
presence or absence of several specific RNA templates from RNA mixtures in a single
reaction tube, is shown as the most efficient methodology for determining the stimulation
of the immune system by nucleic acids. We have developed a multiplex RT-PCR method
that allows the simultaneous detection of IFNα, ISG56, OAS2 genes involved in the
interferon response and the pro-inflamatory cytokine IL-8 gene, a marker of a noninterferon mediated cellular response. In addition the glyceraldehyde-3-phosphatedehidrogenase (GAPDH) is also detected as internal reference gene.
2. Materials and Methods
2.1 Cell culture and transfection.
The human embryonic kidney (HEK) 293T cell line was maintained in Dulbecco´s
modified Eagle’s medium
(DMEM;
PAA
Laboratories Gmbh,
Cölbe, Germany)
supplemented with 10% fetal bovine serum (FBS; Gibco, Invitrogen, San Diego, CA, USA),
100 μg/ml Streptomycin (Sigma Chemical Co. St Louis, MO, USA) 4 mM L-glutamine
(Sigma) and 1 mM sodium pyruvate (Sigma). Human burkitt lymphoma cell line Namalwa
was maintained as suspension culture in RPMI 1640 medium supplemented with 10%
FSB, 2 mM L-glutamine and 50 μg/ml Gentamycin (Sigma). The human U87CD4CXCR4
glioma cell line, was grown in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 50
μg/ml Gentamycin, 300 μg/ml G418 (Sigma) and 1 μg/ml puromycine (Sigma). HEK 293T
cells stably expressing human TLR9 (HEK 293T/hTLR9) were developed by transfection of
6 x 105 cells per well, in a 6-well plate with 4 μg of the pUNO1-hTLR09a plasmid DNA
(Invivogen), using Lipofectamine 2000 (Invitrogen). The pUNO1-hTLR09a vector
expresses the human TLR09a (CD289) gene isoform 1 intronless open reading frame from
the ATG to the stop codon (Invivogen, 6.3 Kb). Forty-eight hours after transfection, cells
were selected in DMEM containing 25 μg/ml blasticidin. Stable cell lines were propagated
and maintained in complete DMEM supplemented with 25 μg/ml blasticidin. The cells were
maintained at 37ºC in a humidified atmosphere with 5% CO2.
Adherent cells were harvested by trypsinization (0.25% trypsin, 0.02% EDTA) and
seeded in 24-well plate at a cell density of 8-10 x104 cells per plate while Namalwa were
seeded at a density of 5x105 cells/ml and incubated 24 hours at 37°C for 24 hours before
transfection. The HEK 293T cells were transfected using lipofectamine 2000 transfectant
agent (invitrogen) with 0.5 μg of synthetic ssRNA and 0.5 μg synthetic dsRNA poly I:C
(Sigma). The U87CD4CXCR4 cells were transfected with 0.5 μg of ssRNA. The
immunostimulatory CpG ODN 2006 (TCGTCGTTTTGTCGTT TTGTCGTT) belonging to
the class B was purchased from Invivogen. The immunostimulatory CpG motifs are
underlined. HEK 293T/hTLR9 and Nawalma cells were incubated with 2.5 μM ODN 2006
(Invivogen).
2.2 RNA isolation and RT-PCR analysis of TLR3, TLR7, TLR8, TLR9, IL-6, IL-8 and IL10 gene expression.
Total RNA from transfected HEK 293T, HEK 293T/hTLR9, U87CD4CXCR4 and Namalwa
cells were extracted using Trizol reagent (Invitrogen) following the manufacturer’s protocol.
