Download incidence and detection of aviadenoviruses of serotypes 1 and 5 in

Bull Vet Inst Pulawy 54, 451-455, 2010
INCIDENCE AND DETECTION OF AVIADENOVIRUSES
OF SEROTYPES 1 AND 5 IN POULTRY
BY PCR AND DUPLEX PCR
JOWITA SAMANTA NICZYPORUK, ELŻBIETA SAMOREK-SALAMONOWICZ,
AND HANNA CZEKAJ
Department of Poultry Viral Diseases,
National Veterinary Research Institute, 24-100 Pulawy, Poland
[email protected]
Received for publication July 19, 2010
Abstract
The aim of the study was to develop and optimise a single PCR and duplex PCR for the detection and differentiation of
avian adenovirus serotypes 1 and 5 in poultry. The methods were based on sequence of hexon gene of the serotypes. The PCR and
duplex PCR DNA products were 227 pb and 178 bp for serotypes 1 and 5, respectively, and were highly specific. The duplex-PCR
method was found to be a highly specific, sensitive, and efficient rapid tool for the detection of serotypes 1 and 5 of adenoviruses,
which could be detected in one reaction mixture. During this study, 30 of the isolates obtained from internal organs of healthy birds
contained both serotypes of the adenovirus. In the case of six isolates, both serotypes were detected in one bird.
Key words: avian adenoviruses, PCR, duplex PCR.
Adenoviruses are icosahedral non-enveloped
dsDNA viruses with capsid of 74-80 nm in diameter,
constructed by 252 capsomers, which surround the core
of 60-65 nm in diameter. The main protein of the
adenovirus capsid is the hexon protein, which creates
240 trimers and is responsible for the serological
differentiation. This protein is 2,800-2,900 bp long with
the molecular weight of 103 kDa. It is characterised by a
great changeability and is the main protein playing a role
in determination of virus antigenic state. Hexon consists
of conservative and variable domains. The conservative
domains are responsible for creating basement of the
molecules and are responsible for the trimer formation.
The highly variable domains are placed mainly outside
of the virion and are responsible for antigenic variation
of adenovirus (5, 11, 15).
Aviadenoviruses are divided into three groups.
Group I is additionally divided in to five subgroups (AE), containing together 12 serotypes. This group is most
numerous and the viruses belonging to it cause IBH inclusion body hepatitis in chickens. Group II contains
viruses, which are responsible for haemorrhagic enteritis
in turkeys, marble spleen disease in pheasants, and
hydropericardium hepatitis syndrome (4), whereas group
III includes virus inducing egg drop syndrome 76 (3, 5).
Adenoviral infections can be found as asymptomatic and
can be a complication factor in the course of different
diseases (11).
Nowadays, molecular diagnostic methods
applied to detect and identify adenoviral infections are
based on the virus isolation and serological methods
such as: AGID, ELISA, and SN (12). Because of the
nucleotide sequence variability of hexon gene, there is a
possibility to differentiate several serotypes of
adenoviruses from group I by PCR and its modifications
(5, 8).
The aim of the study was to evaluate the PCR
and duplex PCR methods of detection and
differentiation of aviadenoviruses, and to estimate the
occurrence of these viruses in chicken flocks in Poland.
Material and Methods
Virus standards. Standard aviadenoviruses
(FAdV), belonging to serotypes 1 and 5 were obtained
as lyophilisates from the Charles River Laboratory
(USA). Strains were grown in chicken embryo kidney
(CEK) cultures.
CEK cultures. CEK cultures were prepared
from 18-19-d old SPF chicken embryos (Lohman,
Germany) according to standard procedure. Growth
medium constituted Eagle’a medium (MEM) with
addition of 10% of bovine serum and 0.1% of antibiotic
mixture (Antibiotic–Antimycotic, Gibco). Maintenance
medium consisted of MEM with 0.1% of antibiotic
mixture. Monolayer of chicken embryo kidney culture
was obtained after 48 h incubation period at 37.5°C.
Isolation of adenoviruses from birds. Blood
and tissues from the liver and intestines were collected
during anatomopathological examination of 162 healthy
birds originating from 54 reproductive and slaughter
flocks. After the homogenisation, triple freeze and
thaw, centrifugation, and filtering through the Millipore
452
filter with pores of 450 nm in diameter, the CEK
monolayer was infected with the collected materials.
