Download Establishment of an immortal chicken embryo liver

MOLECULAR, CELLULAR, AND DEVELOPMENTAL BIOLOGY
Establishment of an immortal chicken embryo liver-derived cell line
Jeongyoon Lee,*† Douglas N. Foster,‡ Walter G. Bottje,*† Hyeon-Min Jang,* Yohanna G. Chandra,*†
Lauren E. Gentles,§ and Byung-Whi Kong*†1
*Department of Poultry Science, and †Cell and Molecular Biology Graduate Program, University of Arkansas,
Fayetteville 72701; ‡Department of Animal Science, University of Minnesota, St. Paul 55108;
and §Department of Biology, University of Arkansas, Fayetteville 72701
ABSTRACT A continuously growing immortal cell
substrate can be used for virus propagation, diagnostic purposes, and vaccine production. The aim of this
study was to develop an immortal chicken cell line for
efficient propagation of avian infectious viruses. From
the various chicken embryo cells that were tested for
life span extension, an immortalized chicken embryo
liver (CEL) cell line, named CEL-im, was derived spontaneously without either oncogenic viruses or carcinogenic chemical treatment. Currently, CEL-im cells are
growing 0.8 to 1.1 population doublings per day and
have reached 120 passages. The CEL-im cell line is permissive for poultry infectious viruses, including avian
metapneumovirus (AMPV), Marek’s disease virus serotype 1 (MDV-1), and infectious laryngotracheitis virus.
The CEL-im cells produced high AMPV titer (>105
pfu/mL), whereas very low titers (~10 pfu/mL) for
MDV-1 and infectious laryngotracheitis virus were produced. To identify genetic alterations in the immortal
CEL-im cell line, telomerase activity and mRNA expression for major cell cycle regulatory genes were determined during the immortalizing process. The CELim cell line has negative telomerase activity, and when
compared with the primary passage 2 CEL cell counterpart, mRNA expression of tumor suppressor protein
p53, mouse double minute 2 (Mdm2), cyclin dependent
kinase (CDK) inhibitor p21 (p21WAF), and CDK inhibitor p16 (p16INK4) were downregulated in the CELim cell line, whereas retinoblastoma (Rb), transcription
factor E2F, member 1 (E2F-1), and alternative reading
frame of p16INK4 (ARF) were upregulated. These results are similar to genetic alterations found previously
in immortal chicken embryo fibroblast (CEF) cell lines
that showed efficient propagation of MDV-1. Therefore,
this newly established CEL-im cell line can serve as an
alternative cell substrate for the propagation of poultry
viruses, such as AMPV.
Key words: chicken embryo liver, immortal cell line, gene expression
2013 Poultry Science 92:1604–1612
http://dx.doi.org/10.3382/ps.2012-02582
INTRODUCTION
Primary chicken embryo kidney, chicken embryo fibroblast (CEF), and chicken embryo liver (CEL) cells
have been preferred for virus propagation, detection,
and subsequent vaccine production (Kawamura and
Tsubahara, 1968; Yamaguchi and Kawamura, 1977;
Barta et al., 1984; Myers and Schat, 1989; Pfirschke,
1989; Kibenge and McKenna, 1992). However, the use
of primary cultured cells prepared from live organ tissues for virus propagation has limitations such as the
limited life-span of the cells, the time consuming and
labor intensive preparation, heterogeneous cell populations, and the potential for microbial contamination.
Thus, continuously growing immortal cell lines can
©2013 Poultry Science Association Inc.
Received July 2, 2012.
Accepted February 10, 2013.
1 Corresponding author: [email protected]
serve as stable cell substrates for virus propagation.
Two immortalized avian cell lines, the DF-1 line, which
was derived spontaneously from CEF cells (Himly et al.,
1998) and the Leghorn male hepatoma (LMH) chemically induced chicken hepatocellular carcinoma cell line
(Kawaguchi et al., 1987), have been widely used for the
propagation of avian infectious viruses including avian
influenza, avian infectious bronchitis virus, Marek’s
disease virus serotype 1 (MDV-1), avian metapneumovirus (AMPV), and infectious laryngotracheitis virus
(ILTV; Schnitzlein et al., 1994). For virus propagation
and vaccine production, immortalized cell lines should
not harbor existing endogenous and exogenous viral genomes, should serve as a continuous supply of homogenous cells, and should overcome disadvantages found in
the use of primary cells such as virus titer fluctuation.
To date, only 2 immortal CEF cell lines noted as DF-1
and SC-1 have been established spontaneously without
the use of tumorigenic viruses or oncogenic chemicals
(Himly et al., 1998; Christman et al., 2005). In addi-
1604
CHICKEN EMBRYO LIVER-DERIVED CELL LINE
tion, other immortal CEF cell lines such as breast CEF
and heart CEF cell lines were established, although
not spontaneously (Kim et al., 2001c). Although many
chicken embryo cell lines have been established and reported, various cellular characteristics including cellular growth rate (rapid vs. slow), morphology (piling up
vs. contact inhibition), and the steady state expression
levels (up- vs. downregulation) for various cell cycle
regulatory genes are critical to determine whether an
established cell line is tumorigenic or not, and in turn,
whether a cell line can serve as a suitable substrate for
production of vaccines.