After treatment with RQ1 DNase (Promega) the extracted RNA was resuspended in 30 μl
of nuclease-free water and stored at – 80ºC. RNA was quantified using NanoDrop ND1000 spectrophotometric UV/Vis analysis (Nixor Biotech, Paris, France), and the integrity
of total RNA was checked by agarose gel electrophoresis. Total RNA (1 µg) was reverse
transcribed using the High-CapacitycDNA Reverse Transcription Kit (Applied Biosystems)
and random hexamers, according to the manufacturer’s instructions. The PCR reaction
was set at 20 μl total volume, containing 2 μl of the cDNA sample, 0.625 units of Taq DNA
polimerasa (Thermo), 0.2 mM of each nucleotide, 75 mM of Tris-HCl (pH 8.8 a 25 °C), 20
mM (NH4)2 SO4, 0.01% Tween® 20, 1.5 mM MgCl2 and 10 pmol of each of the
corresponding primer set to detect the transcripts. Primers were designed according to the
genbank
sequences
for
human
TLRs.
Human
CCTGGTTTGTTAATTGGATTAACGA-3’,
TGAGGTGGAGTGTTGCAAAGG-3’;
TLR3
forward
reverse
human
TTTACCTGGATGGAAACCAGCTA-3’,
TCAAGGCTGAGAAGCTGTAAGCTA-3’;
forward
reverse
TTATGTGTTCCAGGAACTCAGAGAA-3’,
TAATACCCAAGTTGATAGTCGATAAGTTTG-3’;
forward
reverse
human
primer
primer
forward
5’5’-
primer
TLR9
5’5’-
primer
TLR8
5’5’-
primer
TLR7
human
primer
primer
5’-
GTGCCCCACTTCTCCATG-3’, reverse primer 5’-GGCACAGTCATG ATGTTGTTG-3’;
human IL-6 forward primer 5’-GGTACATCCTCGACGGCATCT-3’, reverse primer 5’GTGCCTCTTTGCTGCTTTCAC-3’;
human
ATGCCCCAAGCTGAGAACCA-3’,
forward
reverse
ATGACTTCCAAGCTGGCCGTGGCT-3’,
TCTCAGCCCTCTTCAAAACTTCTC-3’;
IL-8
human
IL-10
reverse
primer
primer
forward
5’5’-
primer
5’5’-
primer
CTGCTCCACGGCCTTGCTCTTGTT-3’. Control GAPDH mRNA was amplified with the
forward primer GAPDH-F 5’-GAAGGTGAAGGTCGGAGTC-3’ and the reverse primer
GAPDH-R 5’-GAAGATGGTGATGGGATTTC-3’. PCR products were resolved in 1% or 2%
agarose gels.
2.3 RNAi and ssRNA synthesis.
The oligonucleotide-directed production of small RNA transcripts with T7 RNA
polymerase has been described [20]. For in vitro transcription, 45-nt DNA template
oligonucleotides
5′-
(PBS-as:
AAAGTGGCGCCCGAACAGGGACCTATAGTGAGTCGTATTACC-3′
AAGGTCCCTGTTCGGGCGCCACCTATAGTGAGTCGTATTACC-3′)
and
and
PBS-s:
5′-
T7-si
5′-
GGTATTACGACTCACTATAGG-3′ oligonucleotide were designed to produce 21-nt
siRNAs. The T7-si oligonucleotide was annealed to each of the other oligonucleotides in
equimolar amounts in siRNA annealing buffer (10 mM Tris–HCl, pH 8, 100 mM NaCl) by
heating at 95°C for 2 min followed by slow cooling to room temperature over 1 h. The
annealed oligonucleotides were transcribed in vitro using the T7-MEGAshortscript High
Yield Transcription Kit (Ambion, Austin, TX, US) overnight at 37°C. DNase I was added to
the transcription mixture which were incubated for 15 min at 37°C. The RNA was ethanol
precipitated and resuspended in siRNA annealing buffer. Single-stranded RNAs were
annealed to their complimentary RNA (antisense and sense strands) by heating to 95°C
for 2 min and cooling to room temperature over 1 h. Double-stranded RNAs were purified
on a 12% nondenaturing polyacrylamide gel run at 4°C and eluted overnight. Purified
products were ethanol precipitated and resuspended in 20 μl siRNA annealing buffer.
ssRNA
(UACCAGGUAAUGUACCACGACUUACGUCGUGUGUUUCUCUGGUUUGCU
UCUAGUGUG) was in vitro transcribed by using the MEGAshortscript High Yield
Transcription Kit (Ambion) according to the manufacturer’s specification. The resulting
ssRNA was extracted with phenol/chloroform followed by ethanol precipitation.
