* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Unconventional T Cell Pleiotropy T Cells
Survey
Document related concepts
Transcript
Distinct Cytokine-Driven Responses of Activated Blood γδ T Cells: Insights into Unconventional T Cell Pleiotropy This information is current as of June 18, 2017. David Vermijlen, Peter Ellis, Cordelia Langford, Anne Klein, Rosel Engel, Katharina Willimann, Hassan Jomaa, Adrian C. Hayday and Matthias Eberl J Immunol 2007; 178:4304-4314; ; doi: 10.4049/jimmunol.178.7.4304 http://www.jimmunol.org/content/178/7/4304 References Subscription Permissions Email Alerts http://www.jimmunol.org/content/suppl/2007/03/19/178.7.4304.DC1 This article cites 68 articles, 34 of which you can access for free at: http://www.jimmunol.org/content/178/7/4304.full#ref-list-1 Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 Supplementary Material The Journal of Immunology Distinct Cytokine-Driven Responses of Activated Blood ␥␦ T Cells: Insights into Unconventional T Cell Pleiotropy1 David Vermijlen,*† Peter Ellis,‡ Cordelia Langford,‡ Anne Klein,§ Rosel Engel,§¶ Katharina Willimann,储 Hassan Jomaa,§¶ Adrian C. Hayday,2* and Matthias Eberl3§储 xtending the seminal realization that CD4⫹ T cell function is distinct according to whether IL-12 or IL-4 prevails during T cell priming, it is now appreciated that the production of a plethora of effector molecules can be provoked in CD4⫹ T cells according to the respective influence of the microenvironment. Thus, Th1 cells characterized by IL-2, IFN-␥, and TNF-␣ trigger inflammatory T cell responses to intracellular infections; Th2 cells characterized by IL-4, IL-5, and IL-13 promote humoral and eosinophilic responses, suited to attacks on large extracellular pathogens; Th17 cells characterized by IL-17 and TNF-␣ regulate neutrophil differentiation and tissue-infiltration that combats bacterial infections; regulatory T cells characterized by IL-10 and TGF- limit the scope of potentially pathologic immune responses; and follicular B-helper T (TFH)4 cells characterized E *Peter Gorer Department of Immunobiology, King’s College London, London, United Kingdom; †Institute for Medical Immunology, Université Libre de Bruxelles Gosselies, Belgium; ‡The Wellcome Trust Sanger Institute, Hinxton, Cambridge, United Kingdom; §Biochemisches Institut, Infektiologie, Justus-Liebig-Universität Giessen, Giessen, Germany; ¶Institut für Klinische Chemie und Pathobiochemie, Universitätsklinikum Giessen und Marburg, Giessen, Germany; and 储Institute of Cell Biology, University of Bern, Bern, Switzerland Received for publication August 16, 2006. Accepted for publication January 19, 2007. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by a Marie-Curie Intra-European Fellowship (to D.V.) and by grants from The Wellcome Trust (to A.C.H.), the Deutsche Forschungsgemeinschaft (to H.J.), and the Else Kröner-Fresenius Stiftung (to M.E.). 2 Address correspondence and reprint requests to Dr. Adrian C. Hayday, Peter Gorer Department of Immunobiology, Guy’s, King’s and St. Thomas’ Medical School, King’s College London, London SE1 9RT, U.K. E-mail address: [email protected] 3 Current address: Department of Medical Biochemistry and Immunology, Cardiff University School of Medicine, Cardiff CF14 4XN, U.K. 4 Abbreviations used in this paper: TFH cell, follicular B-helper-like T cell; GC, germinal center; HMB-PP, (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate; ␥c, common ␥-chain; DC, dendritic cell; FDC, follicular DC; LN, lymph node; LT, lymphotoxin; aRNA, antisense RNA. Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 www.jimmunol.org by IL-21 promote high-affinity B cell maturation in germinal centers (GCs) (1, 2). These diverse effector functions profoundly affect the complexion of the host’s response and dysregulation of each of these responses can be associated with inflammatory, allergic, and/or autoimmune diseases. Such realizations have profoundly influenced how we think about the immune system. Nonetheless, they are largely limited to CD4⫹ ␣ T cells which are not the only type of effector/regulatory T cell; rather, it is increasingly appreciated that the immune response is a spatial and temporal integration of distinct cell types that include conventional and unconventional T cells (3). ␥␦ T cells are the prototype of unconventional lymphocytes (4). Serial analysis of gene expression in the mouse depicted a “pseudomemory” or “activated-yet-resting” phenotype of tissueassociated ␥␦ T cells (5), and data in several species point to the rapid and robust responses of ␥␦ T cells, providing a transitional response between innate immunity provided by myeloid and epithelial cells, and adaptive immunity provided by conventional lymphocytes (4). For instance, human V␥9/V␦2 T cells compose ⬃0.5–5% of peripheral lymphocytes but may transiently expand to occupy 50% of the peripheral T cell pool following infection by microbial pathogens that produce the low m.w. compound, (E)-4hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), an intermediate of the alternative, nonmevalonate pathway of isoprenoid biosynthesis (6). There are compelling data that activated ␥␦ T cells play critical roles in tumor surveillance, immunoregulation, and some aspects of immunoprotection, particularly within tissues and during early life (7). Accordingly, ␥␦-deficient animals show impairments in each of these areas. Moreover, ␥␦ T cells share strong similarities with other unconventional T cells (e.g., ␣ T cells expressing CD8␣␣) that are similarly not restricted by classical MHC (8). Therefore, an improved understanding of ␥␦ T ells is required if we are to develop a fuller picture of functional integration within the human immune system. Despite this, there has been scant application of comprehensive molecular tools such as microarrays Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 Human V␥9/V␦2 T cells comprise a small population of peripheral blood T cells that in many infectious diseases respond to the microbial metabolite, (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), expanding to up to 50% of CD3ⴙ cells. This “transitional response,” occurring temporally between the rapid innate and slower adaptive response, is widely viewed as proinflammatory and/or cytolytic. However, increasing evidence that different cytokines drive widely different effector functions in ␣ T cells provoked us to apply cDNA microarrays to explore the potential pleiotropy of HMB-PP-activated V␥9/V␦2 T cells. The data and accompanying validations show that the related cytokines, IL-2, IL-4, or IL-21, each drive proliferation and comparable CD69 up-regulation but induce distinct effector responses that differ from prototypic ␣ T cell responses. For example, the Th1-like response to IL-2 also includes expression of IL-5 and IL-13 that conversely are not induced by IL-4. The data identify specific molecules that may mediate ␥␦ T cell effects. Thus, IL-21 induces a