Download Biol 178 Study Guide for the Molecular Genetics

Biol 178
Study Guide for the Molecular Genetics Exam
Spring 2008
The study guide given below contains material you can expect on the exam.
Sample Fill in the Blanks
1. ____________________________
2. ____________________________
3. ____________________________
4. ____________________________
5. ____________________________
.
6. ____________________________
7. ____________________________
These viruses were used by Hershey & Chase in the 1950’s and
now they are used to build genomic libraries.
This molecule is the genetic material for all cellular organisms.
Watson and Crick developed a model of DNA in which the two
strands twist into the shape of a __
The expression of a gene involves two phases with this phase
occurring in the nucleus of eukaryotic cells.
Transcription begins at a RNA polymerase-binding site called the
Most eukaryotic genes (or mRNA) contain coding sequences
called __ interspersed with noncoding sequences.
Enzymes that cleave DNA at specific sites are called
8. ____________________________
Viruses and bacterial plasmids are used as ___ to insert foreign
DNA into host cells.
9. ____________________________ ___is a process that separates DNA fragments according to their
size, by causing them to migrate within a gel.
10. ___________________________ The technique is used to increase or amplify the amount of DNA
is called
Sample Short Answer questions. Plan to answer questions such as those given below in the form
of complete, grammatically correct sentences.
1. How did the Griffith Experiments on bacterial transformation contribute to our understanding of DNA as
the genetic material?
2. How did the Hershey & Chase Experiments on bacteriophage replication contribute to our
understanding of DNA as the genetic material?
3. DNA is a polymer of nucleotides. What is a nucleotide?
4. What is a nitrogenous base?
5. What nitrogenous bases are unique to DNA? RNA?
6. What nitrogenous bases are present in both DNA and RNA?
7. How did Franklin’s studies of DNA contribute to our understanding of DNA as the genetic material?
8. How did Chargaff’s studies of DNA contribute to our understanding of DNA as the genetic material?
9. Watson and Crick proposed the structure of DNA and called it a double helix. Comment on the
following properties of this model:
a. Why is it double?
b. Why is it a helix?
c. What are complementary nitrogenous bases in this model of DNA?
d. What is a sugar-phosphate backbone?
e. What is antiparallel?
10. Explain “semi-conservative” in the context of DNA synthesis?
11. DNA replication is both continuous and discontinuous. What does this mean?
12. What is an Okazaki fragment and why are they formed during DNA synthesis?
13. DNA synthesis requires several enzyme. It is not necessary to memorize the enzymes, but why are
many enzymes required for DNA synthesis? In other words, why doesn’t a cell simply use one enzyme
(DNA polymerase) to make daughter strands of DNA?
14. DNA synthesis in eukaryotes uses replication forks. What is a replication fork?
15. What are telomeres and where are they located?
16. In 1952 Briggs and King took a diploid nucleus from a developed frog cell and inserted it into an egg
cell from which the nucleus had been destroyed. Occasionally, a fully-formed adult frog developed. How
did this study contribute to our understanding of DNA?
`
Page 1 of 9
B178S08Exam04-01MolecularGeneticsStudyGuide
Biol 178
Study Guide for the Molecular Genetics Exam
Spring 2008
17. What is Neurospora? How did the studies of Beadle and Tatum on nutritional mutants in Neurospora
contribute to our understanding of DNA? In other words, what is the meaning of the “one gene-one
enzyme” hypothesis?
18. What is the central dogma of molecular biology? What is gene expression? Note: Both questions
have the same answer.
19. What is transcription? Translation?
20. The genetic code is called a “triplet” code. What does this mean?
21. What are the characteristics of the genetic code?
22. Where does RNA synthesis occur in a eukaryotic cell?
23. RNA synthesis consists of initiation, elongation and termination. What does this mean?
24. Why is a “promoter” important for RNA synthesis?
25. Like DNA, ribonucleic acid is a polymer of nucleotides. How is an RNA nucleotide different from
those found in DNA?
26. What is the role of tRNA? mRNA?
27. Protein synthesis (translation) could be summarized in four stages: Initiation, Elongation &
Translocation and Termination. What happens during these stages?
28. What is genetic engineering?
29. What is recombinant DNA?
30. What two enzymes are critical to the construction of recombinant DNA and what do they do? What is
a restriction enzyme (or restriction endonuclease)?
