Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Drug discovery wikipedia , lookup
Drug design wikipedia , lookup
Drug interaction wikipedia , lookup
Pharmacokinetics wikipedia , lookup
Cannabinoid receptor antagonist wikipedia , lookup
Pharmacogenomics wikipedia , lookup
Discovery and development of angiotensin receptor blockers wikipedia , lookup
Neuropsychopharmacology wikipedia , lookup
NK1 receptor antagonist wikipedia , lookup
Psychopharmacology wikipedia , lookup
Molecular Psychiatry (1997) 2, 490–494 1997 Stockton Press All rights reserved 1359–4184/97 $12.00 ORIGINAL RESEARCH ARTICLE response to endogenous opioids and exogenous opiates can now be investigated. m opioid receptor gene variants: lack of association with alcohol dependence Ninety-one percent (1093 base pairs) of the OPRM1 coding sequence and an additional 1479 bases of intronic and untranslated sequence (Exon 2, IVS 2, Exon 3 and 3′UTR) were determined in 30 chromosomes and the 5′UTR and Exon 1 alone were determined in an additional 104 chromosomes (Figure 1). Four nucleotide variants (+17C/T, +118A/G, +440C/G (relative to the ATG) and IVS2+691C/G) were observed and these variants result in three amino acid substitutions (Ala6Val, Asn40Asp and Ser147Cys). The Ala6Val and Ser147Cys variants were rare and were observed in 2/134 chromosomes (0.015%) and in 3/1062 chromosomes (0.0028%), but were not characterized further. However, the Asn40Asp and IVS2+691 polymorphisms were moderately to highly abundant, about °11% and °60% in Caucasians. In each population, the frequencies of +118A/G and IVS2+691 genotypes did not differ significantly from Hardy–Weinberg expectation. The Ala6Val, Asn40Asp, Ser147Cys and IVS2+691G/C sequence variants are the first alleles of the human m opioid receptor gene to be identified in population samples. Direct sequencing and PCR-RFLP genotyping suggest that eight out of the nine sequence differences observed among the three extant OPRM1 cDNA sequences available in public databases are sequencing artifacts or rare haplotypes. The Asp40 allele is a common and non-conservative substitution of a phylogenetically conserved asparagine, the fourth of five asparagine residues in the amino terminal, extracellular domain of the m opioid receptor. While the amino terminus of the rat MOR1 protein has been shown not to be necessary for ligand binding or ligand-mediated inhibition of forskolin-stimulated cAMP accumulation,16,17 substitution of this phylogenetically conserved asparagine might be expected to affect protein transport and expression level at the cell surface due to changes in glycosylation.18–20 Increased m opioid receptor radioligand binding after chronic naloxone treatment is not associated with an increase in OPRM1 mRNA,21 suggesting that another regulatory mechanism is responsible for the increased binding. On the basis of sequence conservation among human and rodent opioid receptors,22 effects of the Ser147Cys variant on m opioid receptor function might be expected, while no effects of the Ala6Val variant would be expected. The opioidergic hypothesis suggested a test of association between alleles, genotypes and haplotypes at the OPRM1 locus and alcohol dependence categories, DSM-III-R lifetime alcohol dependence with and without drug abuse and dependence diagnoses (Tables 1 and 2). In the USC sample, alcohol dependence alone was used in a test for association at the OPRM1 locus due to small cell numbers (Table 1). In the FC sample, the larger number of drug disorder diagnoses permitted two tests, first alcohol dependence vs unaffected and second, a comparison of alcohol dependence with and without drug abuse and dependence diagnoses and unaffected. The category of drug abuse and depen- AW Bergen1, J Kokoszka1, R Peterson1, JC Long1, M Virkkunen 