2.4 One-step multiplex RT-PCR conditions.
Five gene-specific primers for IL-8, OAS2, IFNα, and ISG56 were designed based on
Primer 3 program (www-genome.wi.mit.edu) to amplify fragments of 373 bp (IFNα), 505bp
(OAS2), 137 bp (ISG56), 292 bp (IL-8) ; these were then evaluated separately and in a
multiplex format. The primer pairs were: IFNα gene (NM_002173), IFNα-F: 5’TTTCTCCTGCCTGAAGGACAG-3’ and IFNα-R:
or IFNβ gene (NM_002176), 5’IFNβ-F:
5’-TCTCATGATTTCTGCTCTGACA-3’
5’-CCTGTGGCAATTGAATGGGAGGC-3’ and
3’IFNβ-R: 5’-CCAGGCACAGTGACTGTCCTCCTT-3’; OAS2 gene (NM_002535), OAS2F:
5’-TGGCTCCTATGGACGGAAAACAGT-3’
TGTTCCCAGGCATACACCGTA-3’;
ISG56
gene
and
(NM_001548)
OAS2-R:
,
ISG56-F:
5’5’-
CTTGAGCCTCCTTGGGTTCG-3’ and ISG56-R: 5’-GCTGATATCTGGGTGCCTAAGG-3’;
IL-8 gene (NM_000584.2), IL-8F: 5’-ATGACTTCCAAGCTGGCCGTGGCT-3’ and IL-8R:
5’-TCTCAGCCCTCTTCAAAACTTCTC-3’. To test for possible repetitive sequences, the
selected primers were aligned with the sequence databases at the National Center for
Biotechnology Information (NCBI) using the Basic Local Alignment Search Tool (BLAST)
family of programs, to rule out non-specific binding to other human targets. One-tube RTPCR was performed using the SuperScript™ One-Step RT-PCR Kit with Platinum® Taq
(Invitrogen). The 25 μl reaction mix consisted of: 12.5 μl of 2X reaction buffer, 1 μl
RT/Platinum Taq Mix, 1 µg total RNA, 5 pmoles each GAPDH primers, 5 pmoles each
IFNα or IFNβ primers, 5 pmol each ISG56 primers, 20 pmol each OAS2 primers and 10
pmol each IL-8 primers, 2 mM MgCl2 and 0.8 µg/µl BSA. The optimized thermal profile
included a reverse transcription step at 55°C for 30 min, followed by a denaturation step at
95°C for 3 min, the amplification was performed during 40 cycles including denaturation
(94°C for 30 sec), annealing (55°C for 30 sec) and extension (68°C for 40 sec) and was
concluded by a final extension step at 68°C for 10 min and hold at 4°C. After PCR
amplification, 5 μl of PCR products were mixed with loading dye and subjected to 2%
agarose gel electrophoresis at 100 volts for 45 min. After electrophoresis, the agarose gel
was stained with 10% ethidium bromide solution for 10 min and visualized on an UV
transilluminator.
3. Results
3.1 Expression of TLR3, TLR7, TLR8 and TLR9 in different cell lines.
The transcription levels of TLR3, TLR7, TLR8 and TLR9 was examined in HEK
293T, U87CD4CXCR4 and Namalwa cells. For this purpose a semi quantitative RT-PCR
analysis of the mRNAs of TLR3, TLR7, TLR8 and TLR9 receptors from total RNA
extracted from these human cell lines was performed. Results shown on figure 1 indicate
that each of the tested cell lines expressed at different levels the different tested receptors
involved in the recognition of nucleic acids. While the U87CD4CXCR4 cells constitutively
expressed TLR3 (lane 2) and almost undetectable levels of TLR9 mRNA (lane 8), the
Nawalwa cell line constitutively express the TLR7 receptor (lane 4) and TLR9 (lane 8). No
expression of any of the tested receptors was observed when testing the HEK 293T cell
line. These results imply that these cells should respond differently when they are treated
with nucleic acids.