lymphoid-homing phenotype and high, unexpected expression of the follicular B cell-attracting chemokine CXCL13/BCA-1, suggesting a novel follicular B-helper-like T cell that may play a hitherto underappreciated role in humoral immunity early in infection. Such broad plasticity emphasizes the capacity of ␥␦ T cells to influence the nature of the immune response to different challenges and has implications for the ongoing clinical application of cytokines together with V␥9/V␦2 TCR agonists. The Journal of Immunology, 2007, 178: 4304 – 4314. The Journal of Immunology Materials and Methods ␥␦ T cell stimulation assays PBMC were cultured as described (12). ␥␦ T cells, monocytes, or B cells were depleted using TCR␥␦ microbeads (Miltenyi Biotec) or CD14-FITC (RM052) and CD19-FITC Abs (J4.119) (Beckman Coulter), in combination with anti-FITC microbeads (Miltenyi Biotec). Depletion efficiencies were 98.8 ⫾ 1.8% for ␥␦ T cells, 86.0 ⫾ 5.0% for monocytes, and 95.2 ⫾ 0.7% for B cells. Positively selected populations for reconstitutions were 95.1 ⫾ 1.6% ␥␦⫹ and 97.4 ⫾ 0.5% CD14⫹. Synthetic HMB-PP was used at 0.1–1.0 nM, recombinant human cytokines as follows: 100 U/ml IL-2 (Proleukin; Chiron); 10 ng/ml IL-4, IL-7, or IL-15 (Promocell); 10 ng/ml IL-21 (Zymogenetics); 1000 U/ml IFN-␣2a (Roferon; Roche); and 100 U/ml IFN-1a (Rebif; Serono). These concentrations were chosen from optimized titrations. Recombinant human IL-13 (Promocell); IL-17A, IL17B, IL-17C, IL-17E, and IL-17F; and IFN-1 and IFN-2 were tested at 1–100 ng/ml. Flow cytometry Cells were harvested after 18 h to 6 days of culture and were analyzed on a four-color Epics XL flow cytometer supported with Expo32 ADC (Beckman Coulter) (12). Abs used were CD3-PE-Texas Red (UCHT1), V␥9-PC5 (Immu360), CD11a-PE (25.3), CD25-PE (B1.49.9), CD27-PE (1A4CD27), CD45RO-PE (UCHL-1), CD54-FITC (84H10), CD62L-FITC (DREG56), CD69-PE (TP1.55.3), CD94-PE (HP-3B1), CD244-PE (C1.7) (Beckman Coulter); NKG2D-PE (1D11) (BD Biosciences); and KLRG1Alexa 488 (13A2) (22). For detection of intracellular proteins, brefeldin A (Sigma-Aldrich) was added to cultures at 10 g/ml 3 h before harvesting. Surface-stained cells were labeled using the Fix & Perm kit (Caltag Laboratories) and IFN-␥-FITC (45.15), TNF-␣-PE (188), or CD152-PE (BNI3) (Beckman Coulter). Cell purification and RNA isolation ␥␦ T cells were purified from fresh or cultured PBMC using TCR␥␦ microbeads (Miltenyi Biotec), resulting in purities of 93–99% ␥␦⫹ cells (90 – 96% V␥9⫹). Alternatively, V␥9⫹CD3⫹ and CD8⫹CD3⫹ cells were sorted to ⬎99% purity on a MoFlo machine (Cytomation), using CD3-PE-Texas Red (UCHT1), V␥9-PC5 (Immu360), CD8␣-PE (2ST8.5H7) (Beckman Coulter), and TCR␣-FITC Abs (T1089.1A-31) (BD Biosciences). In each case, total RNA was isolated using the RNeasy kit combined with RNasefree DNase treatment (Qiagen). Semiquantitative RT-PCR RNA was reverse transcribed using oligo(dT) primers and Superscript III reverse transcriptase (Promega). Serial dilutions of each cDNA were tested for cyclophilin expression and normalized dilutions were selected. Twentymicroliter PCRs contained 0.25 M primers, 250 M dNTPs, 1.5–2.5 mM MgCl2, and 0.75 U GoTaq polymerase (Promega). Genes were amplified for 28 –35 cycles at 94°C for 30 s, 55– 63°C for 45 s, and 72°C for 60 s, using a Techne TC-512 gradient cycler. Primer pairs were: cyclophilin, AA AGCATACGGGTCCTGGCAT and CGAGTTGTCCACAGTCAGCAATG; CXCL13, TGATCGAATTCAAATCTTGCCCCGTG and AAGCTTGAGT TTGCCCCATCAGCTCC;GATA-3,CTGCAATGCCTGTGGGCTCandGA CTGCAGGGACTCTCGCT; IL-4, CTCTCTCATGATCGTCTTTAGCCTT TC and AACACAACTGAGAAGGAAACCTCTGC; IL-21, GGCAACAT GGAGAGGATTGT and GTTGGGCCTTCTGAAAACAG; and IL-21R, ACACCGATTACCTCCAGACG and CATCCATGTGGCAGGTGTAG. Analyses were performed on three individual donors, in two independent cultures each. Real-time RT-PCR Total RNA was reverse transcribed using random hexamers, with TaqMan reagents (Applied Biosystems). Real-time PCRs were performed using SYBR Green master mix, on a ABI Prism 7900HT sequence detection system running under SDS2.2 (Applied Biosystems). Primer pairs were designed using Primer Express 2.0 (Applied Biosystems): cyclophilin, TGCTGGACCCAACACAAATG and TGCCATCCAACCACTCAGT CT; CXCL13, CATCTCGACATCTCTGCTTCTCA and TGGACACATC TACACCTCAAGCTT; IL-4, CACAAGCAGCTGATCCGATTC and AA CGTACTCTGGTTGGCTTCCTT; and lymphotoxin (LT)-␣, TGTTGGCC TCACACCTTCAG and TGCTGTGGGCAAGATGCA. Relative gene quantification was performed in duplicate using the standard curve method. Microarray analysis Total RNA was quantified and the A260:280 ratio was checked using a NanoDrop 1000A spectrophotometer. Two hundred nanograms of total RNA (corresponding to 200,000 – 400,000 cells) was amplified by in vitro transcription using the Amino Allyl MessageAmp II aRNA Amplification kit (Ambion). In brief, RNA was reverse transcribed using a T7 Oligo(dT) primer to generate first strand cDNA, containing a T7 promoter sequence. After second-strand synthesis with DNA polymerase and RNase H, the cDNA was purified and transcription performed using amino allyl-labeled dUTPs to generate antisense RNA (aRNA). All steps were quantified using a NanoDrop spectrophotometer, and nucleic acid integrity confirmed by OD and gel electrophoresis, so that the comparability of RNA preparation and processing was assured for each sample. Following aRNA purification, the amino allyl UTP residues on the aRNA were coupled to either Cy3 or Cy5 dye (Amersham Biosciences). The labeled aRNA was then hybridized on Hver2.1.1 cDNA arrays containing ⬃15,000 spots (www.sanger.ac.uk/ Projects/Microarrays/informatics/hver2.1.1.shtml). In each case, dye-swap hybridizations were performed. Arrays were scanned with a PerkinElmer Scanarray Express Microarray Scanner using ScanArray software 3.0. Microarray data and procedures were deposited at ArrayExpress (www.ebi. ac.uk/arrayexpress), under accession number E-MEXP-763. Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 to fully assess the potential pleiotropy of ␥␦ T cell function in different cytokine contexts (9 –12). Issues of particular importance include whether or not ␥␦ T cell responses simply comply with the prototypic responses of ␣ T cells, or whether yet further functional diversification is apparent (13). Such issues have been analyzed here via the application of high-quality cDNA microarrays to human ␥␦ T cells stimulated by IL-2, IL-4, or IL-21. We examined IL-2, IL-4, and IL-21 because they share the common ␥-chain (␥c) in their respective receptors, and yet each possesses distinct costimulatory activities as conventional T cell growth factors (14). IL-2 is typically released by ␣ T cells following Th1 priming by IL-12-secreting dendritic cells (DCs) and regulates T and NK cell growth and survival and the scale of an ensuing Th1 response. IL-4 is released by activated ␣ T cells, mast cells, and basophils under Th2 conditions and can directly and indirectly promote humoral responses, including allergies. And IL-21 is expressed