2, M Linnoila3 and D Goldman1 1 Laboratory of Neurogenetics, National Institute on Alcohol Abuse and Alcoholism, 12501 Washington Avenue, Flow Bldg, Room 2, Rockville, Maryland 20852, USA; 2 Department of Psychiatry, University of Helsinki, Lapinlandentie 1, 001810 Helsinki 18, Finland; 3Laboratory of Clinical Studies, National Institute on Alcohol Abuse and Alcoholism, Building 10, Room 3C-103, Bethesda, Maryland 20892, USA Keywords: OPRM1; m opioid receptor; polymorphism; alcoholism; substance abuse The m opioid receptor is implicated in the reward, tolerance and withdrawal effects of alcohol and other drugs of abuse.1,2 This hypothesis is supported by the effects of alcohol on beta-endorphin release,3 of m opioid receptor agonists and antagonists on alcohol consumption,4,5 and by the activation of the dopaminergic reward system by both alcohol and opiates.6 In addition, the murine m opioid receptor locus, Oprm, is implicated as the major quantitative trait locus (QTL) affecting the different levels of morphine consumption between two inbred mouse strains that also exhibit differences in alcohol and cocaine consumption. 7,8 Detection of genetic variation affecting OPRM1 expression or m opioid receptor function would be an important step towards understanding the origins of inter-individual variation in response to m opioid receptor ligands and in diseases of substance dependence.9–12 We directly sequenced the human m opioid receptor locus, OPRM1,13–15 to detect natural variation that might affect function and/or be associated with psychiatric phenotypes related to opioid function. Four DNA sequence variants were found: three non-synonymous substitutions (Ala6Val [rare], Asn40Asp, [0.10–0.16], Ser147Cys [rare]) and one intronic variant (IVS2+691G/C [0.55–0.63]). OPRM1 alleles, genotypes and haplotypes from three psychiatrically characterized population samples (US Caucasian [USC, n = 100], Finnish Caucasian [FC, n = 324] and Southwestern American Indian [SAI, n = 367]), were used to perform association and sib-pair linkage analyses with alcohol and drug dependence diagnoses. No significant association of OPRM1 genetic variation to phenotype was observed. This analysis has 80% power to detect a small to moderate effect of OPRM1 variation on alcohol dependence and 100% power to detect effects of the magnitude of the ALDH2*2 variant. While these data do not support a role of the m opioid receptor in susceptibility to alcohol dependence, the potential relationship between OPRM1 genetic variation and OPRM1 variants and alcohol dependence AW Bergen et al 491 Figure 1 Direct sequencing screen of the OPRM1 locus. The domains of the m opioid receptor (MOR) protein screened include the entire amino terminal extracellular domain (ECD1), 80% of the first transmembrane domain (TM1), 50% of first cytoplasmic loop (CD1), the entire second through seventh transmembrane domains and intervening extracellular and cytoplasmic loops and 65% of the carboxyterminal cytoplasmic domain (376/400 amino acids). This direct sequencing screen of the OPRM1 locus also included a portion of the promoter (37 bases), the entire 2nd intron (773 bases) and a portion of the 3′UTR (669 bases). The base pair (bp) designations are relative to the start codon. PCR and sequencing primers are indicated by horizontal arrows and sequence variation by vertical arrows and shaded blocks within the locus schema. Hash marks (//) represent unscreened regions of the OPRM1 locus. Table 1 OPRM1 genetic variation (genotype and allele frequency) and dependence phenotype in USC, FC and SAI population samples Population/phenotype Genotype Asn40/Asp40 Allele Asn40/Asp40 691G/C 691G/C n 1/1 1/2 2/2 1/1 1/2 2/2 1 2 1 2 US Caucasians Alcohol Dep Unaffected Total χ2= 20 80 100 0.950 0.750 0.790 0.050 