3.2 Induction of IL-8 gene expression in HEK 293T/hTLR9 cells by CpG DNA
It has been shown that CpG ODNs are also capable of stimulating the release of
cytokines IL-6, IL-8 and IL-10 in immune system cells [21; 22]. To determine if the HEK
293T cells stably expressing human TLR9 (HEK 293T/hTLR9) could be used to analyze
the immunogenicity of CpG ODN we test the effects of CpG ODNs on IL-6, IL-8 and IL-10
mRNA levels in Nawalma and HEK 293T/hTLR9 cells. These cell lines were incubated
with the immunostimulatory class B CpG ODN 2006, and the mRNA levels of the
mentioned cytokines were determined by semi quantitative RT-PCR (Fig. 2). We note that
unlike the IL-6 and IL-10, IL-8 was induced in HEK 293T/hTLR9 cells stably expressing the
human TLR9 when stimulated with a class B CpG ODN. For this reason, we included the
detection of IL-8 gene in this multiplex RT-PCR method for analyzing the stimulation of the
innate immune response by nucleic acids. These results demonstrate that a cell line that
does not belong to the immune system also responds to exogenous nucleic acids when
expressing a TLR that recognizes nucleic acids. Therefore, cells that do not belong to the
immune system expressing TLR9 can be used to determine whether a particular CpG
ODN is able to induce an innate immune response.
3.3 Optimisation of multiplex RT-PCR
In order to rapidly and effectively evaluate the cellular response, induction of
interferon and/or inflammatory cytokines, to the presence of exogenous nucleic acids we
have developed a multiplex RT-PCR procedure. The multiplex RT-PCR assay was
evaluated in terms of specificity and accuracy to ensure the efficiency of the technique.
The developed assay allows the simultaneous analysis of expression of the IFNα or IFNβ
(data no shown), OAS2, ISG56 genes involved in the interferon response and the proinflamatory cytokine IL-8 gene, plus the GAPDH as internal reference gene. IFNα, ISG56,
OAS2 genes are highly sensitive to the activation of the interferon response to nucleic
acids and can be expressed in all cell types except for B lymphocytes, which do not induce
the expression of ISG56 [23; 24; 25; 26].
Optimisation of the PCR conditions was essential for achieving reliable
amplification. The multiplex RT-PCR conditions were tested and optimised in terms of
annealing temperature (ranging from 50°C to 60°C) profile, extension temperature (ranging
from 65°C to 72°C) and magnesium concentration (ranging from 1 to 5 mM). A large
number of primer pairs were tested and their final optimal concentration (ranging from 0.04
- 0.8 μM) established empirically, varied considerably among the targeting gene to be
amplified. Despite other possible RT-PCR conditions we defined the ones described under
material and methods as optimum conditions for the efficient and reliable simultaneous
detection of the five mentioned genes in a single reaction tube. Since it has been
previously described that BSA, in concentrations up to 0.8 μg/µl increased the efficiency of
the PCR much more than either DMSO or glycerol [27], the concentration of BSA was also
optimized. A 0.8 μg/μl BSA concentration in the reaction mix did not show any negative
effect on any of the amplified loci (data not shown). The GAPDH message was used as
internal control because its level in tissue culture cells is independent of the degree of
confluence of the cell culture and is constant upon a variety of different treatments [28].
The only system in which GAPDH would not serve as an internal control is adipocyte
differentiation where GAPDH is transcriptionally regulated [29]. The lack of GADPH
amplification might indicate that the sample contains any RT-PCR inhibitory agent or low
integrity of the extracted RNA.
3.4 Multiplex RT-PCR procedure to detect interferon and inflammatory stress
response.