predominantly by TFH cells (15), which are pivotal in the selection of high-affinity GC centrocytes that have undergone somatic hypermutation (3). IL-21 induces B lymphocyte-induced maturation protein-1 and the GC-associated transcription factor BCL-6 and promotes B cell differentiation into Ab-secreting plasma cells (16). Consequently, IL-21R⫺/⫺ mice have reduced IgG1 and IgG2b serum levels, whereas elevated IL-21 levels are present in nonobese diabetic mice; in BXSBYaa mice, that are prone to a lupus-like disease; and in sanroque mice that carry a mutation in the RING-type E3 ubiquitin ligase roquin, leading to spontaneous GC formation and hightiter autoantibodies (17–19). A unique aspect of the present array analysis is that the cytokines were applied in the context of HMB-PP, which is readily active in vitro at picomolar concentrations and thereby more potent than any other natural compound, such as isopentenyl pyrophosphate (⬃104⫻), 3-formyl-1-butyl pyrophosphate (⬃105⫻), or alkylamines (106–108⫻); indeed, all biological and chemical indications are that HMB-PP is the most physiologic of all currently identified activators of human V␥9/V␦2 T cells (20, 21). The data obtained demonstrate that V␥9/V␦2 T cell functions are highly pleiotropic, very much steered by the prevailing cytokine milieu. Intriguingly however, each of the ␥␦ T cell responses shows seemingly unique features by comparison to the corresponding ␣ T cell response. Additionally, the data offer a molecular basis for previous reports that murine and human ␥␦ T cells can help B cell maturation, by providing evidence that IL-21-stimulated V␥9/V␦2 T cells may exist as a distinct type of follicular T cell, similar to, but with a distinct molecular signature, from recently characterized CD4⫹TCR␣⫹ TFH cells. Thus, our studies unequivocally identify signatory profiles that characterize the pleiotropic ␥␦ T cell compartment in human blood. 4305 4306 FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS FIGURE 1. Flow cytometric analysis of activated ␥␦ T cells. PBMC were cultured in the absence (f) or presence (_) of HMB-PP, together with the cytokines indicated, and analyzed by flow cytometry. Cell proliferation was assessed by expansion of V␥9⫹CD3⫹ cells within the CD3⫹ lymphocyte population (n ⫽ 12). Expression of CD69 on V␥9⫹ CD3⫹ cells was determined after 18 h (n ⫽ 8), expression of ICAM-1 (n ⫽ 6), and LFA-1 (n ⫽ 4) after 6 days. CXCL10, CXCL13, and TRAIL in culture supernatants were detected with human DuoSet ELISA developing kits (R&D Systems). IL-3, IL-5, IL-13, GM-CSF, IFN-␥, TNF-␣, CCL2, and CCL3 were detected with a Beadlyte Human 22-Plex multicytokine detection system (Upstate Biotechnology). Immunohistochemistry Paraffin-embedded gut follicles were pretreated by Streptomyces griseus proteinase (Sigma-Aldrich) and incubated overnight at 4°C with primary Abs against pan-␥␦-TCR (A20; Santa Cruz Biotechnology), CXCL13 (AF470; R&D Systems), or appropriate isotype controls. Subsequent detection and visualization of bound Abs was performed by the ABC method as described (23). Statistical analysis Differential gene expression was analyzed using Limma (linear models for microarray data; www.bioconductor.org). Analysis included background correction with an offset value of 50, within array normalization, fitting a linear model (lmfit), e-Bayes statistics, and adjustment for multiple testing according to Benjamin and Hochberg. Differentially expressed genes were FIGURE 2. IL-2-dependent gene expression. Expression of IFN-␥ (n ⫽ 3– 6) and TNF-␣ (n ⫽ 6) in V␥9⫹ CD3⫹ cells was analyzed by intracellular flow cytometry after 72 h. GMCSF (n ⫽ 4), CCL3 (n ⫽ 3), and IL-13 (n ⫽ 4) were detected in 72 h culture supernatants, IL-5 (n ⫽ 2) after 6 days. Solid and hatched bars as in Fig. 1 legend. Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 ELISA and Luminex analysis The Journal of Immunology 4307 selected on the Benjamin and Hochberg-adjusted p value ( p ⬍ 0.05), and ranked according to their M value. M ⫽ log2[Cy5/Cy3] represents the differential ratio, with M ⫽ 1 corresponding to a Cy5:Cy3 ratio of 21 ⫽ 2; M ⫽ 2 corresponding to 22 ⫽ 4; etc. M values for IL-2-enriched genes appear positive in the IL-2 vs IL-4, and IL-2 vs IL-21 comparisons; hence, IL-4- or IL-21-enriched genes have negative M values. A ⫽ 1⁄2 ⫻ (log2(Cy5) ⫹ log2(Cy3)) is a measurement of the average signal intensity. All other statistical analyses were performed using two-tailed Student’s t tests for paired data. Differences between samples with and without added cytokine were considered significant as indicated in the figures: ⴱ, p ⬍ 0.05. Data shown in bar diagrams represent means and SEs of the indicated numbers of PBMC samples obtained from different donors. Results Selective expansion and activation of HMB-PP-specific V␥9/V␦2 T cells by ␥c cytokines Microarrays identify different responses to different cytokines By 72 h, HMB-PP plus IL-2 stimulated V␥9/V␦2 T cells are potent producers of proinflammatory cytokines (25). Hence, this time point was chosen to apply Hver2.1.1 microarrays containing ⬃15,000 cDNAs to compare V␥9/V␦2 T cells stimulated with HMB-PP plus IL-2, IL-4, and IL-21, respectively. Additionally, a comparison of activated and dividing V␥9/V␦2 T cells with fresh resting cells was made from a second donor at 6 days, at which time point, V␥9/V␦2 T cells proliferate extensively in the presence of HMB-PP plus IL-2 (Fig. 1; Ref. 25). Differential gene expression was defined statistically using Limma bioinformatics software, by calculating log2-relative gene expression (M) and average expression intensity (A) values. By this means, 513 differentially expressed genes were identified in IL-2- vs IL-4-treated cells, and 328 differentially expressed genes defined IL-2 vs IL-21 treatment. These numbers were comparable to each other, yet much lower than those obtained comparing activated vs fresh V␥9/V␦2 T cells (1924 genes). Molecular characteristics of the V␥9/V␦2 T cell response to IL-2 The molecular characterization of the V␥9/V␦2 T cell response to HMB-PP plus IL-2 stimulation revealed a prototypic proinflammatory Th1-type phenotype, but with unexpected and distinct features. When comparing IL-2-stimulated, proliferating cells on day 6 with freshly isolated cells, there was up-regulation of core Th1type molecules such as IFN-␥ (M ⫽ ⫹3.25), LT-␣ (M ⫽ ⫹2.30), TNF-␣ (M ⫽ ⫹2.26), CCL3/MIP-1␣ (M ⫽ ⫹2.11), and GM-CSF (M ⫽ ⫹1.02). This was independently corroborated when HMBPP-treated cells from a different donor were compared after 72 h FIGURE 3. IL-4-dependent gene expression. A, Expression of IL-4 and LT-␣ mRNAs by ␥␦ T cells purified from PBMC after 72 h, as analyzed by real-time RT-PCR. Expression levels were normalized to values in medium controls and represent mean values and SDs from duplicate experiments. B, Expression of IL-4 and GATA-3 mRNAs by ␥␦ T cells purified from PBMC after 72 h. Semiquantitative RT-PCR data shown