The infected cultures were incubated at 37.5°C and
observed under the microscope day by day. Three
passages of isolated viruses were obtained.
Agar gel precipitation (AGP). The sera and
the virus material from the 3rd passage in CEK by micro
method in 1.5% agar with addition of 8% of NaCl,
according to standard procedure, were examined using
immunoreagents (Charles River Laboratories, USA). As
a negative control, serum from SPF chickens and noninfected CEK cells were used. After 24-48 h incubation
at 18°C-25°C, the presence of precipitation lines
between the examined samples and antigen confirmed
positive results of this method.
DNA isolation. Total DNA was isolated from
chicken embryo kidney cells infected with standard or
field serotypes of adenoviruses. The isolation was
performed according to commercial procedure using
DNA Mini Kit (Qiagen, Germany). The DNA samples
were also collected from the liver and intestines of
healthy birds. Isolates of DNA were preserved in -20°C
for the next step of the study.
PCR positive control. Total DNA positive
control was obtained from the reference serotypes 1 and
5 of adenovirus propagated in CEK cell cultures. The
negative control was the total DNA isolated from noninfected CEK cells.
Primers. The sequences of nucleotide primers
for serotype 1 were: FAdV 1A (sense primer):
5’TTCGAGATCAAGAGGCCAGT3’ and FAdV 1B
(antisense primer) 5’GGTCGAAGTTGCGTAGGAAG’
3. In order to detect serotype 5, sequences of the used
primers were as follows: FAdV 5A (sense primer)
5’TACTGCCGTTTCCACATTCA 3’ and FAdV 5B
(antisense primer): 5’ AGCTGATTGCTGGTGTTGTG
3’. The oligonucleotide primers were designed in Primer
3 programme according to Genebank, and were
synthesised in the Institute of Biochemistry and
Biophysics PAN in Warsaw.
PCR. The reaction of amplification was
conducted in Basic gradient thermocycler (Biometra,
Germany) in the final volume of 25 µl of reaction mix.
The mixture contained: 2.5 µl of PCR buffer, 1 µl of
dNTP (10 mM), 1.5 µl of each pair of primers, 4 µl of
total DNA isolated from serotype 1, and 11.5 µl of
sterile water. After the pre-denaturation at 95°C for 5
min, the denaturation was performed at 94°C for 45 s,
the primers annealing was at 61°C for 1 min, the chain
elongation was at 72°C for 2 min, and the final
elongation at 72°C for 10 min. In total 35 replication
cycles were performed.
PCR product analysis. After the reaction of
amplification, the electrophoresis was conducted in 2%
agarose gel with 1µg/mL of ethidium bromide in Mini
Sub-Cell (Biorad, USA). Electrophoresis process was
conducted in Tris-borate-EDTA buffer, pH 8.2, (150 V
and 80 mA) for 50 min. After the electrophoresis, the
size of the amplification products was compared with
the DNA Mass Ruller 1,031 bp (Fermatas). The results
were visualised using transiluminator UV, and then
photographed and analysed. The results were positive
when the obtained product had predicted size for pair of
nucleotide primers.
Specificity of reaction. Total DNA from
standard serotypes of Marek’s disease virus (MDV),
infectious laryngotracheitis virus (ILTV), and chicken
anaemia virus (CAV) derived from the commercial
vaccines were used to determine the specificity of the
reaction.
Method sensitivity. Method sensitivity was
defined using tenfold dilutions of whole cell DNA
isolated from CEK cells infected with standard serotypes
of adenoviruses, which correspond to DNA
concentrations of 10 up to 0.0001 ng/µL.
Results
PCR. The appropriate PCR parameters were
chosen for serotypes 1 and 5 of adenoviruses. The
optimal concentration of polymerase was detected in
volume of 2.0 µl (5 u/µL). The volume of the whole cell
DNA was optimal at 2.0 µl of DNA for serotypes 1 and
5, with 10 ng/µL concentration. The primers were the
most effective at 1.5 µl with 10 ng/µL concentration. At
61°C, PCR products of standard serotypes 1 and 5
corresponded with the predicted size of 178 bp for
serotype 1 and 227 bp for serotype 5. No PCR product
was observed in case of negative control at temperature
parameter described above. No products were observed
for DNA samples of MDV, CAV, and ILTV.