Once the PCR conditions were established and optimized, different samples were
analyzed. Results of applying the multiplex RT-PCR in a single step to samples of total
RNA extracted 24 hours after transfection from various cell lines (HEK 293T, 293T/hTLR9,
U87CD4CXCR4 and Namalwa) treated with various types of nucleic acids (ssRNA ,
dsRNA, siRNA and OD-2006) using primers specific for IFNα, ISG56, OAS2, IL-8 and
GADPH genes are shown in figure 3. All treated cell lines yielded at least a specific
amplicon of the expected size corresponding to one of the tested genes. The results also
showed that the GAPDH gene was amplified in all samples, indicating the integrity of the
RNA and the proficiency of the various reactions. Non unspecific PCR product was
detected. As expected, untreated cells do not express genes involved in the activation of
interferon response or IL-8 (Lanes 1, 4, 6 and 7). HEK 293T cells do not express TLR3,
TLR7, TLR8 or TLR9 (Fig.1). However, when they are stimulated with exogenous ssRNA
(lane 2) or dsRNA (lane 3) induces interferon response which can be detected by the
multiplex RT-PCR. Therefore this method can detect innate immune system activation in
those cells lacking the TLRs involved in the recognition nucleic acids. U87CD4CXCR4 and
HEK 293T cells have a different pattern of gene expression when stimulated with ssRNA
(compare lanes 2 and 9) as occurs with HEK 293T/hTLR9 and Namalwa cells when they
are stimulated with OD 2006 (compare lanes 5 and 7). All these data indicate that this
multiplex RT-PCR is capable of detecting activation of the immune response due to
stimulation with nucleic acids in different cell types.
No discrepancies were observed when a monospecific RT-PCR for each gene,
using only the specific primer pair under the same conditions, was performed showing that
no interference occurred in the multiplex RT-PCR (data not shown). Basal and induced
levels of IFNα or IFNβ, ISG56, OAS2 and IL-8 may vary among different human cell lines,
and even in a cell line depending on the growth conditions. Thus, it is critical to include a
non-induced control that is treated exactly the same way as the tested samples (mock
transfection control).
4. Discussion
The achievements during the last 30 years in the development of nucleic acid tools
as specific gene suppressors has lead to a great increase in the number of attempts aimed
to use the nucleic acids as inhibitors of gene expression or as therapeutic agents.
However, immune stimulation and the induction of interferon and the inflammatory
response by nucleic acids provide not only the potential for strong nonspecific effects with
respect to target gene expression and function, but the result in significant toxicities when
these molecules are administered in vivo. In addition, the development of an efficient
strategy based on inhibitor nucleic acids requires the existence of highly sensitive tests
that unequivocally confirm that the inhibitory or therapeutic effect is a direct action of the
nucleic acid and no a side effect due to nonspecific activation of an innate immune
response release through TLR 3, 7, 8 and 9 or cytoplasmic receptors. Therefore it is
recommended testing for interferon induction before attributing a particular response to a
gene targeted nucleic acid. We have designed a one-step multiplex RT-PCR method to
ensure whether synthetic CpG ODN, ssRNA and synthetic or plasmid-expressed siRNA
induce interferon-related responses and/or proinflammatory cytokine release when
introduced in the cell system of choice. Three classes of synthetic CpG ODNs; class A, B
and C, activate human immune cells through TLR9 [21]; [22]. Recognition of synthetic
CpG-ODNs through TLR9 has been shown to induce inflammatory response. Moreover, Aand C-class induce high levels of IFNα. In contrast, B-class ODNs preferentially induce
inflammatory cytokines IL-6, IL-8 and IL-10 production but are relatively poor inducers of
IFNα release. For this reason, we include the detection of the IL-8 gene expression in this
method. The inclusion of the detection of this gene is a great advantage because it
broadens the spectrum of cell types to which this method can be applied and to determine
whether a particular CpG ODN is immunostimulatory without using immune system cells.
Therefore, this multiplex RT-PCR might be applied to any cell treated with nucleic acids.