are representative of three blood donors. C, Surface expression of CD27 (n ⫽ 6 –7) as analyzed by flow cytometry on day 6. for the effects of IL-2, IL-4, and IL-21 (supplementary table I).5 The data were confirmed by a series of validations using the same and different donors; protein data for IFN-␥, TNF-␣, GM-CSF, CCL3/MIP-1-␣, and TRAIL (M ⫽ ⫹1.18) (Fig. 2 and data not shown) are consistent with recent analyses of proinflammatory ␥␦ T cells (26, 27), and emphasize that IL-2-stimulated cells are considerably more proinflammatory than IL-4- or IL-21-stimulated cells. Of note, the Hver2.1.1 system tended to underestimate differences, as with other microarrays. To establish a more detailed comparison of genes induced in human V␥9/V␦2 T cells and ␣ T cells under Th1 conditions (28 –31), we noted that both cell types up-regulated oncostatin M (M(IL-2 vs IL-4) ⫽ ⫹1.99), PMA-induced protein 1 (M ⫽ ⫹1.92), suppressor of cytokine signaling 2 (M ⫽ ⫹1.47), CD66a/carcinoembryonic Ag-related cell adhesion molecule 1 (M ⫽ ⫹1.43), CCR1 (M ⫽ ⫹1.31), CD150/signaling lymphocytic activation molecule (M ⫽ ⫹1.10), granulysin (M ⫽ ⫹1.03), CCR5 (M ⫽ ⫹0.97), and regulator of G protein signaling 16 (M ⫽ ⫹0.83). This sharp and broad Th1 differentiation of V␥9/V␦2 T cells is striking considering that the cultures were supplemented with synthetic (LPS free) HMB-PP and IL-2 in the absence of any overt activators of DC; induction of monocyte differentiation toward immature 5 The online version of this article contains supplemental material. Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 Addition of HMB-PP to PBMC up-regulated the activation marker CD69 on ⬎50% of V␥9/V␦2 T cells and this was further enhanced by cotreatment with IL-2, IL-4, and IL-21 (Fig. 1), or by IFN-␣ and IFN- (data not shown). Conversely, the HMB-PP-dependent expansion of V␥9/V␦2 T cells over a 6-day period was promoted only by the cytokines signaling via the ␥c-chain receptors: IL-2, IL-4, and IL-21 (with IL-4 having a smaller but nevertheless significant effect) (Fig. 1) and IL-7 and IL-15 (data not shown). No expansion was supported by type I IFNs (IFN-␣, IFN-), type III IFNs (IFN-1 (IL-29), IFN-2 (IL-28A)), IL-13, or the IL-17 family members IL-17A, IL-17B, IL-17C, IL-17E (IL-25), and IL17F (data not shown). IL-2, IL-4, and IL-21 treatment also increased the percentage of V␥9/V␦2 T cells expressing LFA-1 (CD11a) and ICAM-1 (CD54) (Fig. 1), as well as NKG2D and CD94 (data not shown), implying an enhanced capacity of expanding V␥9/V␦2 T cells to engage target cells (24). These data emphasize the profound capacity of HMB-PP plus IL-2, IL-4, or IL-21 to activate, expand, and differentiate human V␥9/V␦2 T cells. 4308 FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS DCs and their subsequent maturation by activated ␥␦ cells is unlikely to occur in our PBMC cultures within 72 h (32). This indicates that a population of peripheral blood V␥9/V␦2 T cells is precommitted to Th1-type differentiation upon signaling via the TCR and CD25. However, unlike conventional Th1-type responses, V␥9/V␦2 T cells treated with HMB-PP plus IL-2 unexpectedly up-regulated the Th2 cytokines IL-13 (M(IL-2 vs IL-4) ⫽ ⫹0.86) and IL-5 (Fig. 2). Neither was substantially induced by IL-4 or IL-21, arguing against the idea that this was simply a cytokine reactivation of Th2-like V␥9/V␦2 T cells. Molecular characteristics of the V␥9/V␦2 T cell response to IL-4 The bulk of the qualitative response to TCR plus IL-4 stimulation is shared by human V␥9/V␦2 and ␣ T cells, e.g., T cell factor 1 (M(IL-2 vs IL-4) ⫽ ⫺2.13), EBV-induced receptor 2 (M ⫽ ⫺1.75), Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 FIGURE 4. IL-21-dependent gene expression. A, Surface expression of CD25 (n ⫽ 6), intracellular expression of CD152 (n ⫽ 6), and CXCL10 secretion into the culture supernatants (n ⫽ 4 –9) were detected after 72 h. Surface expression of CD244 (n ⫽ 8 –11), KLRG1 (n ⫽ 3), and CD62L (n ⫽ 5) was measured after 6 days (note that KLRG1 expression is depicted as mean fluorescence values as at baseline V␥9/V␦2 T cells were already ⬃80% KLRG1⫹). Solid and hatched bars as in Fig. 1 legend. B, Expression of IL-21 and IL-21R mRNAs by ␥␦ T cells purified from PBMC after 72 h in culture was analyzed by semiquantitative RT-PCR; data shown are representative of three individual blood donors (ctrl, whole PBMC stimulated with PHA). T lymphocyte maturation-associated protein (M ⫽ ⫺1.27), XCL1/ lymphotactin (M ⫽ ⫺1.19), IL-10R␣ (M ⫽ ⫺0.88), and special AT-rich sequence-binding protein 1 (M ⫽ ⫺0.79), that were described in previous studies of total human T cells polarized under Th2 conditions (28 –31). Likewise, elevated expression of IL17BR (M ⫽ ⫺1.19), which was recently described on human CD4 T cells polarized under Th2 conditions may confer increased responsiveness to the Th2 favoring cytokine IL-17E (IL-25) (15, 33). The reciprocal expression of LT-␣ and IL-4 illustrates the mutual Th1-type and Th2-type responses of V␥9/V␦2 T cells to IL-2 and IL-4, respectively, with IL-21 inducing neither such state (Fig. 3A). At the same time, while the Th2-specific transcription factor GATA-3 was obviously up-regulated in IL-4-treated, HMB-PPactivated cells (M(IL-2 vs IL-4) ⫽ ⫺1.33), it was nonetheless clearly detectable in IL-2-stimulated cells (Fig. 3B). The Journal of Immunology 4309 Table I. Genes preferentially expressed in the presence of IL-21 M Gene ⫺2.16 FMR-1 ⫺2.12 ⫺1.80 ⫺1.50 ⫺1.41 ⫺0.95 ⫺0.87 ⫺0.87 ⫺0.83 ⫺0.81 ⫺0.71 ⫺0.71 ⫺0.68 ⫺0.66 ⫺0.65 ⫺0.64 ⫺0.63 Fragile X mental retardation protein 1 Implication in GC Physiology and/or Lymphocyte Homing Possible suppression of proinflammatory cytokines, similarly to the fragile X-related protein FXR1P CXCL13 (BCA-1) B cell-attracting chemokine Produced by follicular stromal cells and TFH cells, defines the GC by attracting CXCR5⫹ cells to the follicle CXCL10 (IP-10) IFN-␥-inducible protein, 10 kDa Increased expression in GCs in comparison with mantle and marginal zone MafB v-maf homolog B TFH-associated as confirmed in microarray studies TrkA High-affinity NGF receptor Expressed in paracortical zones but also inside follicles, presumably by FDCs Trps1 Trichorhinophalangeal syndrome I TFH-associated as confirmed in microarray studies SNARK SNF1/AMP-activated protein kinase TFH-associated as confirmed in microarray studies CD266 TWEAK receptor (Fn14) Suppression of proinflammatory cytokine expression upon TNF-like weak inducer of apoptosis binding DCNP1 Dendritic cell nuclear protein 1 Abundantly expressed in mature DCs and at a lower level in immature DCs but not in monocytes and B cells PD-L1 (B7-H1) Programmed death-1 (PD-1) ligand 1 Expressed in GC; possibly involved in regulating affinity maturation as PD-1⫺/⫺ mice develop lupus-like symptoms Notch-1 Notch homolog 1, translocation-assoc. TFH-associated as confirmed in microarray studies Granzyme K Serine protease, tryptase II TFH-associated as confirmed in microarray studies