31. What is a vector? What is a plasmid? What is a phage?
32. What does the word “host” mean regarding the storage of recombinant DNA?
33. A DNA library stores the genome of a species. What is a genome and what is a DNA library?
34. Prokaryotic DNA does not contain introns and exons. Since introns are present in eukaryotic DNA,
explain how a eukaryotic gene can be used in a transgenic bacterial cell to synthesize a protein
ordinarily made from eukaryotic DNA. Hint: The enzyme reverse transcriptase is very important.
35. What is the polymerase chain reaction (PCR)?
36. What is an RFLP and what is the importance of an RFLP in DND fingerprinting?
37. What is gel electrophoresis and how is it used in DNA fingerprinting?
38. Recombinant DNA has been successfully introduced into the cells of plants, animals and
microorganisms. Almost always, the recombinant DNA is introduced to synthesize a protein. The same
applies to gene therapy, where a “good” gene is used to replace a defective gene to overcome a
genetic disorder. No question here, just observations.
39. What is a mutation?
40. What does ultraviolet light (UV) do to DNA and why is this potentially harmful?
41. What do many chemicals in cigarette smoke do to DNA and why is this potentially harmful?
42. What is one of the most common carcinogenic substances responsible for many different types of
cancer?
43 A normal DNA segment and the same segment containing a mutation are given below in Figure 1.
Consider the 3’ Æ 5’ DNA (left to right) the template strand and ignore stop and start codons. Here’s
what must be done to answer this question:
First, convert the 3’ to 5’ DNA sequence to an mRNA sequence (i.e. transcribe the molecule). Second,
read the mRNA molecule in a 5’ to 3’ direction for the codons contained in it and translate the codons
using the genetic code (see the last page) into a sequence of amino acids (i.e. translate the mRNA).
Figure 1: DNA segments
Normal DNA
Mutated DNA (Note G:C at third base pair from left.)
5’—CCATGCTTC—3’
5’—CCGTGCTT C—3’
3’—GGTACGAAG—5’
3’—GGCACGAAG—5’
A. Give the resulting amino acid sequence for both DNA segments:
Normal DNA______________________________ Mutated DNA _______________________________
B. How would you explain your answer knowing that mutations cause differences in gene expression?
`
Page 2 of 9
B178S08Exam04-01MolecularGeneticsStudyGuide
Biol 178
Study Guide for the Molecular Genetics Exam
Spring 2008
Figure 2: A 6.85 kb (6,850 bases = 6850) fragment of DNA is shown below. The locations of several
restriction sites are indicated. Eco RI, PstI and BamHI are different restriction endonucleases with
different cutting sites. Eco RI(1) is the first site cut in this DNA fragment and the first nitrogen base located
there is arbitrarily designated #1. Numbers in parentheses refer to the location of the cutting site related
to Eco R1 on the left side. For example, BAM HI (2854) is located 2,854 base pairs away from the Eco
RI(1) cutting site. Use this information to answer the next three questions.
44. (see Figure 2) If you were to digest this fragment of DNA using only Pst I, how many pieces of DNA
would you obtain?
A. 1
B. 2
C. 3
D. 4
45. (see Figure 2) If you were to use both Bam HI and Eco RI, what is the size of the DNA fragment that
would migrate the fastest on an agarose gel?
A. 803 b
B. 1038 b
C. 1816 b
D. 1713 b
E. 6850 b
46. (see Figure 2) DNA fragments separated by gel electrophoresis can be denatured to form singlestranded DNA, then some of the single-stranded DNA can be blotted onto a sheet of filter paper. A
radioactive probe of single stranded DNA can be incubated with the DNA on the filter paper to identify
complementary sequences. This technique is called Southern blot analysis. In a first attempt at Southern
blot analysis, you wish to construct a probe. To do this, you digest the above piece of DNA with Pst I and
isolate a 2622 kb Pst I fragment. You radiolabel the fragment and use it to probe a Southern blot of the
same DNA as above (in Figure 2), but one that has been digested with Eco RI. Which of the following
DNA fragments does your probe detect?
A. 235 b
B. 2622 b
C. 1038 b, 2285 b, 3529 b
D. 1038 b, 3529 b
47. (see Figure 6) Based on the evidence in the fingerprint, who is
guilty? Note: Sperm DNA in Figure 3 was collected from a female
victim of rape.
Figure 6: DNA
fingerprint from a
rape case.