A variety of key cell cycle regulatory factors that have
been well characterized in mammalian cells, including
tumor suppressor protein p53 (p53), retinoblastoma
(Rb), mouse double minute 2 (Mdm2), transcription
factor E2F, member 1 (E2F-1), cyclin-dependent kinase (CDK) inhibitor p21 (p21WAF), CDK inhibitor
p16 (p16INK4), alternative reading frame of p16INK4
(ARF), and cellular proto-oncogene c-myc (c-myc)
has also been characterized in chicken cells (Kim et
al., 2001a,b,c; Christman et al., 2005). The p53 functions as a tumor suppressor in cell cycle arrest (Ko
and Prives, 1996), and the downstream genes p21WAF
(CDK inhibitor) and Mdm2 (ubiquitin ligase), which
are transcriptionally upregulated by activated p53 protein, can regulate cellular proliferation and cell death
(el-Deiry et al., 1993; Harper et al., 1993; Xiong et al.,
1993; Zauberman et al., 1995). The Rb protein regulates
G1/S phase transition by binding to E2F, which activate G1/S transition when they are released from phosphorylated Rb (Murphree and Benedict, 1984; Wu et
al., 1995; Dyson, 1998; Das et al., 2005). Both p16INK4
and ARF are encoded at the INK4/ARF locus (also
known as CDKN2A; Sherr, 2006a). The ARF (CDK
inhibitor) acts as a tumor suppressor for active p53dependent cell cycle arrest (Sherr, 2006b), and IKN4a
(CDK inhibitor) is also a tumor suppressor regulating
the cell cycle (Nobori et al., 1994). Myc (c-myc) is a
well-known cellular proto-oncogene and transcriptional
regulator controlling cell proliferation, cell growth, differentiation, and apoptosis (Marcu et al., 1992; Peukert
et al., 1997).
In this study, we established an immortal chicken embryo liver-derived cell line (CEL-im) for mainly targeting the propagation of poultry viruses. Furthermore,
gene expression for cell cycle regulatory factors and
telomerase activity were determined at various passages during the immortalization process of the newly
established CEL-im cell line.
MATERIALS AND METHODS
Isolation and Culture of Chicken Cells
Primary chicken embryo liver cells were isolated from
15-d-old specific-pathogen-free (SPF) chicken embryos
(Charles River Avian Vaccine Services, North Franklin,
CT). Embryonic liver tissues were treated with VT so-
1605
lution (1:1 ratio of 0.25% trypsin and PBS) for 30 min.
Cells were plated into 100-mm tissue culture dishes
(Sarstedt, Newton, NC) coated with 0.5% gelatin in
PBS and were grown at 39°C in a 5% CO2 incubator.
The CEL cells were cultured in Dulbecco’s modified
eagle medium (0.45% glucose) with 10% fetal bovine
serum (FBS), 100 units of penicillin/mL, 100 µg of
streptomycin/mL, and 2 mM l-glutamine (Invitrogen
Life Technologies, Carlsbad, CA). Cells (6 × 105) were
transferred to new culture dishes, and medium was
changed every 2 d. Two culture dishes of cells were passaged every 4 to 5 d, and cell numbers were counted at
each passage. The DF-1 CEF cells were cultured using
the same condition as CEL cells, whereas LMH cells
were grown in Waymouth’s medium (Invitrogen Life
Technologies) with 10% FBS, 100 units of penicillin /
mL, 100 µg of streptomycin/mL, and 2 mM l-glutamine (Invitrogen Life Technologies).
Viruses and Infections
The stock viruses of AMPV/MN2A (provided by D.
N. Foster), MDV-1 (purchased from American Type
Culture Collection, Manassas, VA), and ILTV (purchased from National Veterinary Services Laboratory,
Ames, IA) were used. The CEL-im cells were infected
with AMPV at a multiplicity of infection of 0.5. After incubation for 72 h, virus-infected cells were subjected to 3 freeze-thaw cycles, then medium-containing
virus was clarified by centrifugation at 3,000 × g for
15 min at room temperature. To determine AMPV titers, the supernatant fluid was collected and 10-fold
dilutions were subjected to reinfection of Vero cells in
96-well plates. The AMPV titers were determined at
3 d postinfection (dpi) by scoring for cytopathic effect (CPE) and were measured as pfu per milliliter
(Kong et al., 2007). The MDV infection and tittering
were performed following the methods of Parcells et al.
(1994) with minor modifications. To determine titers
for MDV-1, CEL-im cells were infected with stock virus
at 100 pfu. At 5 dpi, MDV infected cells were harvested with 0.25% trypsin treatment and 10-fold cell
dilutions were inoculated onto fresh DF-1 CEF cells
in 24-well dishes. The CPE shown in DF-1 CEF cells
were counted at 5 dpi, and the mean number of plaques
was determined. The ILTV infection and titering was
performed following the methods of Fuchs et al. (2012).