CD244 (2B4) Natural killer cell receptor TFH-associated as confirmed in microarray studies CXCR6 Chemokine receptor May recognize CXCL16 on the follicle-associated epithelium IL-21R IL-21 receptor TFH-associated as confirmed in microarray studies Decysin Disintegrin metalloproteinase Strongly expressed in mature DCs, possibly involved in GC reaction Dectin-1 -glucan receptor Abundant in paracortical and medullary regions but also within follicles and around the GC TGF-RII TGF- receptor type 2 In human tonsils mainly expressed by FDCs Clusterin Apolipoprotein J Survival factor for GC B cells with an efficiency comparable to CD40 agonists; marker for murine FDCs USF1 Upstream transcription factor 1 Implicated in promoting expression of fragile X mental retardation protein 1 (FMR-1) CD226 (DNAM-1) DNAX accessory molecule 1 Drives migration of mature DCs via binding CD112 and CD155 in the parafollicular T-cell region and around high endothelial venules Fc⑀RI High-affinity IgE receptor Expressed in tonsillar GCs with some staining in the mantle zone Plexin-B1 High-affinity semaphorin receptor Expressed by FDCs, mature DCs, activated T cells; binds CD100 on T and B cells in interfollicular areas and the GC A parallel functional potential of TCR plus IL-4 activated ␣ T cells and V␥9/V␦2 T cells was evident in specific genes that may facilitate B cell help. Thus, while IL-2-treated V␥9/V␦2 T cells lost expression of CD27, a TNFR family member that engages CD70 on B and T cells, IL-4 up-regulated CD27 mRNA (M(IL-2 vs IL-4) ⫽ ⫺1.05) and its surface expression (Fig. 3C). There was likewise IL-4-induced up-regulation of B cell maturation protein (CD269) (M ⫽ ⫺1.05), that interacts with B cell-activating factor belonging to the TNF family (BLyS, CD257) in the GC. However, set against this backdrop, the lack of IL-5 and IL-13 production by IL-4-treated, HMB-PP activated V␥9/V␦2 T cells (Fig. 2) is striking and consistent with similar results reported for V␥9/V␦2 T cells treated with IL-4 in the presence of anti-IL-12 (11). Collectively, these data highlight a distinction between the Th2-type response of human peripheral blood ␥␦ T cells and that shown by conventional ␣ T cells. Molecular characteristics of the V␥9/V␦2 T cell response to IL-21 The arrays revealed the V␥9/V␦2 T cell response to HMB-PP plus IL-21 stimulation to combine a limited proinflammatory phenotype with additional potential to promote B cell maturation. Some IL-21-induced effects were clearly shared with IL-2, e.g., surface up-regulation of CD25 and KLRG1, intracellular accumulation of CD152, and secretion of the chemokine CXCL10/IFN-␥-inducible protein-10 (Fig. 4). In the case of the costimulatory receptor CD244 (2B4), synergistic up-regulation by IL-21 and HMB-PP Ref. 37 15, 34, 35 36 15, 35 38 15 15 39 40 41 35 15 15 42 15 43 44 45 46 47 48 49 50 signaling was particularly evident. However, there was a generally reduced level of proinflammatory mediators induced by IL-21 compared with IL-2 (Fig. 2) despite the fact that these treatments displayed similar array intensities for the master regulator of Th1 development, T-bet (A ⫽ 13.53), as confirmed by RT-PCR (data not shown). There was similarly equivalent expression of the Tbet-related factor, eomesodermin (A ⫽ 10.81). In this context, the microarray analysis revealed that several genes that may suppress proinflammatory responses were preferentially expressed in the presence of IL-21 (Table I), e.g., the translational repressor fragile X mental retardation protein 1 (M(IL-2 vs IL-21) ⫽ ⫺2.16), and the receptors for the TNF-like weak inducer of apoptosis (TWEAK-R, CD266) (M ⫽ ⫺0.87), and for TGF- (TGF-RII) (M ⫽ ⫺0.71). IL-21 selectively induces expression of CXCL13 and other follicular molecules Other aspects of the IL-21-induced phenotype were most evidently shared with IL-4. For example, the sustained levels of the lymph node (LN) homing receptor CD62L, and expression of the IL-21R (M(IL-2 vs IL-21) ⫽ ⫺0.73), which was much greater in IL-21 compared with IL-4-treated cells. Thus, lymph-node homing V␥9/ V␦2 T cells may be particularly sensitive to IL-21 produced by follicular TCR␣⫹ TFH cells, whereas they may not themselves be TFH cells because they do not express IL-21 (Fig. 4B). Nonetheless, in addition to IL-21R and CD244 (M ⫽ ⫺0.74), other signatures of TFH cells were apparent (15, 34, 35), e.g., MafB Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 ⫺0.79 ⫺0.78 ⫺0.74 ⫺0.74 ⫺0.73 ⫺0.72 Description 4310 FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS (M(IL-2 vs IL-21) ⫽ ⫺1.50), Trps1 (M ⫽ ⫺0.95), SNF1/AMPactivated protein kinase (M ⫽ ⫺0.87), granzyme K (M ⫽ ⫺0.78), and dectin-1 (M ⫽ ⫺0.71) (Table I). Of note, the homeostatic B cell-attracting chemokine CXCL13/ BCA-1 was the second most differentially expressed gene in the IL-2 vs IL-21 comparison (M ⫽ ⫺2.12) (Table I; Fig. 5A). This was validated by PCR, and by detection of CXCL13 in culture supernatants, in which assay IL-4 induced only a marginal increase (Fig. 5, B–D). The amount of CXCL13 secreted by HMB-PP-stimulated PBMC depended on the IL-21 concentration, with 73 ⫾ 13, 190 ⫾ 76, 613 ⫾ 171, and 689 ⫾ 201 pg/ml CXCL13 detected in the presence of none, 0.1, 1.0, and 10 ng/ml IL-21 respectively (n ⫽ 3). At these IL-21 concentrations, no proinflammatory cytokines are induced (Ref. 25, and this study). Depletion from PBMC of ␥␦ T cells, but not monocytes or B cells, abrogated the HMBPP/IL-21-dependent CXCL13 secretion, which could be restored by reconstitution with purified ␥␦⫹ cells (Fig. 5E). Likewise, Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 FIGURE 5. IL-21-dependent expression of CXCL13. A, M/A plot of IL-21-stimulated vs IL-2-stimulated V␥9/V␦2 T cells. The locations of the IL-2-induced genes encoding for GM-CSF and LT-␣ and the IL-21-induced gene encoding for CXCL13 are indicated. B and C, Expression of CXCL13 mRNA by ␥␦ T cells purified from PBMC cultured for 72 h in medium alone or with HMB-PP and the cytokines indicated. Semiquantitative RT-PCR data shown are representative of three blood donors; real-time data are mean values and SDs from duplicate experiments. D, Detection of CXCL13 protein in the supernatant of PBMC cultured for 72 h with and without HMB-PP, in the presence of the cytokines indicated (n ⫽ 6 –9). E, CXCL13 production by PBMC cultured for 72 h in medium alone or with HMB-PP plus IL-21 after depletion of ␥␦ T cells, monocytes, or B cells (n ⫽ 3). F, CXL13 production by purified ␥␦ T cells in the absence or presence of monocytes as feeder cells after 72 h (n ⫽ 4). G, Inhibition of the IL-21-induced ␥␦ T cell proliferation by IFN-. PBMC were cultured for 6 days with HMB-PP plus IL-2 or HMB-PP plus IL-21 in the absence or presence of IFN- (n ⫽ 3). H, Inhibition of the IL-21-dependent CXCL13 expression by IFN-. PBMC were cultured for 72 h with HMB-PP plus IL-2 or HMB-PP plus IL-21 in the absence or presence of IFN- (n ⫽ 5). HMB-PP plus IL-21 stimulation of purified ␥␦⫹ cells evoked CXCL13 expression, but much less than by total PBMC, showing that a trans-effect of accessory cells such as monocytes is likely required for maximal levels of secretion (Fig. 5F). IFN-␣ and IFN- (but not IFN-1 and IFN-2) selectively blocked IL-21driven proliferation and CXCL13 secretion (Fig. 5, G and H, and data not shown). The surprising finding that IL-21 induces CXCL13 secretion and maintains CD62L expression by HMB-PP-activated V␥9/V␦2 T cells strongly suggests that such cells can play a role in lymphoid follicles and in GC physiology. Although the CXCL13 levels harvested from our cultures were below the sensitivity threshold of chemotactic assays with tonsillar B cells (data not shown), immunohistochemistry identified CXCL13-producing cells within clusters of ␥␦ T cells in a gut-derived lymphoid follicle (Fig. 6A). Likewise, HMB-PP/IL-21-stimulated V␥9/V␦2 T cells also secreted abundant CXCR3 ligand, CXCL10/IP-10 (Table I; Fig. 4), The Journal of Immunology 4311 which is preferentially expressed in the GC compared with the mantle and marginal zone (36). In this light, the arrays revealed that IL-21-treated HMB-PP-activated cells differentially expressed several specific genes associated with B cell follicles, follicular DCs (FDCs), and/or the GC reaction, e.g., TrkA (M(IL-2 vs IL-21) ⫽ ⫺1.41), DC nuclear protein 1 (DCNP1) (M ⫽ ⫺0.83), PD-L1 (B7-H1) (M ⫽ ⫺0.81), CXCR6 (M ⫽ ⫺0.74) decysin (M ⫽ ⫺0.72), clusterin (M ⫽ ⫺0.68), the adhesion molecule CD226 (DNAM-1) (M ⫽ ⫺0.65), FcRI (M ⫽ ⫺0.64), and plexin-B1 (M ⫽ ⫺0.63) (Table I). Discussion This study has used the most potent known biological activator of V␥9/V␦2 T cells, HMB-PP, to provide clear and novel molecular Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 FIGURE 6. A role for ␥␦ T cells in regulating follicular B cell maturation. A, Immunohistochemical analysis of serial sections of an active gut follicle from a patient with Yersinia ileitis, with ␥␦ T cells and CXCL13, respectively, stained in red. Colocalization of CXCL13-producing cells and ␥␦ T cells is indicated by arrows. Note that a similar picture of the same section stained for ␥␦ T cells was already published earlier (23), but has been included here for the sake of optimum comparison. B, Proposed interaction between ␥␦ T cells, B cells, and TFH cells in secondary lymphoid tissue. Expression of CCR7 by naive and central memory ␣ T cells permits entry to the LNs, and subsequent colocalization with CCR7⫹ DC in the T zone that is defined by the CCR7 ligands CCL19 and CCL21. T cell priming results in the generation of TFH cells expressing CXCR5, thereby conferring responsiveness to the B zonespecific chemokine CXCL13. After relocalization of TFH cells and CXCR5⫹ B cells to the follicles, mutual interaction through ICOS and CD40 with their respective ligands induces plasma cell maturation on one hand, and gives rise to effector ␣ T cells on the other hand (see also Refs. 2 and 60). Upon infection with microbial pathogens, peripheral ␥␦ T cells recognize HMB-PP at sites of inflammation and contribute to the local immune response by secretion of proinflammatory cytokines and chemokines, and lysis of infected cells. Alternatively or additionally, they acquire a LN homing phenotype by up-regulation of CCR7 and CD62L (Ref. 23 and this study), and HMB-PP released in the periphery may reach local LN through tissue drainage and act on LN resident ␥␦ T cells. Data presented here show that ␥␦ T cells moving into the GCs will respond to TFH-derived IL-21 by producing CXCL13 and CXCL10, thus contributing to the molecular definition of the B zone and aiding further recruitment of CXCR5⫹ B cells, TFH cells, and monocytes. HMB-PP triggered ␥␦ T cells may also directly present microbial Ags to TFH cells at an early stage of infection (65). 4312 IL-21R expression (63), may help maintain the separation between T and B zones. IL-4 and IL-21 each induced in HMB-PP-specific V␥9/V␦2 T cells distinct molecules associated with humoral immunity, suggesting complementary mechanisms of B cell help by activated ␥␦ T cells, that evoke the finding that IL-21R⫺/⫺IL-4R⫺/⫺ double knockout mice exhibit substantially greater impairment of IgG and IgE responses than do single knockout strains (17, 64). These data, combined with the capacity of ␥␦ T cells to provide B cell help in vitro as potently as do TFH cells (23, 59), justify including follicular B cell responses in the sequelae of infection-driven human ␥␦ T cell activation, as suggested in Fig. 6B. Such activities may promote B cell responses outside the constraints of MHC restriction, and might be further enhanced by the capacity of V␥9/V␦2 T cells to present Ag to naive ␣ T cells (65), albeit none of the signatory genes (e.g., CD40, CD80, CD86, and HLA-DR) reportedly expressed on V␥9/V␦2 T-APCs was obviously up-regulated in IL-4- or IL-21-treated cells. Although the evidence of pleiotropy among ␥␦ T cells evokes the increasing evidence for pleiotropy among ␣ T cells, the molecular rules may be different. For example, the unusual profile of a cell population producing IFN-␥, IL-5, and IL-13, but no IL-4, might result from the expression of T-bet and residual levels of GATA-3 that we show are expressed in IL-2-treated cells. Nonetheless, it seems a priori surprising that IL-4-stimulated cells fail to express IL-5 and IL-13 while maintaining high expression of GATA-3. In sum, the transcriptional control mechanisms for ␥␦ cells need clarifying, especially considering that pharmacological approaches are being considered to regulate some of the “master” transcription factors, based almost entirely on data from ␣ T cells. Additionally, an activated T cell that produces IFN-␥, IL-5, and IL-13 may simultaneously promote eosinophilia, IgE-production, and inflammation, suggesting the prudence of re-examining the involvement of human ␥␦ T cells in mixed Th1/Th2 pathologies such as asthma. In sum, our data accentuate the highly pleiotropic nature of human V␥9/V␦2 T cells and show a broad and perhaps unanticipated plasticity, as the same cell population may readily and rapidly assume distinct Th1- and Th2-like effector functions, and/or potentially provide B cell help in secondary lymphoid tissues. This gives great scope for these cells to bridge innate and acquired immunity in a variety of contexts. The relevance of the in vitro findings presented here extends to attempts to promote non-MHCrestricted antitumor efficacy by administration of V␥9/V␦2 TCR agonists such as zoledronate, together with different cytokines and cofactors (66). Although codelivery of a low dose of IL-2 appears crucial for optimal cytotoxicity, excessive production of proinflammatory mediators may de facto promote tumor growth in some scenarios (67). By contrast, the considered use of IL-21 in carcinoma trials (68) might actually diminish the proinflammatory response. Acknowledgments We thank Armin Reichenberg and Martin Hintz for providing HMB-PP; Donald Foster for IL-21; Patrick Oschmann for Roferon and Rebif; Austin Gurney for IL-17s; Sergei Kotenko for IFN-s; and Hanspeter Pircher for anti-KLRG1; Wayne Turnbull for the cell sorting; Marina Zafranskaya, Stefanie Wagner, and Katy Wendt for their vital contribution; Ewald Beck for his support; and Bernhard Moser, Andrew Roberts, and Dan Pennington for stimulating discussions. Disclosures The authors have no financial conflict of interest. Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 definitions of the cells’ pleiotropy in vitro. Although there was existing evidence that murine and human ␥␦ T cells could display Th1- and Th2-like phenotypes in response to different stimuli (11, 51, 52), the array data and the accompanying validations present unique features of such polarized responses of human peripheral blood ␥␦ T cells. As examples, the proinflammatory response to HMB-PP plus IL-2-mediated stimulation includes IL-5 and IL-13 that conversely are lacking from the Th2-like response of the same cells to IL-4. Although the arrays used here do not yet provide full genome coverage, the data are already sufficient to demonstrate a broader responsiveness of human ␥␦ T cells than previously reported. The results seem to parallel the increasing effector/regulatory pleiotropy apparent for CD4⫹ ␣ T cells (1, 2). Given their rapid and expansive responses in the context of ␥c cytokines, HMB-PP-activated ␥␦ T cells may profoundly influence the different functional responses to qualitatively distinct challenges (3), which has been termed “transitional immunity.” In this context, the data presented here identify specific molecules that may facilitate ␥␦ T cell actions, that may prove useful biomarkers for particular types of immune response, and that may provide a means to regulate particular immune functions. Among the specific genes identified as differentially expressed by ␥␦ T cells in the context of different cytokines, the genes associated with B cell help are perhaps some of the most striking. There have been earlier reports that ␥␦ T cells can help B cells. Thus, there is a strong association of ␥␦ T cells with GCs in TCR␣⫺/⫺ and TCR⫺/⫺ mice (53, 54), there are tight clusters of V␥9/V␦2 T cells in human gastrointestinal and mucosa-associated GC (23), and in mice and humans there is an association of exaggerated ␥␦ T cell activity with high titers of class-switched, selfreactive Abs, independent of MHC-restricted ␣ T cells (55, 56). However, there have heretofore been few clues as to the molecules that may underpin ␥␦ T cell help of B cells. The present study provides a set of strong candidates that may now be functionally interrogated. Besides IL-4 itself (which is a potent B cell growth and differentiation factor), IL-4-stimulated ␥␦ T cells differentially expressed CD27 that may facilitate interaction with CD70⫹ cells, including GC B cells, and/or T cells within and around the GC (57). Indeed, recent data imply that CD27 expression on T cells as well as on B cells contributes to GC formation (58). Also upregulated in IL-4-treated cells was B cell maturation protein, which has been attributed a role in maintaining the survival of long-lived plasma cells and promoting Ag presentation by B cells. IL-21 shared with IL-4 the maintenance and/or enhancement of CD62L expression that, together with the up-regulation of the lymph node homing receptor CCR7 by activated V␥9/V␦2 T cells (23), may permit them to enter lymphoid tissue (28), where the cells’ expression of CXCR3 and/or CXCR5 may promote entry into follicles (23, 59). In this context, the IL-21-stimulated upregulation of IL-21R suggests that follicle-entering ␥␦ T cells may remain strongly IL-21-responsive, forming a functional interface with TFH cells. IL-21-stimulated, HMB-PP- activated ␥␦ T cells up-regulated CXCL10, implicated in monocyte and lymphocyte trafficking into follicles (36). Moreover, their high expression of CXCL13 was unanticipated as CXCL13 was heretofore attributed primarily to follicular stromal cells, myeloid and plasmacytoid DC, and TFH cells (60). CXCL13 is an important chemoattractant to the follicles for CXCR5⫹ cells such as naive B cells and early activated CD4⫹ T cells but mostly absent from extrafollicular sites, including the T zones of spleen, LNs, and Peyer’s patches. Interestingly, type I IFNs are reportedly enriched in the paracortex over the follicles (61, 62), where conceivably their inhibition of ␥␦ T cell expression of CXCL13 (Fig. 5), perhaps by suppressing FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS The Journal of Immunology 4313 References 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. opment of human T helper cells using oligonucleotide arrays. Nat. Genet. 25: 96 –101. Hamalainen, H., H. Zhou, W. Chou, H. Hashizume, R. Heller, and R. Lahesmaa. 2001. Distinct gene expression profiles of human type 1 and type 2 T helper cells. Genome Biol. 2: Research 0022.1– 0022.11. Kovanen, P. E., A. Rosenwald, J. Fu, E. M. Hurt, L. T. Lam, J. M. Giltnane, G. Wright, L. M. Staudt, and W. J. Leonard. 2003. Analysis of ␥c-family cytokine target genes: identification of dual-specificity phosphatase 5 (DUSP5) as a regulator of mitogen-activated protein kinase activity in interleukin-2 signaling. J. Biol. Chem. 278: 5205–5213. Lund, R., T. Aittokallio, O. Nevalainen, and R. Lahesmaa. 2003. Identification of novel genes regulated by IL-12, IL-4, or TGF- during the early polarization of CD4⫹ lymphocytes. J. Immunol. 171: 5328 –5336. Ismaili, J., V. Olislagers, R. Poupot, J. J. Fournié, and M. Goldman. 2002. Human ␥␦ T cells induce dendritic cell maturation. Clin. Immunol. 103: 296 –302. Bosco, A., K. L. McKenna, C. J. Devitt, M. J. Firth, P. D. Sly, and P. G. Holt. 2006. Identification of novel Th2-associated genes in T memory responses to allergens. J. Immunol. 176: 4766 – 4777. Kim, C. H., H. W. Lim, J. R. Kim, L. Rott, P. Hillsamer, and E. C. Butcher. 2004. Unique gene expression program of human germinal center T helper cells. Blood 104: 1952–1960. Rasheed, A. U., H. P. Rahn, F. Sallusto, M. Lipp, and G. Müller. 2006. Follicular B helper T cell activity is confined to CXCR5hiICOShi CD4 T cells and is independent of CD57 expression. Eur. J. Immunol. 36: 1892–1903. Shen, Y., J. Iqbal, L. Xiao, R. C. Lynch, A. Rosenwald, L. M. Staudt, S. Sherman, K. Dybkaer, G. Zhou, J. D. Eudy, et al. 2004. Distinct gene expression profiles in different B-cell compartments in human peripheral lymphoid organs. BMC Immunol. 5: 20. Garnon, J., C. Lachance, S. di Marco, Z. Hel, D. Marion, M. C. Ruiz, M. M. Newkirk, E. W. Khandjian, and D. Radzioch. 