A. Suspect 1
B. Suspect 2
C. inconclusive because the sperm DNA may be from the husband.
`
Page 3 of 9
B178S08Exam04-01MolecularGeneticsStudyGuide
Biol 178
Study Guide for the Molecular Genetics Exam
Spring 2008
Sample Multiple Choice Questions
1. DNA consists of two antiparallel strands of nucleotide chains held together by
A. peptide bonds.
B. polar covalent bonds.
C. ionic bonds.
D. hydrogen bonds.
E. complementary base pairing bonds.
2. Hershey-Chase concluded from their experiment with T2 bacteriophage that
A. proteins are the genetic material.
B. polysaccharide coat contains the genetic material.
C. DNA is the genetic material.
D. viruses are needed for DNA to function.
E. DNA contains sulfur.
3. Which of the following is not a component of nucleic acids?
A. organic nitrogen bases
B. sugar
C. phosphate
D. protein
4. Chargaff's rules for the pairing of nitrogen bases is
A. A = T and G = C.
B. A pairs with T and G pairs with C.
C. A pairs with G and C pairs with T.
D. A pairs with C and G pairs with T.
E. T = C and G = A.
5. DNA is a double helix because it contains two
A. antiparallel phosphate groups
B. sugars
D. pairs of complementary nitrogen bases
E. helixes
C. polynucleotide chains
6. The DNA molecule contain nitrogen bases which are
A. identical.
B. parallel.
C. complementary.
D. the same in all species.
E. exact copies of the protein they make.
7. During replication of DNA, the lagging strand is replicated with short stretches of Okazaki fragments.
That is why this aspect of DNA synthesis is considered to be
A. discontinuous.
B. continuous. C. primed.
D. never stopping.
E. semiconservative.
8. The double helix model of DNA was proposed by
A. Watson and Crick.
B. Griffith.
C. Avery.
D. Franklin.
E. Beadle and Tatum.
9. Fourteen percent of the DNA nucleotides from a certain organism contain T. What amounts of the other
bases would you expect to be present in this particular DNA?
A. 14 % A, 0% C, 36 % G
B. 14 % A, 36 % C, 14 % G
C. 14 % A, 36 % C, 36 % G
D. 14 % T, 38 % C, 36 % G
E. 14 % T, 36 % C, 36 % U
10. When DNA is replicated during S of the cell cycle, the sequence of nitrogen bases is maintained but
the double strand is not. Each strand of the original double strand accompanies its new strand. This
process is known as
A. disruptive DNA replication.
B. conservative DNA replication.
C. semiconservative DNA replication.
D. dispersive DNA replication.
11. Which of the following choices is the correct sequence for DNA replication in E. coli?
A. initiation, termination, elongation
B. initiation, elongation, termination
C. elongation, termination, initiation
D. elongation, initiation, termination
12. DNA synthesis requires several enzymes. The enzyme responsible for adding free nucleotides to the
growing chain of DNA would be
A. Ligase
B. Gyrase
C. Helicase
D. DNA polymerase III
E. DNA Replicase
`
Page 4 of 9
B178S08Exam04-01MolecularGeneticsStudyGuide
Biol 178
Study Guide for the Molecular Genetics Exam
13. Which of the following DNA sequences is complementary to
A. 5' ATGGTCAGT 3'
B. 5' TGACTGGTA 3'
C. 5' TACCAGTCA 3'
D. 5' ACTGACCAT 3'
Spring 2008
5' ATGGTCAGT 3'?
14. After a long week of sunbathing on the beach, what type of DNA damage might you be concerned
about?
A. photolyase-induced mutations
B. decreased telomere length
C. thymine dimers
D. protein mutation
15. The connection that exists between genes and hereditary traits requires the deciphering of the
information encoded in genes into
A. polysaccharides
B. nucleotides.
C. proteins.
D. histone molecules.
E. complementary bases.
16. Both DNA and RNA are made up of building blocks known as
A. nucleotides.
B. complementary base pairs.
C. amino acids.
D. genes.
17. Which of the following is not true about eukaryotic DNA?
A. It is an exceedingly long and fragile molecule.
B. It is packaged into successively compact formations.
C. The entire molecule has encoded information for protein synthesis.
D. In the condensed form, it is transcriptionally inactive.
E. It must be unpackaged before it can be transcribed into RNA.
18. While study Neurospora genetics and the biosynthetic pathway for arginine synthesis, the "one geneone enzyme" hypothesis was proposed by