The ILTV stock virus was used to infect CEL-im cells
at 100 pfu. Infected cells were incubated at 37°C for 1
h with gentle rocking every 15 min. After the incubation, 10 mL of fresh media was added, and the cells
were incubated for 5 d. After incubation, infected cells
and supernatant were harvested and lysed by 3 freezethaw cycles. To determine ILTV titer, 10-fold dilutions
of ILTV were subjected to re-infection of LMH cells in
24-well plates. The ILTV titers were determined at 5
dpi by scoring CPE and were measured as pfu per milliliter. Three replicates for titering were conducted for
all viruses examined.
1606
Lee et al.
RNA Extraction
The RNA samples were prepared at passages of 20,
50, 70, and 90 for CEL-im in addition to primary passage 2 CEL cells in addition to DF-1 CEF and LMH
cells using TRIzol reagent (Invitrogen Life Technologies) following manufacturer’s instructions. The total
RNA was treated with DNase I (New England BioLabs
Inc., Ipswich, MA) and repurified using TRIzol reagent.
The quantity of the repurified total RNA was measured
using a Nanodrop1000 spectrophotometer (Thermo
Scientific, Wilmington, DE) and quality was assessed
by agarose gel electrophoresis (data not shown).
Quantitative Reverse-Transcription PCR
Reverse-transcription reactions were performed with
SuperScript II RTase (Invitrogen Life Technologies) using 3 μg of total RNA, and the reverse-transcription
products were diluted to 1:10 with diethylpyrocarbonate (DEPC)-water. The quantitative reverse-transcription PCR (qPCR) reactions were performed by
the following condition: denaturing 95°C for 30 s, annealing at 62°C for 1 min, extension at 72°C for 30 s
with a final extension at 72°C for 10 min in 40 cycles.
The SYBR and reference ROX dyes (Invitrogen Life
Technologies) were used for quantification. A nontemplate control and chicken glyceraldehyde 3-phosphate
dehydrogenase (chGAPDH) as a loading control were
used for the relative quantification. The fold change
values for target genes compared with the samples from
primary passage 2 CEL cells were measured by the 2−
ΔΔCT method (Livak and Schmittgen, 2001). Genespecific primer sets were designed by Primer3 software
(http://primer3.wi.mit.edu/) and were synthesized by
Integrated DNA Technologies (Coralville, IA). Primer
sequences are shown in Table 1.
Telomeric Repeat Amplification
Protocol Assay
Telomerase activity was analyzed using the TRAPeze
Telomerase Detection Kit (EMD Millipore, Billerica,
MA) following the manufacturer’s instructions. Briefly,
1 × 106 CEL-im cells at passage 60, 80, 100 and LMH,
DF-1 cells in addition to HeLa (human cervical carcinoma cell line) positive control cells were lysed in CHAPS
{3-[(3-Cholamidopropyl)-dimethylammonio]-1-propane
sulfonate} buffer, and 2 µg of protein were used for
the PCR-based telomeric repeat amplification protocol
(TRAP) assay.
RESULTS AND DISCUSSION
Cellular Proliferation During
Immortalizing Process
Because primary CEL cells, freshly isolated from
chicken embryo liver, did not proliferate rapidly, cells
were passaged once every week with no increase in cell
number (data not shown). At the 13th passage, several
proliferating foci of cells were observed and the cell
numbers began to be counted to determine the growth
rates when cells were passaged. Population doublings
(PD) per day for the repopulating primary CEL cells
were determined at every passage by passaging cells
every 4 to 5 d to the 100th passage (Figure 1). The
PD/day for these cells fluctuated between 0.2 and 1.1
until passage 85, and became stable after passage 100
(Figure 1), resulting in cells that were considered to be
immortal. The spontaneously immortalized CEL cells
were designated as the CEL-im cell line. Currently, the
CEL-im cell line grows continuously and has reached
120 passages at between 0.8 to 1.1 PD/day.
The Morphology and Growth Rates
of the CEL-im Cell Line
The morphology and growth rates of the CEL-im cell
line at passage 100 are shown in Figure 2. When higher
resolution microscopy (200×) was used, the morphology of CEL-im cells showed a smaller size (~10 µm)
compared with a typical primary hepatocyte (~25 µm).