0.250 0.210 0.000 0.000 0.000 0.213 0.150 0.138 0.140 0.550 0.450 0.470 0.300 0.413 0.390 0.001 0.975 0.875 0.895 0.025 0.125 0.105 3.405 0.425 0.363 0.375 0.575 0.638 0.625 0.533 Finnish Caucasians Alcohol Dep Unaffected Total χ2= 140 184 324 0.743 0.783 0.765 0.243 0.212 0.225 0.014 0.005 0.009 1.174 0.164 0.152 0.157 0.457 0.533 0.500 0.379 0.315 0.343 1.911 0.864 0.889 0.878 0.136 0.111 0.122 0.877 0.393 0.418 0.407 0.607 0.582 0.593 0.432 Indians 238 0.681 129 0.744 367 0.703 0.286 0.233 0.267 0.034 0.023 0.030 2.731 0.185 0.209 0.193 0.529 0.512 0.523 0.286 0.279 0.283 0.792 0.824 0.860 0.837 0.176 0.140 0.163 1.669 0.450 0.465 0.455 0.550 0.535 0.545 0.163 52 88 182 322 0.827 0.693 0.780 0.764 0.173 0.284 0.214 0.227 0.000 0.023 0.005 0.009 5.440 0.154 0.170 0.154 0.158 0.481 0.443 0.533 0.500 0.365 0.386 0.313 0.342 2.146 0.913 0.835 0.887 0.877 0.087 0.165 0.113 0.123 6.132 0.394 0.392 0.420 0.408 0.606 0.608 0.580 0.592 0.496 Indians 122 116 21 108 367 0.656 0.707 0.905 0.713 0.703 0.311 0.259 0.048 0.269 0.267 0.033 0.034 0.048 0.019 0.030 7.143 0.180 0.190 0.095 0.231 0.193 0.525 0.534 0.619 0.491 0.523 0.295 0.276 0.286 0.278 0.283 2.681 0.811 0.836 0.929 0.847 0.837 0.189 0.164 0.071 0.153 0.163 3.902 0.443 0.457 0.405 0.477 0.455 0.557 0.543 0.595 0.523 0.545 0.997 Southwest American Alcohol Dep Unaffected Total χ2= Finnish Caucasians Alc Dep + Drug Alc Dep − Drug Unaffected Total χ2= Southwest American Alc Dep + Drug Alc Dep − Drug Drug alone Unaffected Total χ2= * All P values nonsignificant (P.0.05). OPRM1 variants and alcohol dependence AW Bergen et al 492 Table 2 Sib-pair linkage and regression of OPRM1 Asn40/Asp40 and IVS2+691C/G alleles to alcohol dependence and drug abuse and dependence in the SAI population sample Alcohol dependence Drug dependence Sib-pair linkage P-value Pairs Sib-pair type Pairs Alleles i.b.d. Std Err Asn40/Asp40 Unaffected Discordant Affected 37 87 97 0.510 0.495 0.500 0.024 0.016 0.016 0.332 0.380 0.498 IVS2+691C/G Unaffected Discordant Affected 36 88 94 0.485 0.485 0.510 0.032 0.020 0.020 1.000 0.229 0.308 Asn40/Asp40 IVS2+691G/C D.F. 136 136 Mean p 0.500 0.496 T-value −0.379 −0.678 dence (drug disorder) alone without alcohol dependence was discarded in this sample because the n was 2. In the SAI sample, the same two tests were used, and a sufficient number of drug disorder patients without alcohol dependence was available (n = 21) to include this category in the second analysis. Also in the SAI sample, sib-pair linkage analysis was used to test for association between genotype and alcohol dependence and drug disorder diagnoses (Table 2). No significant association or linkage between OPRM1 alleles, OPRM1 genotype or OPRM1 haplotype (data not shown) to any disorder category was observed in the three population samples. Human and animal studies implicate the opioid system in both initial sensitivity or response to alcohol and in the reinforcing effects of alcohol, which have been attributed to activation of the opioid and dopamine systems.1,2,5 The lack of an alcohol preference or sensitivity QTL near the Oprm locus on proximal chromosome 10q25 and the presence of QTLs at other loci23–25 suggest that differences in consumption of alcohol in the C57BL and DBA mouse strains may be affected by loci other than Oprm. The results of this study suggest that a similar conclusion could be drawn for humans, that is, that the OPRM1 locus does not affect alcohol consumption, where a diagnosis of alcohol dependence is a measure of increased intake of alcohol. The diseases of alcohol and drug dependence are complex disorders involving genes, the effects of drugs of abuse on normal physiology and variable host response to drug exposure,2 suggesting that the effect of any single gene may be small. To detect subtle