Also, our procedure can be used to assess the effects of reagents (such as transfection
reagents) and other procedural steps that may produce, enhance, or otherwise affect
cellular interferon responses. The advantage of multiplex RT-PCR is that this assay
comprises more than one primer set in a single reaction for detecting the presence of
multiple target genes. This allows to reduced the amount of sample to be used that might
be very limited and therefore of great value. It also allows reducing the manipulation
minimizing the risk of contamination; it is less time-consuming and also reduced the cost of
the analysis in comparison to other approaches based on monospecific gene amplification.
To our knowledge this is the first report describing the use of a four primer pairs multiplex
set for one step RT-PCR in a single tube for immune genes detection. We also observed
here that expression of human TLR9 is correlated with CpG-DNA responsiveness in HEK
293T cells. Therefore, transfection of TLR9 into nonresponsive cells reconstitutes the
immunostimulatory CpG-DNA response.
5. Conclusions
The one-step multiplex RT-PCR method described for the analysis of the
stimulation of the innate immune response by nucleic acids is advantageous because it is
rapid, specific, sensitive, reproducible and cost effective allowing the simultaneous
detection of five genes in a single reaction. This method allows evaluating different nucleic
acid molecules, currently used for therapeutic or gene silencing approaches. Furthermore,
as an internal reference control and to prevent false negative results it uses the detection
of the gene GAPDH because its level of expression in culture cells is independent of the
degree of cell confluence and it is constant under different treatments. Moreover, this
method could be useful to determine the minimal concentration of nucleic acid able to
induce interferon response. Therefore, this method could be used routinely in biological
and clinical research laboratories to test activation of interferon and/or inflammatory stress
related pathways of cells by the introduction of nucleic acids for knockdown gene or
therapeutic applications.
Acknowledgements
We would like to thank Dr. Sánchez-Luque for helpful comments and to Vicente AugustinVacas for excellent technical assistance. This work was supported by grants BFU200908137 and BFU2012-31213 from the Spanish Ministerio de Ciencia e Innovación, and
grant 36472/05 from FIPSE to A. B-H. J.A.R-D. was funded by grant 36472/05 from
FIPSE. Work at our laboratory is partially supported by FEDER funds from the EU.
References
[1]
Y. Dorsett, T. Tuschl
siRNAs: applications in functional genomics and potential as therapeutics
Nat Rev Drug Discov, 3 (2004), pp. 318-329.
[2]
L. Alexopoulou, A.C. Holt, R. Medzhitov, and R.A. Flavell
Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like
receptor 3
Nature, 413 (2001), pp. 732-738
[3]
S.S. Diebold, T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa
Innate antiviral responses by means of TLR7-mediated recognition of singlestranded RNA
Science, 303 (2004), pp. 1529-1531
[4]
F. Heil, H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira, G.
Lipford, H. Wagner, and S. Bauer
Species-specific recognition of single-stranded RNA via toll-like receptor 7
and 8
Science, 303 (2004), pp. 1526-1529
[5]
D.H. Kim, M. Longo, Y. Han, P. Lundberg, E. Cantin, and J.J. Rossi
Interferon induction by siRNAs and ssRNAs synthesized by phage
polymerase
Nat Biotechnol, 22 (2004), pp. 321-325
[6]
A.M. Krieg
CpG motifs in bacterial DNA and their immune effects
Annu Rev Immunol, 20 (2002), pp. 709-760
[7]
A.M. Krieg, A.K. Yi, S. Matson, T.J. Waldschmidt, G.A. Bishop, R. Teasdale, G.A.
Koretzky, and D.M. Klinman
CpG motifs in bacterial DNA trigger direct B-cell activation
Nature, 374 (1995), pp. 546-549
[8]
M. Schlee, W. Barchet, V. Hornung, and G. Hartmann
Beyond double-stranded RNA-type I IFN induction by 3pRNA and other viral
nucleic acids
Curr Top Microbiol Immunol, 316 (2007), pp. 207-230
[9]
K. Takeda, and S. Akira
Toll receptors and pathogen resistance
Cell Microbiol, 5 (2003), pp. 143-153.