After growing for 3 d, the culture dishes became confluent from 1 × 105 seeded cells in 6-cm-diameter culture
dish (Figure 2A). The growth rate of CEL-im cells was
compared with the primary CEL (passage 2) and the
LMH hepatoma cell line (Figure 2B). Whereas primary
Table 1. The primer sets for quantitative reverse-transcription PCR
Gene1
Forward
Reverse
p53
Rb
Mdm2
E2F-1
p21WAF
ARF
p16INK4
c-myc
chGAPDH
CCATCCACGGAGGATTATGG
TGTGCTGAGATTGGCTCACA
GCCAAATTTCGGCTTGAAAA
AGCGGAAGCTGAACTTGGAG
CCCGTAGACCACGAGCAGAT
GGAAGACCTGGGAATGGATG
GCGGGATGAACTAGCCAACG
TGTCACGTCAACATCCACCA
GGCACTGTCAAGGCTGAGAA
TTCAGCACCGGGGAGTAAGT
CTGAGAGGCGCTCTTCTTCC
TGTTGTTGGCTGGGAAGTTG
CAGGAGACTTTGCCCCTCTG
CGTCTCGGTCTCGAAGTTGA
TGATGGGTGCACCACTGAAT
GTCCGACCGAAGGAGTTGAC
ACCCTGCCACTGTCCAACTT
TGCATCTGCCCATTTGATGT
1p53 = tumor suppressor protein p53; Rb = retinoblastoma; Mdm2 = mouse double minute 2; E2F-1 = transcription factor E2F, member 1; p21WAF = cyclin dependent kinase (CDK) inhibitor p21; ARF = alternative
reading frame of p16INK4; p16INK4 = CDK inhibitor p16; c-myc = cellular proto-oncogene c-myc; chGAPDH =
chicken glyceraldehyde 3-phosphate dehydrogenase.
CHICKEN EMBRYO LIVER-DERIVED CELL LINE
1607
Figure 1. Growth curve during immortalization of chicken embryo liver line. Population doublings (PD) per day were determined by passaging every 4 to 5 d.
CEL cells showed no increase in cell numbers and LMH
cells showed growth only reaching 6 × 105 cells, respectively, CEL-im showed a much greater growth rate for
4 d. The fact that newly established CEL-im cell line
can proliferate stably and rapidly suggests the CEL-im
cell line can serve as an alternative cellular substrate
for virus propagation.
Permissiveness of CEL-im Cells
to Infectious Avian Viruses
To determine the viral susceptibility, the spontaneously immortalized CEL-im cells were tested for permissiveness of avian infectious viruses including AMPV,
MDV-1, and ILTV (Table 2). The CEL-im cells were
highly permissive for AMPV infection producing titers
of ~105 pfu/mL, which is comparable with other cell
substrates, such as Vero, TT-1, and DF-1 (Kong et al.,
2006, 2007), whereas CEL-im cells were weakly permissive, producing low titers (~10 pfu/mL) for both
MDV-1 and ILTV (Table 2). These results suggest that
CEL-im cells can be used as an alternative cellular substrate for AMPV and can be tested for permissiveness
for other infectious avian viruses.
Altered Expression of Cell Cycle
Regulatory Genes
To characterize genetic alterations that led to the
induction of rapid cell divisions in the CEL-im cell line,
transcriptional changes of cell cycle regulatory genes
such as p53, Rb, Mdm2, E2F-1, p21WAF, ARF, p16INK4,
and c-myc were determined by qPCR during the immortalization process (Figure 3). The connection between cellular phenotypes and mRNA expression data
may not be as strong as expected. This could be due to
the potential lack of correlation between mRNA expres-
sion and protein abundance [which has been reported
previously in both prokaryotes and eukaryotes (Greenbaum et al., 2003; Nie et al., 2006; Guo et al., 2008;
Pascal et al., 2008; Taniguchi et al., 2010)]. The mRNA
expression for the cell cycle regulatory genes tested
here was confirmed to be correlated with the protein
abundance during either the aging process or immortalization of chicken cells (in addition to human and
mouse cells) and have been reported previously (Kim
et al., 2002a,b; Christman et al., 2006). Therefore, the
changes in mRNA expression levels of cell cycle regulatory genes could provide insight into understanding the
basic genetic alterations of the newly established CELim cell line, although further study is needed to reveal
the more detailed functional roles of these alterations in
the CEL-im immortalization process.
The expression level of p53 mRNA in the CEL-im
cell line was dramatically downregulated compared
with primary passage 2 CEL counterpart (Figure 3A).
Similar downregulation of p53 was found in the LMH
cell line. In turn, the downregulation of p53 in CEL
cells was confirmed by the decreased expression of
p21WAF and Mdm2 mRNA, which are the transcriptional downstream targets of p53 protein (Figure 3B
and 3C). Although p53 expression in DF-1 CEF cells
was not decreased, its functional activity as a transcription factor appeared to be greatly downregulated (in
lieu of the dramatic downregulation of p21WAF), possibly due to genetic mutations (Figure 3A and 3B). Similar results were reported previously showing that p53
mRNA expression was greatly decreased in immortal
CEF cell lines (Kim et al., 2001b,c; Christman et al.,
2005, 2006). Furthermore, the downregulation of p53
has been known as a key regulatory alteration in the
immortalization of human cells (Williams et al., 1994;
Hahn et al., 1999). Thus, the downregulation of p53 in
CEL-im cells appeared to be a typical genetic alteration process during cellular immortalization.
1608
Lee et al.
Table 2. Permissiveness of an immortal chicken embryo liverderived cell line infected with avian metapneumovirus (AMPV),
Marek’s disease virus serotype 1 (MDV-1), and infectious laryngotracheitis virus (ILTV)
Virus
AMPV
MDV-1
ILTV
1++
Permissiveness1
Titer
(pfu/mL)
++
+
+
7 × 105
1.03 × 101
1.50 × 101
= highly permissive; + = weakly permissive.