genetic effects on such complex diseases, large samples of either unrelated individuals or sib-pairs may need to be analyzed using non-parametric approaches.26 This Alleles i.b.d. Std Err P-value 89 96 36 0.480 0.518 0.506 0.016 0.015 0.013 1.000 1.000 0.397 87 97 34 0.487 0.513 0.462 0.019 0.019 0.040 1.000 1.000 1.000 Mean p 0.500 0.496 T-value 1.561 1.155 P-value 0.940 0.875 Regression P-value D.F. 0.353 136 0.249 136 analysis of three population samples suggests, however that the negative result may not be due to a lack of power. The three samples are large enough to have a power of 80% to detect small (0.1) to medium (0.3) effect sizes at a nominal significance level of P = 0.05,27 where the effect size of the variant ALDH2*2 allele is 0.32 for DSM-III alcohol dependence.28 At this effect size, all our samples have complete power to detect association of OPRM1 variation to alcohol dependence. These results do not rule out a relationship between OPRM1 alleles and alcohol dependence, but do suggest that the effect on alcohol dependence, if it exists, is less than 10% of the liability. Other phenotypes related to the normal and diseaseassociated functions of the opioid system could be tested for association with the OPRM1 genetic variation discovered and characterized in this study. The lack of morphine-mediated analgesia, reward, physical dependence and withdrawal symptoms in Oprm knock-out mice which show no accompanying changes in d or k opioid receptor number or distribution suggests that it is the m opioid receptor which is of primary importance in the pharmacology of opiate addiction.29,30 Methadone31 and naltrexone32 have been used to treat opiate addiction and alcoholism33,34 and patients who exhibit differential response to opiate pharmacotherapy constitute groups within which to look for association of OPRM1 to behavior. The recent discovery of endomorphins as powerful m opioid-specific ligands35 suggests that there are multiple endogenous m opioid ligand-receptor systems regulating opioid system tone. Thus the function of neuroendocrine systems regulated by the opioid system, such as the HPA axis and nociception, may be affected by genetic varation at OPRM1. Association analysis with such phenotypes may contribute towards understanding the role of the OPRM1 variants and alcohol dependence AW Bergen et al m opioid receptor in vulnerability to addiction, response to m opioid receptor pharmacotherapy and to endogenous ligands. Methods Subject ascertainment and diagnostic assessment The US Caucasian population sample is composed of 100 unrelated individuals (42 males, 58 females, mean age = 43.6 ± 14.0 years) recruited through newspaper advertisements for an EEG study as described.36 This sample included five individuals with alcohol dependence alone, three with drug abuse or dependence (drug abuse) alone, 15 with both alcohol dependence and drug abuse, and 77 with no alcoholism or drug abuse diagnoses. The Finnish sample was made up of 324 males, composed of 165 male criminal offenders (mean age = 31.6 ± 8.1 years) undergoing forensic psychiatric examination in the Psychiatry Department of the University of Helsinki and 159 male volunteers (mean age = 31.7 ± 9.7 years) recruited through newspaper advertisements as described. 