[10]
J. Lee, T.H. Chuang, V. Redecke, L. She, P.M. Pitha, D.A. Carson, E. Raz, and
H.B. Cottam
Molecular basis for the immunostimulatory activity of guanine nucleoside
analogs: activation of Toll-like receptor 7
Proc Natl Acad Sci U S A, 100 (2003), pp. 6646-651
[11]
H. Hemmi, O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K.
Hoshino, H. Wagner, K. Takeda, and S. Akira, A
Toll-like receptor recognizes bacterial DNA
Nature, 408 (2000), pp. 740-745
[12]
T.H. Flo, O. Halaas, S. Torp, L. Ryan, E. Lien, B. Dybdahl, A. Sundan, and T.
Espevik
Differential expression of Toll-like receptor 2 in human cells
J Leukoc Biol, 69 (2001), pp. 474-481
[13]
I. Kokkinopoulos, W.J. Jordan, and M.A. Ritter
Toll-like receptor mRNA expression patterns in human dendritic cells and
monocytes
Mol Immunol, 42 (2005), pp. 957-968
[14]
M. Muzio, D. Bosisio, N. Polentarutti, G. D'Amico, A. Stoppacciaro, R. Mancinelli, C.
van't Veer, G. Penton-Rol, L.P. Ruco, P. Allavena, and A. Mantovani
Differential expression and regulation of toll-like receptors (TLR) in human
leukocytes: selective expression of TLR3 in dendritic cells
J Immunol, 164 (2000), pp. 5998-6004
[15]
K.A. Zarember, and P.J. Godowski
Tissue expression of human Toll-like receptors and differential regulation of
Toll-like receptor mRNAs in leukocytes in response to microbes, their
products, and cytokines
J Immunol, 168 (2002), pp. 554-561
[16]
A. Thomas, C. Laxton, J. Rodman, N. Myangar, N. Horscroft, and T. Parkinson
Investigating Toll-like receptor agonists for potential to treat hepatitis C virus
infection
Antimicrob Agents Chemother, 51 (2007), pp. 2969-2978
[17]
L. Jozsef, T. Khreiss, D. El Kebir, and J.G. Filep
Activation of TLR-9 induces IL-8 secretion through peroxynitrite signaling in
human neutrophils
J Immunol, 176 (2006), pp. 1195-1202
[18]
V. Fensterl, and G.C. Sen
The ISG56/IFIT1 gene family
J Interferon Cytokine Res, 31 (2011), pp. 71-78
[19]
T. Gondai, K. Yamaguchi, N. Miyano-Kurosaki, Y. Habu, and H. Takaku
Short-hairpin RNAs synthesized by T7 phage polymerase do not induce
interferon
Nucleic Acids Res, 36 (2008), pp. e18
[20]
J.F. Milligan, and O.C. Uhlenbeck
Synthesis of small RNAs using T7 RNA polymerase
Methods Enzymol, 180 (1989) pp. 51-62
[21]