However, Rb, another tumor suppressor, was greatly
upregulated in CEL-im cell line (Figure 3D), but not
in LMH cells, as found previously with other immortal
chicken cell lines (Kim et al., 2001c). The increased
Rb expression in immortal chicken cell lines is in contrast to the decreased expression found in mammalian
cancer cells (Hickman et al., 2002). In addition, the
mRNA level of E2F-1, which is regulated (suppressed)
by binding with Rb, was upregulated in CEL-im cells
in addition to DF-1 CEF and LMH cells (Figure 3E),
as reported previously in the immortal breast CEF
(BCEFi) and heart CEF (HCEFi) cell lines (Kim et
al., 2001c). Generally E2F, including E2F-1, function
in the cellular proliferation by the cell cycle progression
(Wu et al., 2001). Moreover, E2F-1 mRNA expression
is downregulated in senescent cells of human diploid
fibroblast (HDF), mouse embryonic fibroblast (MEF),
and CEF cells (Kim et al., 2002b).
Figure 2. Morphology and the growth of chicken embryo liver (CEL) cell line. (A) Cells were visualized for 4 d using a phase contrast microscope at 100× magnification. (B) Primary CEL (passage 2; diamond), Leghorn male hepatoma (LMH; square), and immortal chicken embryo
liver-derived (CEL-im; circle) cells were plated at a density of 1 × 105 cells/6 cm dish, and the number of cells was calculated every day for 4 d.
Each value represents the mean ± SE of 3 observations.
CHICKEN EMBRYO LIVER-DERIVED CELL LINE
1609
Figure 3. The mRNA expression for cell cycle regulatory genes in chicken embryo liver immortal (CEL-im) cells. The quantitative reversetranscription PCR results were displayed for each gene examined. The x-axis indicates the passage number of CEL-im cells, and the y-axis presents fold change values of relative expression (REL). (A) tumor suppressor protein p53 (p53); (B) cyclin-dependent kinase (CDK) inhibitor p21
(p21WAF); (C) mouse double minute 2 (Mdm2); (D) retinoblastoma (Rb); (E) transcription factor E2F, member 1 (E2F1); (F) CDK inhibitor p16
(p16INK4); (G) alternative reading frame of p16INK4 (ARF); (H) cellular proto-oncogene c-myc (c-myc). Each value represents the mean ± SE of
3 replicates. CEL1° P2 = primary chicken embryo fibroblast (CEF) passage 2 cells; DF-1 = spontaneously immortalized CEF cell line; LMH =
Leghorn male hepatoma.
As previously reported (Kim et al., 2001c), the expression level of cyclin A, B2, B3, C, D1, and E were
upregulated in immortal CEF cell lines, whereas the
expression level of p16INK4, one of the cyclin-dependent
kinase inhibitors, was downregulated in immortal CEF
cell lines. We confirmed the downregulation of p16INK4
mRNA expression in the CEL-im cell line in addition
to DF-1 CEF and LMH cells (Figure 3F). Interestingly,
the opposite expression pattern between p16INK4 and
E2F-1 in the CEL-im cells was similar to what was
previously reported in the immortal CEF cells (Kim et
al., 2002b). Taken together, in the Rb/p16INK4/E2F1 pathway, the E2F-1 protein is bound to hypophosphorylated Rb, whereas phosphorylated Rb releases
1610
Lee et al.
Figure 4. Telomerase assay. Passages 60, 80, and 100 of the chicken embryo liver immortal (CEL-im) and Leghorn male hepatoma (LMH),
DF-1 chicken embryo fibroblast (CEF) cells were analyzed using the PCR-based telomeric repeat amplification protocol (TRAP) assay for telomerase activity. HeLa cell extract was used as a control (positive). The sequential 6-bp increments of amplified telomeric repeats are indicated in
the positive control lane and LMH sample. DF-1 = spontaneously immortalized CEF cell line; HeLa = human cervical carcinoma cell line.
free E2F-1, and cells are then able to pass from G1 into
the S phase of the cell cycle. The Rb phosphorylation
process can be suppressed by p16INK4 (Wu et al., 2001).
Although expression of Rb is upregulated, the downregulation of p16INK4 may induce hyperphosphorylation of Rb and the higher level of free E2F1, not bound
to Rb, may stimulate enhanced cell cycle progression in
CEL-im cells.
The expression level of ARF mRNA was upregulated
in the CEL-im cell line (Figure 4G). Although the major function of ARF is tumor suppression and induction
of apoptosis through the binding of Mdm2 to stabilize
p53 (Sherr, 2001), thereby preventing cellular proliferation (Bertwistle et al., 2004), recent findings of the
p53-independent function of ARF have shown ribosome
biogenesis and cell growth stimulation by binding to
nucleophosmin/B23 (NPM; Bertwistle et al., 2004; Apicelli et al., 2008). Thus, the upregulated ARF mRNA
may also play a role in enhanced cell growth capability
of CEL-im cells.