37,38 This sample included 88 individuals with alcohol dependence alone, two with drug abuse alone, 52 individuals with both alcohol dependence and drug abuse, and 182 with no drug abuse or dependence diagnoses. The American Indian population sample is composed of 367 individuals (155 male and 212 female, mean age = 36.5 6 13.2 years) from a single Southwestern tribe. Individuals were identified from three very large genealogies for a family-based study on alcoholism and psychiatric disorders as described.39 This sample included 116 with alcohol dependence diagnoses alone, 21 individuals with drug abuse alone, 122 individuals with both alcohol dependence and drug abuse, and 108 with no alcohol or drug abuse diagnoses. All subjects provided informed consent and all studies were approved by the appropriate IRBs as described.36–39 All subjects were interviewed using SADS-L or SCID and DSM-III-R diagnoses were determined from interview data by two psychiatrists,36 by a clinical social worker under the supervision of a research psychiatrist37,38 or by a clinical social worker and a clinical psychologist.39 Genotyping PCR reactions and direct sequencing and restriction of PCR products was performed on DNA extracted from lymphoblastoid cell lines using sequencing primers derived from cDNA sequence and intronic sequence as depicted in Figure 1 and as described.40 The +17 C/T (Ala6Val) transition was observed in the direct sequencing screen and was not genotyped in other individuals. The +118A/G (Asn40Asp) polymorphism was genotyped using the forward primer, 5′CCTTGGCGTACTCAAGTTGCTC3′, bases +45→+66, and reverse primer, 5′TTCGGACCGCATGGGACG GAC3′, bases +139→ +119, where an A was substituted for a T at position −6 to create a DrdI site, with an annealing temperature of 66°C, to amplify a 95-bp PCR product, yielding 22 and 73 bp fragments upon DrdI digestion of the variant PCR product. The +440C/G (Ser147Cys) transversion was genotyped using forward primer, 5′CTCCTAGATACACCAAGATG3′, composed of the last seven bases of IVS141 and bases +285→+297 and reverse primer, 5′TGAACATGTTATAGTAA TCTCTG3′, bases +462→ 441, where a C was substituted for an A at position −3 to create a PstI site, with an annealing temperature of 54°C, to amplify a 185-bp PCR product, yielding 24 and 161 bp fragments upon PstI digestion of the variant PCR product. The IVS2+691C/G transversion was genotyped using forward primer, 5′GCTCTGGTCAAGGCTAAGAAT3′, bases IVS2+670→IVS2+690 where a G was substituted for an A at position −4 to create a HinfI site, and reverse primer, 5′GATCATCAGTCCATAGCACACGG3′, bases +774→+751, with an annealing temperature of 64°C, to amplify a 235-bp fragment, yielding 215 and 20 bp fragments upon HinfI digestion of the variant PCR product. Haplotype information derived from direct sequencing and PCR-RFLP genotyping of bases at positions +151, +183, +621, +699, +700, +1313, +1655 and +1700 suggests that these sequencing discrepancies observed among the three OPRM1 cDNA sequences found in Genbank13–15 and the sequence obtained in this study are sequencing artifacts or rare haplotypes not observed in our sample, as noted in Genbank Accessions AF024515, AF024516 and AF024517. Statistical analysis Association analyses between OPRM1 alleles, genotypes and haplotypes and DSM-III-R diagnoses of alcohol dependence and drug abuse and/or dependence were performed using contingency table analysis. Sibpair linkage analyses in the Southwest American Indian population between OPRM1 genotype and DSM-III-R diagnoses of alcohol dependence and drug abuse and/or dependence diagnoses were performed using the SAGE program.42 Acknowledgements The authors thank L Akhtar, R Aragon and M Radel for technical assistance, MA Enoch, M Eggert and R Robin for assistance with ascertainment of clinical populations, A Malhotra for advice on power analysis and the editor and two referees for suggestions on a earlier version of this manuscript. References 1 Herz A. Endogenous opioid systems and alcohol addiction. Psychopharmacology 1997; 129: 99–111. 2 Kreek MJ. Opiates, opioids and addiction. Mol Psychiatry 1996; 1: 232–254. 3 Gianoulakis C, Barcomb A. Effect of acute ethanol in vivo and in vitro on the B-endorphin system in the rat. Life Sci 1987; 40: 19–28. 4 Reid LD, Hunter GA. Morphine and naloxone modulate intake of ethanol. Alcohol 1984; 1: 33–37. 