In the next step, the sensitivity of the method
was examined. The method sensitivity, described as the
highest dilution of DNA in which a positive result was
present, was 0.0001 ng/µL DNA for serotype 1 (Fig.1)
and for serotype 5 (Fig. 2).
Isolation and serological identification of
adenoviruses. AGP was performed with serum of 162
healthy birds. The specific antibodies against
adenoviruses were detected in 30 (18.5%) blood
samples. The samples from the liver and intestines of
birds with positive sera in AGP were used for the
infection of CEK cells and isolation of adenoviruses.
The first changes in the infected cell cultures were
observed after 24-36 h of incubation. The cells were
bigger, rounder, and filled with granules. During next
few days, the number of cells with cytopathic effect
(CPE) increased and the cells formed foci. When it was
recognised in 80% of the cells, supernatant from cell
cultures was collected to prepare next passage. The
material from the 3rd passage was treated as an antigen
for AGP with positive standard serum (Charles River
Laboratories, USA) and was used as detection method
for the identification of group antigen of the
adenoviruses. Thirty virus isolates were obtained, which
caused CPE in CEK cell cultures and showed a positive
reaction in AGP test.
453
M
1
2
3
4
5
6
7
Fig. 1. The sensitivity of PCR. M-Mass Ruller 1,031 bp (Fermantas), 1-6 appropriate dilutions (10; 1; 0.1; 0.01; 0.001;
and 0.0001 ng/µL of DNA) of 10 ng/µL of DNA of serotype 1, corresponding to concentrations of 10 ng/µL; 1 ng/ µL;
0.1 ng/ µL; 0.01 ng/ µL; 0.001 ng/ µL; and 0.0001 ng/µL of total DNA isolated from infected chicken embryo kidneys
(CEK) of serotype 1.
M
1
2
3
4
5
6
7
Fig. 2. The sensitivity of single PCR. M-Mass Ruller 1,031 bp (Fermantas), 1-6 appropriate dilutions (10; 1; 0.1 ; 0.01;
0.001; and 0.0001 ng/µL of DNA) of 10 ng/µL DNA of serotype 5, corresponding to concentration of total DNA
isolated from infected chicken embryo kidneys (CEK) - 10 ng/µL; 1 ng/ µL; 0.1 ng/ µL; 0.01 ng/ µL; 0.001 ng/ µL;
0.0001 ng/µL of serotype 5.
M
1
2
3
4
5
6
7
8
9
10
11
12
M
Fig. 3. Duplex PCR field samples. M- Mass Ruller 1,031 bp DNA Ladder (Fermentas). Lanes 1, 2 - field samples as a
dual infection with serotypes 1 and 5, lanes 3, 4 - field samples infected with serotype 1, lanes 5, 10 - field samples
infected with serotype 5, lanes 11 - K+ positive control, lane 12 - K- negative control.
454
M
1
2
3
4
5
were fully confirmed with the single PCR used for
separate serotypes.
Discussion
Fig. 4. The sensitivity of duplex PCR. M-Mass Ruller
1,031 bp (Fermantas), 1-6 appropriate dilutions (10; 1;
0.1; 0.01; and 0.001 ng/µL of DNA) of 10 ng/µL DNA
of serotype 1 and serotype 5, corresponding to
concentration of total DNA isolated from infected
chicken embryo kidneys (CEK) - 10 ng/µL; 1 ng/ µL;
0.1 ng/ µL; 0.01 ng/ µL; and 0.001 ng/ µL of serotypes 1
and 5.
Identification of isolated serotypes by PCR.
Thirty virus samples isolated from CEK cell cultures,
identified as adenoviruses by serologic method, were
used in PCR for the detection of viruses that belong to
serotype 1. During electrophoresis, the presence of 178
bp product specific for serotype 1 was indentified in 11
examined samples. In the next step, PCR was performed
with specific primers for the detection of serotype 5. In
25 samples, 227 bp product was observed, which was
characteristic for viruses representing serotype 5. In six
samples, positive results in the first and second reactions
were obtained, which indicated simultaneous appearance
of both serotypes in one sample.