The expression level of c-myc mRNA fluctuated
during the all passages in the CEL-im cell line compared with primary passage 2 CEL counterpart (Figure
3G). The c-myc oncogene has long been known to be
among the most frequently deregulated genes in cancer cells. The deregulation of c-myc leads to additional
mutations, such as genomic instability including single
nucleotide substitutions, double-stranded breaks, and
numerical chromosomal defects (Prochownik and Li,
2007; Prochownik, 2008). Although c-myc is a strong
proto-oncogene and shows critical functions in cellular proliferation and genomic instability in mammals
(Marcu et al., 1992; Peukert et al., 1997), functional
roles of c-myc showing variable expression patterns
during the immortalization process in the CEL-im remain for further study.
Telomerase Activity
To further verify the basic cellular characteristics of
the CEL-im cell line, cells were subjected to the TRAP
assay to determine telomerase activity. The CEL-im
cells were not positive for telomerase activity at passages 60, 80, or 100 (Figure 4), compared with the positive control (an extract from the HeLa human cervical
carcinoma cell line). Interestingly, from the comparison
with other immortal avian cell lines, LMH cells showed
positive activity (the sequential 6-bp increments of
amplified telomeric repeats), whereas DF-1 CEF cells
showed negative telomerase activity (Figure 4).
In summary, a newly established immortal CELim cell line retains similar genetic alterations found
in other immortal avian cell lines. The CEL-im cell
line was permissive for avian infectious viruses including ILTV, MDV-1, and AMPV. The CEL-im cell line
may be valuable for studying virus propagation due to
the rapid proliferation potential and its morphological
stability. Further research is needed to investigate the
potential of the CEL-im cell line as cellular substrates
for the propagation and vaccine production of infectious viruses.
ACKNOWLEDGMENTS
This work was supported by US Poultry and Egg Association (project number 640) and, in part, by the Arkansas Bioscience Institute and Arkansas Agricultural
Experimental Station.
REFERENCES
Apicelli, A. J., L. B. Maggi Jr., A. C. Hirbe, A. P. Miceli, M. E. Olanich, C. L. Schulte-Winkeler, A. J. Saporita, M. Kuchenreuther,
J. Sanchez, K. Weilbaecher, and J. D. Weber. 2008. A non-tumor
CHICKEN EMBRYO LIVER-DERIVED CELL LINE
suppressor role for basal p19ARF in maintaining nucleolar structure and function. Mol. Cell. Biol. 28:1068–1080. http://dx.doi.
org/10.1128/MCB.00484-07.
Barta, V., W. T. Springer, and D. L. Millar. 1984. A comparison of
avian and mammalian cell cultures for the propagation of avian
reovirus WVU 2937. Avian Dis. 28:216–223.
Bertwistle, D., M. Sugimoto, and C. J. Sherr. 2004. Physical and
functional interactions of the Arf tumor suppressor protein with
nucleophosmin/B23. Mol. Cell. Biol. 24:985–996.
Christman, S. A., B. W. Kong, M. M. Landry, H. Kim, and D.
N. Foster. 2005. Modulation of p53 expression and its role in
the conversion to a fully immortalized chicken embryo fibroblast
line. FEBS Lett. 579:6705–6715. http://dx.doi.org/10.1016/j.
febslet.2005.10.066.
Christman, S. A., B. W. Kong, M. M. Landry, H. Kim, and D.
N. Foster. 2006. Contributions of differential p53 expression in
the spontaneous immortalization of a chicken embryo fibroblast
cell line. BMC Cell Biol. 7:27. http://dx.doi.org/10.1186/14712121-7-27.
Das, S. K., T. Hashimoto, K. Shimizu, T. Yoshida, T. Sakai, Y.
Sowa, A. Komoto, and K. Kanazawa. 2005. Fucoxanthin induces cell cycle arrest at G0/G1 phase in human colon carcinoma cells through up-regulation of p21WAF1/Cip1. Biochim.
Biophys. Acta
1726:328–335. http://dx.doi.org/10.1016/j.
bbagen.2005.09.007.
Dyson, N. 1998. The regulation of E2F by pRB-family proteins.
Genes Dev. 12:2245–2262.
el-Deiry, W. S., T. Tokino, V. E. Velculescu, D. B. Levy, R. Parsons,
J. M. Trent, D. Lin, W. E. Mercer, K. W. Kinzler, and B. Vogelstein. 1993. WAF1, a potential mediator of p53 tumor suppression. Cell 75:817–825.
Fuchs, W., H. Granzow, J. Veits, and T. C. Mettenleiter. 2012.
Identification and functional analysis of the small membraneassociated protein pUL11 of avian infectious laryngotracheitis
virus. Virus Res. 163:599–608. http://dx.doi.org/10.1016/j.
virusres.2011.12.014.
Greenbaum, D., C. Colangelo, K. Williams, and M. Gerstein. 2003.