A. Watson and Crick. B. Griffith.
C. Garrod.
D. Franklin.
E. Beadle and Tatum.
19. Which of the following statements is true regarding telomeres and telomeric DNA?
A. Telomeres are short-repeated sequences of DNA located at the tips of chromosomes.
B. A gradual shortening of chromosome telomeric DNA occurs in somatic cells.
C. Cell aging seems to be correlated with shortening telomeres.
D. A & B
E. A, B & C
20. Gene expression includes which two of the following processes?
A. transcription and replication
B. replication and repression
C. protein synthesis and replication
D. mutation and cell division
E. transcription and translation
21. The enzyme that initiates transcription is
A. RNA polymerase.
B. DNA polymerase.
C. carbonic anhydrase.
D. ATP synthetase.
E. transformation principle.
22. The number of nucleotides required to specify an amino acid in a codon is
A. 1.
B. 2.
C. 3. D. 4. E. a variable number.
23. The genetic code operates on all the following principles except
A. four nucleotide bases are used.
B. each combination of any three nucleotides is a codon.
C. the first nucleotide in every codon is always the same.
D. a particular codon always specifies the same amino acid.
24. How many unique mRNA codons can be constructed from four different RNA nucleotides?
A. 4
B. 8
C. 16 D. 32 E. 64
`
Page 5 of 9
B178S08Exam04-01MolecularGeneticsStudyGuide
Biol 178
Study Guide for the Molecular Genetics Exam
25. The 3-nucleotide sequence of an mRNA is called the
A. codon.
B. anticodon. C. amino acid. D. transcript.
Spring 2008
E. template.
26. Protein synthesis proceeds by the ribosome
A. alternating between many chains.
B. moving three nucleotides at a time on the mRNA.
C. attaching amino acids in a random fashion.
D. selecting the tRNA molecule that fits.
E. attaching amino acids to the growing chain without charged tRNAs.
27. During protein synthesis, the bond that forms between the newly added amino acid and the previous
amino acid on the chain is called a
A. hydrogen bond.
B. hydrophobic bond.
C. hydrophilic bond.
D. phosphodiester bond.
E. peptide bond.
28. The different components of the protein synthesizing machinery include all of the following except
A. mRNA.
B. tRNA.
C. ribosomes. D. amino acids.
E. RNA polymerase.
29. Eukaryotic mRNA molecules are occasionally interspersed with non-coding sequences that must be
removed before protein synthesis. These non-coding sequences are called
A. anticodons. B. introns.
C. exons.
D. nucleosomes.
E. chromomeres.
30. In eukaryotes, mRNA processing involves all of the following events except
A. synthesis with reverse transcriptase B. addition of a 5' cap. C. addition of poly A to the 3' end.
D. mRNA splicing.
E. association with the spliceosome.
31. If the sequence of bases in a section of DNA is ATCGCTCC, what is the corresponding sequence of
bases in mRNA?
A. ATCCGATT B. TAGGCUGG
C. UAGCGAGG
D. TATCGGCC
E. AUCCGAUU
32. Most of the beneficial products produced by bacteria and other genetically modified organisms
containing recombinant DNA are
A. lipids
B. carbohydrates
C. proteins
D. other nucleic acids
33. Eukaryotic organisms and prokaryotic organisms differ in how gene information is processed. Select
the statement that best explains this difference.
A. Prokaryote genes are transcribed into mRNA, which is translated immediately. Eukaryote genes
contain long sequences of nucleotides that do not code for amino acids and have to be removed from the
primary transcript.
B. Prokaryote genes are transcribed directly into a polypeptide, while eukaryote genes have mRNA and
tRNA involved in polypeptide assembly.
C. Prokaryote genes are translated before being transcribed into mRNA. Eukaryotic genes are
transcribed into mRNA and then translated.
D. Prokaryote genes are edited of all introns before being transcribed into mRNA, while eukaryotic genes
are edited after mRNA formation.
34. Transcription is the first stage in the Central Dogma. Transcription is initiated by
A. DNA polymerase binding to the promoter.
B. RNA polymerase binding to the promoter.
C. mRNA polymerase binding to the promoter.
D. tRNA polymerase binding to the promoter.
35. Why are there only 45 different tRNA anticodons rather than 64 to match each of the mRNA codons?
A. The first nucleotide of a tRNA anticodon allows some flexibility or "wobble."
B. The second nucleotide of a tRNA anticodon allows some flexibility or "wobble."
C. The third nucleotide of a tRNA anticodon allows some flexibility or "wobble."
D. The remaining 19 tRNA anticodons are used for initiation and termination of protein synthesis.
`
Page 6 of 9
B178S08Exam04-01MolecularGeneticsStudyGuide
Biol 178
Study Guide for the Molecular Genetics Exam
Spring 2008
36. Xeroderma Pigmentosum (XP) is a rare autosomal recessive disorder. Patients with XP exhibit a
cellular hypersensitivity to ultraviolet (UV) radiation, a high incidence of skin cancer and premature aging.