J. Vollmer, R. Weeratna, P. Payette, M. Jurk, C. Schetter, M. Laucht, T. Wader, S.
Tluk, M. Liu, H.L. Davis, and A.M. Krieg
Characterization of three CpG oligodeoxynucleotide classes with distinct
immunostimulatory activities
Eur J Immunol, 34 (2004), pp. 251-262
[22]
S. Agrawal, and E.R. Kandimalla
Synthetic agonists of Toll-like receptors 7, 8 and 9
Biochem Soc Trans, 35 (2007), pp. 1461-1467
[23]
S.D. Der, A. Zhou, B.R. Williams, and R.H. Silverman
Identification of genes differentially regulated by interferon alpha, beta, or
gamma using oligonucleotide arrays
Proc Natl Acad Sci U S A, 95 (1998), pp. 15623-15628
[24]
Y. Li, C. Li, P. Xue, B. Zhong, A.P. Mao, Y. Ran, H. Chen, Y.Y. Wang, F. Yang, and
H.B. Shu
ISG56 is a negative-feedback regulator of virus-triggered signaling and
cellular antiviral response
Proc Natl Acad Sci U S A,106 (2009), pp.7945-7950
[25]
A.J. Sadler, and B.R. Williams
Interferon-inducible antiviral effectors
Nat Rev Immunol, 8 (2008), pp. 559-568
[26]
C.A. Sledz, M. Holko, M.J. de Veer, R.H. Silverman, and B.R. Williams
Activation of the interferon system by short-interfering RNAs
Nat Cell Biol, 5 (2003), pp. 834-839
[27]
O. Henegariu, N.A. Heerema, S.R. Dlouhy, G.H. Vance, and P.H. Vogt
Multiplex PCR: critical parameters and step-by-step protocol
Biotechniques, 23 (1997), pp. 504-511
[28]
G.S. Dveksler, A.A. Basile, and C.W. Dieffenbach
Analysis
of
gene
expression:
use
of
oligonucleotide
primers
for
glyceraldehyde-3-phosphate dehydrogenase
PCR Methods Appl, 1 (1992), pp. 283-285
[29]
D.M. Alexander M, Galli R, Kahn B, and Nasrin N
Tissue specific regulation of the glyceraldehyde-3-phosphate dehydrogenase
gene by insulin correlates with the induction of an insulin-sensitive
transcription factor during differentiation of 3T3 adipocytes
UCLA Symposium Mol. Cell. Biol., New Series, 132 (1990), pp. 247–261
Figure legends
Figure 1. Analysis of TLR3, TLR7, TLR8 and TLR9 genes expression in HEK 293T,
U87CD4CXCR4 and Namalwa cells. Total RNA was extracted from HEK 293T,
U87CD4CRCX4 and Namalwa cell lines, and TLR3 (lane 2), TLR7 (lane 4), TLR8 (lane 6)
and TLR9 (lane 8) mRNAs were individually examined by RT-PCR. GAPDH mRNA was
used as internal reaction control. Genomic DNA of each cell line is included as a positive
control of the PCR amplification reaction (lanes 1, 3, 5 and 7). A 100-bp DNA ladder was
used as the DNA size marker (Lane M). Size, in bp, of interesting DNA marker fragments
are shown on the right.
Figure 2. Analysis of IL-6, IL8 and IL-10 gene expression in HEK 293T/hTLR9 and
Namalwa cell lines. Total RNA was isolated from HEK 293T/hTLR9 and Namalwa cells
24 hours after incubation with 2.5 µM CpG ODN class B (OD2006) and IL-6, IL-8 and IL-10
mRNAs were individually examined by RT-PCR. Amplification products were resolved on 1
or 2 % TAE agarose gels. Detection of the cellular GAPDH gene was used as internal RTPCR reaction control. (-), RT-PCR of total RNA extracted from untransfected cells.
Figure 3. Stimulation of interferon response and inflammatory stress detected in
four human cell lines by exogenous nucleic acids. Lane 1, untransfected HEK 293T
cell line (control). Lane 2, HEK 293T cell line transfected with 0.5 ug of ssRNA. Lane 3,
HEK 293T cell line transfected with 0.5 ug of dsRNA. Lane 4, HEK 293T cell line stably
expressing TLR9 (HEK 293T/hTLR9; control). Lane 5, HEK 293T/hTLR9 cell line,
stimulated with 2.5 µM CpG ODN class B (OD2006). Lane 6, Namalwa cell line
unstimulated (control). Lane 7, Namalwa cell line stimulated with 2.5 µM of CpG ODN
class B (OD2006). Lane 8, U87CD4CXCR4 untransfected cell line (control). Lane 9,
U87CD4CXCR4 cell line was transfected with 0.5 ug of ssRNA. Total RNA was isolated
from each of the cells described 24 hours after the transfection or stimulation. The three
genes mediated interferon response (ISG56, IFNα, OAS2), the proinflammatory interleukin
(IL-8), and the internal referent control of the reaction (GAPDH) were amplified
simultaneously by RT-PCR in a single reaction mixture. All products were of the expected
size. The transcription levels are determined by comparison with those obtained for the
referent control gene. Lane M, 100-bp DNA ladder used as molecular size marker. Sizes,
in bp, of selected DNA marker fragments are shown on the right.