Comparing protein abundance and mRNA expression levels on a
genomic scale. Genome Biol. 4:117. http://dx.doi.org/10.1186/
gb-2003-4-9-117.
Guo, Y., P. Xiao, S. Lei, F. Deng, G. G. Xiao, Y. Liu, X. Chen,
L. Li, S. Wu, Y. Chen, H. Jiang, L. Tan, J. Xie, X. Zhu, S. Liang, and H. Deng. 2008. How is mRNA expression predictive for
protein expression? A correlation study on human circulating
monocytes. Acta Biochim. Biophys. Sin. (Shanghai) 40:426–436.
Hahn, W. C., C. M. Counter, A. S. Lundberg, R. L. Beijersbergen,
M. W. Brooks, and R. A. Weinberg. 1999. Creation of human
tumour cells with defined genetic elements. Nature 400:464–468.
http://dx.doi.org/10.1038/22780.
Harper, J. W., G. R. Adami, N. Wei, K. Keyomarsi, and S. J.
Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent
inhibitor of G1 cyclin-dependent kinases. Cell 75:805–816.
Hickman, E. S., M. C. Moroni, and K. Helin. 2002. The role of
p53 and pRB in apoptosis and cancer. Curr. Opin. Genet. Dev.
12:60–66.
Himly, M., D. N. Foster, I. Bottoli, J. S. Iacovoni, and P. K. Vogt.
1998. The DF-1 chicken fibroblast cell line: Transformation induced by diverse oncogenes and cell death resulting from infection by avian leukosis viruses. Virology 248:295–304. http://
dx.doi.org/10.1006/viro.1998.9290.
Kawaguchi, T., K. Nomura, Y. Hirayama, and T. Kitagawa. 1987.
Establishment and characterization of a chicken hepatocellular
carcinoma cell line, LMH. Cancer Res. 47:4460–4464.
Kawamura, H., and H. Tsubahara. 1968. Propagation and cytopathic effect of Myxovirus yucaipa in chicken kidney cell culture.
Natl. Inst. Anim. Health Q. (Tokyo) 8:1–7.
Kibenge, F. S., and P. K. McKenna. 1992. Isolation and propagation
of infectious bursal disease virus using the ovine kidney continuous cell line. Avian Dis. 36:256–261.
Kim, H., J. Farris, S. A. Christman, B. W. Kong, L. K. Foster, S. M.
O’Grady, and D. N. Foster. 2002a. Events in the immortalizing
process of primary human mammary epithelial cells by the catalytic subunit of human telomerase. Biochem. J. 365:765–772.
http://dx.doi.org/10.1042/BJ20011848.
1611
Kim, H., S. You, J. Farris, L. K. Foster, and D. N. Foster. 2001a.
Post-transcriptional inactivation of p53 in immortalized murine
embryo fibroblast cells. Oncogene 20:3306–3310. http://dx.doi.
org/10.1038/sj.onc.1204423.
Kim, H., S. You, J. Farris, B. W. Kong, S. A. Christman, L. K.
Foster, and D. N. Foster. 2002b. Expression profiles of p53, p16(INK4a)-, and telomere-regulating genes in replicative senescent primary human, mouse, and chicken fibroblast
cells. Exp. Cell Res. 272:199–208. http://dx.doi.org/10.1006/
excr.2001.5420.
Kim, H., S. You, L. K. Foster, J. Farris, and D. N. Foster. 2001b.
The rapid destabilization of p53 mRNA in immortal chicken embryo fibroblast cells. Oncogene 20:5118–5123. http://dx.doi.
org/10.1038/sj.onc.1204664.
Kim, H., S. You, I. J. Kim, L. K. Foster, J. Farris, S. Ambady, F.
A. Ponce de Leon, and D. N. Foster. 2001c. Alterations in p53
and E2F–1 function common to immortalized chicken embryo
fibroblasts. Oncogene 20:2671–2682. http://dx.doi.org/10.1038/
sj.onc.1204378.
Ko, L. J., and C. Prives. 1996. P53: Puzzle and paradigm. Genes
Dev. 10:1054–1072.
Kong, B. W., L. K. Foster, and D. N. Foster. 2006. Comparison of
avian cell substrates for propagating subtype C avian metapneumovirus. Virus Res. 116:58–68. http://dx.doi.org/10.1016/j.
virusres.2005.08.013.
Kong, B. W., L. K. Foster, and D. N. Foster. 2007. Establishment
of an immortal turkey turbinate cell line suitable for avian metapneumovirus propagation. Virus Res. 127:106–115. http://
dx.doi.org/10.1016/j.virusres.2007.03.028.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative
gene expression data using real-time quantitative PCR and the
2(−Delta Delta C(T)). Methods 25:402–408. http://dx.doi.
org/10.1006/meth.2001.1262.
Marcu, K. B., S. A. Bossone, and A. J. Patel. 1992. Myc function
and regulation. Annu. Rev. Biochem. 61:809–860. http://dx.doi.
org/10.1146/annurev.bi.61.070192.004113.