Based on these clinical characteristics, what is the underlying cause for this disease?
A. defects in DNA repair
B. defects in DNA replication
C. lack of telomerase activity
D. shortened telomeres
Figure 1: Consider the following sequence of nitrogen bases in mRNA for the next three questions.
NOTE: Refer to the genetic code at the end of this exam. Count the amino acid methionine (with the start
codon) as the first amino acid.
5'AUGGCUACAGAUAGCUGGGGCUGAUAA3'
37. (see Figure 1) After translation of the mRNA in Figure 1, the corresponding protein would contain
how many amino acids? (Note: UAA is a Stop codon.)
A. 5
B. 6
C. 7
D. 8
E. 9
38. (see Figure 1) What is the anticodon for the fourth codon?
A. AGC
B. CUA
C. GAU
D. UCG
39. (see Figure 1) What would happen to the protein being synthesized if the third base of the third codon
was replaced with the nitrogen base U?
A. The final protein would have different amino acids after the second codon, but it would still be the
same length as the original.
B. The final protein would be shorter because of the insertion of a stop codon.
C. The ribosome would stop protein synthesis, mRNA would be degraded and a protein would not be
synthesized.
D. Nothing, the same protein would be synthesized.
40. If you wanted to block transcription of a group of functionally related genes in a prokaryote, you could
place an obstacle
A. upstream of both the promoter and operon.
B. downstream of both the promoter and operon.
C. place an obstacle downstream of the promoter, but upstream of the operon.
D. place an obstacle upstream of the promoter, but downstream of the operon.
41. DNA can be cleaved at specific sites, generating smaller DNA fragments with short single-stranded
ends. The chemical tool used to cleave the DNA is called a(n)
A. hybridization enzyme.
B. complementary enzyme.
C. restriction endonuclease.
D. methylating enzyme.
E. endonuclease.
42. Restriction enzymes recognize DNA sequences that are
A. A-T rich.
B. C-G rich.
C. palindromes.
D. complementary.
43. Genetically modified crops have been produced for
A. herbicide (e.g. glyphosate) resistance
B. insect resistance (Bt crops)
C. enhanced longevity
D. enhanced nutritional value
E. sticky.
E. all of the above
44. When electrical current is applied during a gel electrophoresis procedure, the DNA fragments move
because they are charged, but they separate based on differences in their
A. electrical charge
B. poly-A tails
C. response to the staining chemicals used during the procedure.
D. size
E. enzyme binding activity sites.
`
Page 7 of 9
B178S08Exam04-01MolecularGeneticsStudyGuide
Biol 178
Study Guide for the Molecular Genetics Exam
Spring 2008
45. Scientists can distinguish between DNA of different individuals, thus making this information useful in
criminal investigations. The technique of DNA fingerprinting takes advantage of differences in DNA called
A. restriction fragment length polymorphisms.
B. transposons
C. hybrid polymorphisms.
D. Southern Blot.
E. genetic engineering.
46. Clinical trials of gene therapy attempt to
A. change the gametes of individuals with genetic disorders.
B. introduce normal genes to replace defective genes.
C. introduce normal proteins to replace those that can’t be synthesized
D. using PCR to study genetic disorders
E. clone the perfect human being.
47. A vector "carries" ___ into a host cell.
A. a recombinant RNA fragment
B. a recombinant DNA molecule
C. an endonuclease
D. glyphosate chains
E. "sticky" ended metabolites of X-gal degradation
48) Any change in the nucleotide sequence of DNA is called a(n)
A) anticodon. B) advantage. C) mutation
D) codon.
E) transition.
49) A normal regulatory gene that has the potential to cause cancer if it should mutate is called a(n)
A) enhancer gene.
B) proto-oncogene
C) carcinogen
D) oncogene.
50. Which of the following has been linked to producing carcinogens and many different types of cancer?
A. High dietary fat
B. Ultraviolet light
C. Table salt
D. Cigarette smoke
`
Page 8 of 9
B178S08Exam04-01MolecularGeneticsStudyGuide
Biol 178
Study Guide for the Molecular Genetics Exam
Spring 2008
Sample Essay: Discuss the Central Dogma of Biology. DO NOT discuss DNA synthesis in your answer. No
credit will be given for drawings, diagrams or outlines. Write clearly and use complete, grammatically correct
sentences.
`
Page 9 of 9
B178S08Exam04-01MolecularGeneticsStudyGuide