Development of duplex PCR. Because of the
presence of two different adenovirus serotypes in one
sample, a duplex PCR method, which allows the
detection of genetic material of the viruses in one
reaction mixture, was developed and optimised. The
parameters of the reaction were similar as in case of
single reaction of amplification for one serotype. In the
study, the temperature of 61°C for 1min was used for
primer annealing and duplex PCR was performed with
different amplification cycles: 25, 30, 35, and 40. The
bands of most effective PCR products were obtained
within 35 cycles of amplification. Characteristic
products for positive control, with the size of 178 bp for
serotype 1 and 227 bp for serotype 5, as well as both
products for the mixture serotypes 1 and 5 were
observed. Products of PCR amplification from serotypes
1 and 5 in the examined samples were demonstrated by
electrophoresis and photographed. The exemplary
examined probes were presented on Fig. 3. The
characteristic product of reaction for serotype 1 was
observed in 11 samples, and serotype 5 was confirmed
in 19 samples. Both serotypes were present in six
samples simultaneously. No bands were observed in
negative control samples. Results of these reactions
Adenovirus infections can cause a serious
problem in Poland and in the World’s husbandry.
Because of the possibility of existing of simultaneous
infection with few adenovirus serotypes, it is necessary
to create fast and sensitive diagnostic method (5, 16,
18). Serotype 1 is the most common serotype of
adenoviruses and is the model adenovirus, which served
as the basis for the description of the genome structure
(2, 13).
Fatal adenovirus disease in broiler chickens,
described as gizzard erosion and ulceration, caused
mostly by serotype 1, was reported during the last years
(13, 14). In Poland, for the first time, the infection was
described in September 2007 (9).
In the clinical case of inclusion body hepatitis
(IBH), the first isolated serotype was adenovirus
serotype 5. However, serotypes 2 and 8 were the most
commonly isolated serotypes from the cases of IBH (11,
17). For this reason, a molecular diagnostic technique
based on PCR was developed and optimised for useful
and reliable detection of adenovirus serotypes 1 and 5.
The conservative fragment of the gene coding hexon
was used to develop oligonucleotide primers. As the
hexon gene is the longest gene in the adenovirus genome
and contains conservative and variable sequence, it was
possible to create specific oligonucleotide primers to
differentiate serotypes 1 and 5. They allow detection of
a specific fragment of the hexon gene and create a
product size of 178 bp for serotypes 1 and of 227 bp for
serotype 5. The differences in the amplification product
size allow also creating duplex PCR, useful for the
detection and identification of adenoviruses serotypes in
one reaction mixture. The developed duplex PCR
method was sensitive and allowed the detection of 0.001
ng of viral DNA (Fig. 4).
PCR method for the detection of adenoviruses
in poultry was described for the first time by Jiang et al.
(8). The sensitivity of their method allowed the detection
of 0.01 ng of virus DNA. Other researchers described
reaction of amplification to detect haemorrhagic enteritis
virus in turkeys caused by the virus from group II of
adenoviruses (6, 10).
Okuda et al. (14) developed and optimised PCR
and performed restriction product analysis for the
detection of serotype 1. This method provides
differentiation of species of adenoviruses from serotype
1, which is the cause of gizzard erosion and ulceration,
from the serotypes 1, which are not the reason of these
lesions in broilers. PCR and restriction analysis method
were designed also to detect adenoviral inclusion body
hepatitis in chickens (5). Girgić et al. (7) developed PCR
method for identification of serotype 9 of adenoviruses
and this method has been used for the determination of
vertical transmission of the virus.
The multiplex PCR method for the detection
and simultaneous identification of aviadenoviruses from
455
group I, avian reovirus, infectious bursal disease virus,
and chicken anaemia virus was developed and optimised
by Caterina et al. (1).The sensitivity of this method for
aviadenoviruses was evaluated as 10 pg (0.01ng) of
virus DNA
In conclusion, the developed duplex PCR for
simultaneous identification of serotypes 1 and 5 is a
highly specific and sensitive method. The examination
of 30 field isolates of aviadenoviruses derived from
healthy birds confirmed the presence of these serotypes.
Additionally, both serotypes were demonstrated in six
field samples. The PCR and duplex PCR can be used
successfully for the identification of adenovirus
infection in birds.