Murphree, A. L., and W. F. Benedict. 1984. Retinoblastoma: Clues
to human oncogenesis. Science 223:1028–1033.
Myers, T. J., and K. A. Schat. 1989. Propagation of avian rotavirus
in primary chick kidney cell and MA104 cell cultures. Avian Dis.
33:578–581.
Nie, L., G. Wu, and W. Zhang. 2006. Correlation of mRNA expression and protein abundance affected by multiple sequence features related to translational efficiency in Desulfovibrio vulgaris:
A quantitative analysis. Genetics 174:2229–2243. http://dx.doi.
org/10.1534/genetics.106.065862.
Nobori, T., K. Miura, D. J. Wu, A. Lois, K. Takabayashi, and D.
A. Carson. 1994. Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers. Nature 368:753–756.
http://dx.doi.org/10.1038/368753a0.
Parcells, M. S., A. S. Anderson, J. L. Cantello, and R. W. Morgan.
1994. Characterization of Marek’s disease virus insertion and deletion mutants that lack US1 (ICP22 homolog), US10, and/or
US2 and neighboring short-component open reading frames. J.
Virol. 68:8239–8253.
Pascal, L. E., L. D. True, D. S. Campbell, E. W. Deutsch, M. Risk,
I. M. Coleman, L. J. Eichner, P. S. Nelson, and A. Y. Liu. 2008.
Correlation of mRNA and protein levels: Cell type-specific gene
expression of cluster designation antigens in the prostate. BMC
Genomics 9:246. http://dx.doi.org/10.1186/1471-2164-9-246.
Peukert, K., P. Staller, A. Schneider, G. Carmichael, F. Hanel,
and M. Eilers. 1997. An alternative pathway for gene regulation
by Myc. EMBO J. 16:5672–5686. http://dx.doi.org/10.1093/
emboj/16.18.5672.
Pfirschke, C. D. 1989. The use of embryonic chicken liver cell culture
for the diagnosis of virus infections in hens. Arch. Exp. Veterinarmed. 43:345–350.
Prochownik, E. V. 2008. c-Myc: Linking transformation and genomic instability. Curr. Mol. Med. 8:446–458.
Prochownik, E. V., and Y. Li. 2007. The ever expanding role for cMyc in promoting genomic instability. Cell Cycle 6:1024–1029.
Schnitzlein, W. M., J. Radzevicius, and D. N. Tripathy. 1994. Propagation of infectious laryngotracheitis virus in an avian liver cell
line. Avian Dis. 38:211–217.
1612
Lee et al.
Sherr, C. J. 2001. The INK4a/ARF network in tumour suppression. Nat. Rev. Mol. Cell Biol. 2:731–737. http://dx.doi.
org/10.1038/35096061.
Sherr, C. J. 2006a. Divorcing ARF and p53: An unsettled case. Nat.
Rev. Cancer 6:663–673. http://dx.doi.org/10.1038/nrc1954.
Sherr, C. J. 2006b. Autophagy by ARF: A short story. Mol. Cell
22:436–437. http://dx.doi.org/10.1016/j.molcel.2006.05.005.
Taniguchi, Y., P. J. Choi, G. W. Li, H. Chen, M. Babu, J. Hearn,
A. Emili, and X. S. Xie. 2010. Quantifying E. coli proteome and
transcriptome with single-molecule sensitivity in single cells. Science 329:533–538. http://dx.doi.org/10.1126/science.1188308.
Williams, B. O., L. Remington, D. M. Albert, S. Mukai, R. T. Bronson, and T. Jacks. 1994. Cooperative tumorigenic effects of germline mutations in Rb and p53. Nat. Genet. 7:480–484. http://
dx.doi.org/10.1038/ng0894-480.
Wu, C. L., L. R. Zukerberg, C. Ngwu, E. Harlow, and J. A. Lees.
1995. In vivo association of E2F and DP family proteins. Mol.
Cell. Biol. 15:2536–2546.
Wu, L., C. Timmers, B. Maiti, H. I. Saavedra, L. Sang, G. T.
Chong, F. Nuckolls, P. Giangrande, F. A. Wright, S. J. Field,
M. E. Greenberg, S. Orkin, J. R. Nevins, M. L. Robinson, and
G. Leone. 2001. The E2F1–3 transcription factors are essential
for cellular proliferation. Nature 414:457–462. http://dx.doi.
org/10.1038/35106593.
Xiong, Y., G. J. Hannon, H. Zhang, D. Casso, R. Kobayashi, and D.
Beach. 1993. P21 is a universal inhibitor of cyclin kinases. Nature 366:701–704. http://dx.doi.org/10.1038/366701a0.
Yamaguchi, S., and H. Kawamura. 1977. Chicken kidney cell culture
in medium without serum. Natl. Inst. Anim. Health Q. (Tokyo)
17:54–57.
Zauberman, A., D. Flusberg, Y. Haupt, Y. Barak, and M. Oren.
1995. A functional p53-responsive intronic promoter is contained
within the human mdm2 gene. Nucleic Acids Res. 23:2584–2592.