5 Altschuler HL, Phillips PE, Feinhandler DA. Alteration of ethanol self-administration by naltrexone. Life Sci 1980; 26: 679–688. 6 Di Chiara G, Imperato A. Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats. Proc Natl Acad Sci USA 1988; 85: 5274–5278. 493 OPRM1 variants and alcohol dependence AW Bergen et al 494 7 Berrettini W, Ferraro T, Alexander R, Buchberg A, Vogel W. Quantitative trait loci study of morphine preference in inbred mouse strains. Nature Genet 1994; 17: 54–58. 8 Alexander RC, Heydt D, Ferraro TN, Vogel W, Berrettini WH. Further evidence for a quantitative trait locus on murine chromosome 10 controlling morphine preference in inbred mice. Psych Genet 1996; 6: 29–31. 9 Volpicelli JR. Uncontrollable events and alcohol drinking. Br J Addict 1987; 82: 381–392. 10 Gianoulakis C, Beliveau D, Angelogianni P, Meaney M, Thavundayil J, Tawar V et al. Different pituitary B-endorphin and adrenal cortisol response to ethanol in individuals with high and low risk for future development of alcoholism. Life Sci 1989; 45: 1097–1109. 11 Peterson JB, Pihl RO, Gianoulakis C, Conrod P, Finn PR, Stewart SH, LeMarquand DG et al. Ethanol-induced change in cardiac and endogenous opiate function and risk for alcoholism. Alcoholism: Clin Exper Res 1996; 20: 1542–1552. 12 King AC, Volpicelli JR, Frazer A, O’Brien CP. Effect of naltrexone on subjective alcohol response in subjects at high and low risk for future alcohol dependence. Psychopharmacology 1997; 129: 15–22. 13 Wang JB, Johnson PS, Persico A, Hawkins AL, Griffin CA, Uhl GR. Human mu opiate receptor: cDNA and genomic clones, pharmacological characterization and chromosomal assignment. FEBS Lett 1994; 338: 217–222. 14 Bare LA, Mansson E, Yang D. Expression of two variants of the human mu opioid receptor mRNA in SK-N-SH cells and human brain. FEBS Lett 1994; 354: 213–216. 15 Mestek A, Hurley JH, Bye LS, Campbell AD, Chen Y, Tian M et al. The human mu opioid receptor: modulation of functional desensitization by calcium/calmodulin-dependent protein kinase and protein kinase C. J Neurosci 1995; 15: 2396–2406. 16 Wang JB, Imai Y, Eppler CM, Gregor P, Spivak CE, Uhl GR. mu opiate receptor: cDNA cloning and expression. Proc Natl Acad Sci USA 1993; 90: 10230–10234. 17 Surratt CK, Johnson PS, Moriwaki A, Seidleck BK, Blaschak CJ, Wang JB et al. m opiate receptor: charged transmembrane domain amino acids are critical for agonist recognition and intrinsic activity. J Biol Chem 1994; 269: 20548–20553. 18 Green SA, Turki J, Innis M, Liggett SB. Amino-terminal polymorphisms of the human beta2-adrenergic receptor impart distinct agonist-promoted regulatory properties. Biochemistry 1994; 33: 9414–9419. 19 Green SA, Turki J, Bejarano P, Hall IP, Liggett SB. Influence of betaadrenergic receptor genotypes on signal transduction in human airway smooth muscle cells. Am J Respir Cell Mol Biol 1995; 13: 25–33. 20 Liles WC, Nathanson NM. Regulation of neuronal muscarinic receptor number by protein glycosylation. J Neurochem 1986; 46: 85–95. 21 Unterwald EM, Rubenfeld JM, Imai Y, Wang JB, Uhl GR, Kreek MJ. Chronic opioid antagonist administration upregulates mu opioid receptor binding without altering mu opioid receptor mRNA levels. Mol Brain Res 1995; 33: 351–355. 22 Kieffer BL. Recent advances in molecular recognition and signal transduction of active peptides: receptors for opioid peptides. Cell Mol Neurobio 1995; 15: 615–635. 23 Melo JA, Shendure J, Pociask K, Silver LM. Identification of sexspecific quantitative trait loci controlling alcohol preference in C57BL/6 mice. Nature Genet 1996; 13: 147–153. 24 Market PD, Bennett B, Beeson M, Gordon L, Johnson TE. Confirmation of quantitative trait loci for ethanol sensitivity in long-sleep and short-sleep mice. Genome Res 1997; 7: 92–99. 