References
1.
2.
3.
4.
5.
6.
Caterina K.M., Salwatore F.J., Girshick T., Khan M.I.:
Development of a multiplex PCR for detection of avian
adenovirus, avian reovirus, infectious bursal disease virus,
and chicken anemia virus. Mol Cell Probes 2004, 18, 293298.
Chiocca S., Kurzbauer R., Schaffner G., Baker A.,
Mautner V.: The complete DNA sequence and genomic
organization of the avian adenovirus CELO. J Virol 1996,
70, 2939-2949.
Dhinakar R.G., Sivakumar S., Matheswaran K.,
Chandrasekhar M., Thiagarajan V., Nachimuthu K.:
Detection of egg drop syndrome virus antigen or genome
by enzyme-linked immunosorbent assay or polymerase
chain reaction. Avian Pathol 2003, 32, 545-550.
Geanesh K., Suryanarayana V.V., Raghavan R.: Detection
of fowl adenovirus associated with hydropericardium
hepatitis syndrome by polymerase chain reaction. Vet Res
Commun 2002, 26, 73-80.
Hess M.: Detection and differentiation of avian
adenoviruses: a review. Avian Pathol 2000, 29, 195-206.
Hess M., Raue R., Hafez H.M.: PCR for specific detection
of hemorrhagic enteritis virus of turkeys an avian
adenovirus. J Virol Methods 1999, 81, 199-203.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Grgić H., Philippe C., Ojkić D., Nagy E.: Study of vertical
transmission of fowl adenoviruses. Can J Vet Res 2006,
70, 230-233.
Jiang P., Ojkic D., Tuboly T., Huber P., Nagy E.:
Application of the polymerase chain reaction to detect
fowl adenowiruses. Can J Vet Res 1999, 63, 124-128.
Mamczur J., Szeptycki J., Hess M., Houszka M.,
Szeleszczuk P., Bartoszkiewicz J.: Pierwsze rozpoznane w
kraju przypadki adenowirusowej choroby kurcząt. Pol
Drob 2008, 10, 37-39.
Mazur-Lech B., Koncicki A., Janta M.: Investigations on
using a polymerase chain reaction (PCR) to detect and
evaluate the distribution of haemorrhagic enteritis virus in
turkeys. Medycyna Wet 2009, 65, 413-415.
McConnell B. A., Fitzgerald A. S.: Group I - Adenovirus
Infections. Disease of Poultry. Ed. Y.M. Saif, Blackwell
Publishing Professional, Iowa State Press, Ames, USA,
2008, pp. 252-266.
Mockett A.P., Cook J.K.A.: The use of an enzyme-linked
immunosorbent assay to detect IgG antibodies to serotypespecific and group-specific antigens of fowl adenovirus
serotypes 2, 3 and 4. J Virol Methods 1983, 7, 327-335.
Payet V., Arnauld C., Picault C.J.P., Jestin A., Langlois
P.: Transcriptional organization of the avian adenovirus
CELO. J Virol 1998, 72, 9278-9285.
Okuda Y., Ono M., Shibata I., Sato S., Akashi H.:
Comparison of the polymerase chain reaction restriction
fragment length polymorphism pattern of the fiber gene
and pathogenicity of serotype-1 fowl adenovirus isolates
from gizzard erosions and from feces of clinically healthy
chickens in Japan. J Vet Diagn Invest 2006, 18, 162-167.
Roberts M.M., White J.L., Grutter M.G., Burnett R.M.:
Three-dimensional structure of the adenovirus major coat
protein hexon. Science 1986, 232, 1148-1151.
Romanowa N., Corredor J.C., Nagy E.: Detection and
quantification of fowl adenovirus genome by a real-time
PCR assay. J Virol Methods 2009, 159, 58-63.
Singh A., Oberoi M.S., Grewal G.S., Hafez H. M., Hess
M.: The use of PCR combined with restriction enzyme
analysis to characterize fowl adenovirus field isolates
from northern India. Vet Res Commun 2002, 26, 577-585.
Xie Z., Fadl A.A., Grishick T., Khan M.I.: Detection of
avian adenoviruses by polymerase chain reaction. Avian
Dis 1999, 43, 98-105.