25 Kozak CA, Filie J, Adamson MC, Chen Y, Yu L. 1994. Murine chromosomal location of the m and k opioid receptor genes. Genomics 1994; 21: 659–661. 26 Risch N, Merikangas K. The future of genetic studies of complex human diseases. Science 1996; 273: 1516–1517. 27 Cohen J. Statistical Power Analysis for the Behavioral Sciences. Lawrence Erlbaum Associates: Hillsdale, New Jersey, 1988. 28 Thomasson HR, Edenberg HJ, Cragg DW, Mai X-L, Jerome RE, Li T-K et al. Alcohol and aldehyde dehydrogenase genotypes and alcoholism in Chinese men. Am J Hum Genet 1991; 48: 677–681. 29 Matthes HW, Maldonado R, Simonin F, Valverde O, Slowe S, Kitchen I et al. Loss of morphine-induced analgesia, reward effect and withdrawal symptoms in mice lacking the mu-opioid receptor gene. Nature 1996; 383: 819–823. 30 Sora I, Takahashi N, Funada M, Ujike H, Revay RS, Donovan DM et al. Opiate receptor knockout mice define mu receptor roles in endogenous nociceptive responses and morphine-induced analgesia. Proc Natl Acad Sci USA 1997; 94: 1544–1549. 31 Dole VP, Nyswander M. A medical treatment for diacetylmorphine (heroin) addiction. J Am Med Assoc 1965; 193: 80–84. 32 Martin WR, Jasinski DR, Mansky PA. Naltrexone, an antagonist for the treatment of heroin dependence. Arch Gen Psych 1973; 28: 784–791. 33 O’Malley SS, Jaffe A, Chang G, Schottenfeld RS, Meyer RE, Rounsaville BJ. Naltrexone and coping skills therapy for alcohol dependence: a controlled study. Arch Gen Psych 1992; 49: 881–887. 34 Volpicelli JR, Alterman AI, Hayashida M, O’Brien CP. Naltrezone in the treatment of alcohol dependence. Arch Gen Psych 1992; 49: 876–880. 35 Zadina JE, Hackler L, Ge L-J, Kastin AJ. A potent and selective endogenous agonist for the m-opiate receptor. Nature 1997; 386: 499–502. 36 Enoch M-A, Rohrbaugh JW, Davis EZ, Harris CR, Ellingson RJ, Andreason P et al. Relationship of genetically transmitted alpha EEG traits to anxiety disorders and alcoholism. Am J Med Gen (Neuropsych Gen) 1995; 60: 400–408. 37 Virkkunen M, Rawlings R, Tokola R, Pland RE, Guidotti A, Nereroff C et al. CSF biochemistries, glucose metabolism, and diurnal activity rhythms in alcoholic, violent offenders, fire setters, and healthy volunteers. Arch Gen Psych 1994; 51: 20–27. 38 Virkkunen M, Kallio E, Rawlings R, Tokola R, Pland RE, Guidotti A et al. Personality profiles and state aggressiveness in Finnish alcoholic, violent offenders, fire setters, and healthy volunteers. Arch Gen Psych 1994; 51: 28–33. 39 Goldman D, Urbanek M, Guenther D, Robin R, Long JC. Linkage and association of a functional DRD2 variant [Ser311Cys] and DRD2 markers to alcoholism, substance abuse and schizophrenia in Southwestern American Indians. Am J Med Gen (Neuropsych Gen) 1997; 74: 386–394. 40 Bergen A, Wang C-Y, Nakai B, Goldman D. Mass allele detection (MAD) of rare 5-HT1A structural variants with allele-specific amplification and electrochemiluminescent detection. Hum Mut 1996; 7: 135–143. 41 Simonin F, Gaveriaux-Ruff C, Befort K, Matthes H, Lannes B, Micheletti G et al. k-Opioid receptor in humans: cDNA and genomic cloning, chromosomal assignment, functional expression, pharmacology, and expression pattern in the central nervous system. Proc Natl Acad Sci USA 1995; 92: 7006–7010. 42 Statistical Analysis for Genetic Epidemiology, Release 22. Computer program package available from the Department of Biometry and Genetics, LSU Medical Center, New Orleans, supported by a USPHS Resource Grant (1 P41 RR03655) from the Division of Research Resources. Correspondence: Dr AW Bergen, Laboratory of Neurogenetics, National Institute on Alcohol Abuse and Alcoholism, 12501 Washington Avenue, Flow Bldg, Room 2, Rockville, Maryland 20852, USA. E-mail: awbKdicbr.niaaa.nih.gov Received 9 April 1997; revised 1 August 1997; accepted 4 August 1997