2005. Fragile X-related protein FXR1P regulates proinflammatory cytokine tumor necrosis factor expression at the post-transcriptional level. J. Biol. Chem. 280: 5750 –5763. Garcia-Suarez, O., J. Hannestad, I. Esteban, M. Martinez del Valle, F. J. Naves, and J. A. Vega. 1997. Neurotrophin receptor-like protein immunoreactivity in human lymph nodes. Anat. Rec. 249: 226 –232. Maecker, H., E. Varfolomeev, F. Kischkel, D. Lawrence, H. LeBlanc, W. Lee, S. Hurst, D. Danilenko, J. Li, E. Filvaroff, et al. 2005. TWEAK attenuates the transition from innate to adaptive immunity. Cell 123: 931–944. Masuda, M., S. Senju, S. Fujii Si, Y. Terasaki, M. Takeya, S. Hashimoto Si, K. Matsushima, E. Yumoto, and Y. Nishimura. 2002. Identification and immunocytochemical analysis of DCNP1, a dendritic cell-associated nuclear protein. Biochem. Biophys. Res. Commun. 290: 1022–1029. Nishimura, H., M. Nose, H. Hiai, N. Minato, and T. Honjo. 1999. Development of lupus-like autoimmune diseases by disruption of the PD-1 gene encoding an ITIM motif-carrying immunoreceptor. Immunity 11: 141–151. Hase, K., T. Murakami, H. Takatsu, T. Shimaoka, M. Iimura, K. Hamura, K. Kawano, S. Ohshima, R. Chihara, K. Itoh, et al. 2006. The membrane-bound chemokine CXCL16 expressed on follicle-associated epithelium and M cells mediates lympho-epithelial interaction in GALT. J. Immunol. 176: 43–51. Mueller, C. G., I. Cremer, P. E. Paulet, S. Niida, N. Maeda, S. Lebeque, W. H. Fridman, and C. Sautes-Fridman. 2001. Mannose receptor ligand-positive cells express the metalloprotease decysin in the B cell follicle. J. Immunol. 167: 5052–5060. Reid, D. M., M. Montoya, P. R. Taylor, P. Borrow, S. Gordon, G. D. Brown, and S. Y. Wong. 2004. Expression of the -glucan receptor, Dectin-1, on murine leukocytes in situ correlates with its function in pathogen recognition and reveals potential roles in leukocyte interactions. J. Leukocyte Biol. 76: 86 –94. Yamada, K., M. Yamakawa, Y. Imai, and M. Tsukamoto. 1997. Expression of cytokine receptors on follicular dendritic cells. Blood 90: 4832– 4841. Huber, C., C. Thielen, H. Seeger, P. Schwarz, F. Montrasio, M. R. Wilson, E. Heinen, Y. X. Fu, G. Miele, and A. Aguzzi. 2005. Lymphotoxin- receptordependent genes in lymph node and follicular dendritic cell transcriptomes. J. Immunol. 174: 5526 –5536. Kumari, D., and K. Usdin. 2001. Interaction of the transcription factors USF1, USF2, and ␣-Pal/Nrf-1 with the FMR1 promoter: implications for fragile X mental retardation syndrome. J. Biol. Chem. 276: 4357– 4364. Pende, D., R. Castriconi, P. Romagnani, G. M. Spaggiari, S. Marcenaro, A. Dondero, E. Lazzeri, L. Lasagni, S. Martini, P. Rivera, et al. 2006. Expression of the DNAM-1 ligands, Nectin-2 (CD112) and poliovirus receptor (CD155), on dendritic cells: relevance for natural killer-dendritic cell interaction. Blood 107: 2030 –2036. Kanowith-Klein, S., F. Hofman, and A. Saxon. 1988. Expression of Fc receptors and surface and cytoplasmic IgE on human fetal and adult lymphopoietic tissue. Clin. Immunol. Immunopathol. 48: 214 –224. Hall, K. T., L. Boumsell, J. L. Schultze, V. A. Boussiotis, D. M. Dorfman, A. A. Cardoso, A. Bensussan, L. M. Nadler, and G. J. Freeman. 1996. Human CD100, a novel leukocyte semaphorin that promotes B-cell aggregation and differentiation. Proc. Natl. Acad. Sci. USA 93: 11780 –11785. Ferrick, D. A., M. D. Schrenzel, T. Mulvania, B. Hsieh, W. G. Ferlin, and H. Lepper. 1995. Differential production of interferon-␥ and interleukin-4 in response to Th1- and Th2-stimulating pathogens by ␥␦ T cells in vivo. Nature 373: 255–257. Wen, L., D. F. Barber, W. Pao, F. S. Wong, M. J. Owen, and A. Hayday. 1998. Primary ␥␦ cell clones can be defined phenotypically and functionally as Th1/Th2 cells and illustrate the association of CD4 with Th2 differentiation. J. Immunol. 160: 1965–1974. Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 1. Stockinger, B., C. Bourgeois, and G. Kassiotis. 2006. CD4⫹ memory T cells: functional differentiation and homeostasis. Immunol. Rev. 211: 39 – 48. 2. Vinuesa, C. G., S. G. Tangye, B. Moser, and C. R. Mackay. 2005. Follicular B helper T cells in antibody responses and autoimmunity. Nat. Rev. Immunol. 5: 853– 865. 3. Pennington, D. J., D. Vermijlen, E. L. Wise, S. L. Clarke, R. E. Tigelaar, and A. C. Hayday. 2005. The integration of conventional and unconventional T cells that characterizes cell-mediated responses. Adv. Immunol. 87: 27–59. 4. Hayday, A. C. 2000. ␥␦ cells: a right time and a right place for a conserved third way of protection. Annu. Rev. Immunol. 18: 975–1026. 5. Shires, J., E. Theodoridis, and A. C. Hayday. 2001. Biological insights into TCR␥␦⫹ and TCR␣⫹ intraepithelial lymphocytes provided by serial analysis of gene expression (SAGE). Immunity 15: 419 – 434. 6. Eberl, M., M. Hintz, A. Reichenberg, A. K. Kollas, J. Wiesner, and H. Jomaa. 2003. Microbial isoprenoid biosynthesis and human ␥␦ T cell activation. FEBS Lett. 544: 4 –10. 7. Hayday, A., and R. Tigelaar. 2003. Immunoregulation in the tissues by ␥␦ T cells. Nat. Rev. Immunol. 3: 233–242. 8. Pennington, D. J., B. Silva-Santos, J. Shires, E. Theodoridis, C. Pollitt, E. L. Wise, R. E. Tigelaar, M. J. Owen, and A. C. Hayday. 2003. The interrelatedness and interdependence of mouse T cell receptor ␥␦⫹ and ␣⫹cells. Nat. Immunol. 4: 991–998. 9. Boullier, S., Y. Poquet, T. Debord, J. J. Fournié, and M. L. Gougeon. 1999. Regulation by cytokines (IL-12, IL-15, IL-4 and IL-10) of the V␥9V␦2 T cell response to mycobacterial phosphoantigens in responder and anergic HIV-infected persons. Eur. J. Immunol. 29: 90 –99. 10. Cipriani, B., G. Borsellino, F. Poccia, R. Placido, D. Tramonti, S. Bach, L. Battistini, and C. F. Brosnan. 2000. Activation of C-C -chemokines in human peripheral blood ␥␦ T cells by isopentenyl pyrophosphate and regulation by cytokines. Blood 95: 39 – 47. 11. Wesch, D., A. Glatzel, and D. Kabelitz. 2001. Differentiation of resting human peripheral blood ␥␦ T cells toward Th1- or Th2-phenotype. Cell. Immunol. 212: 110 –117. 12. Eberl, M., R. Engel, E. Beck, and H. Jomaa. 2002. Differentiation of human ␥␦ T cells towards distinct memory phenotypes. Cell. Immunol. 218: 1– 6. 13. Lafont, V., S. Loisel, J. Liautard, S. Dudal, M. Sable-Teychene, J. P. Liautard, and J. Favero. 2003. Specific signaling pathways triggered by IL-2 in human V␥9V␦2 T cells: an amalgamation of NK and ␣ T cell signaling. J. Immunol. 171: 5225–5232. 14. Leonard, W. J., and R. Spolski. 2005. Interleukin-21: a modulator of lymphoid proliferation, apoptosis and differentiation. Nat. Rev. Immunol. 5: 688 – 698. 15. Chtanova, T., S. G. Tangye, R. Newton, N. Frank, M. R. Hodge, M. S. Rolph, and C. R. Mackay. 2004. 2004. T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide help for B cells. J. Immunol. 173: 68 –78. 16. Ozaki, K., R. Spolski, R. Ettinger, H. P. Kim, G. Wang, C. F. Qi, P. Hwu, D. J. Shaffer, S. Akilesh, D. C. Roopenian, et al. 2004. Regulation of B cell differentiation and plasma cell generation by IL-21, a novel inducer of Blimp-1 and Bcl-6. J. Immunol. 173: 5361–5371. 17. Ozaki, K., R. Spolski, C. G. Feng, C. F. Qi, J. Cheng, A. Sher, H. C. Morse 3rd, C. Liu, P. L. Schwartzberg, and W. J. Leonard. 2002. A critical role for IL-21 in regulating immunoglobulin production. Science 298: 1630 –1634. 18. King, C., A. Ilic, K. Koelsch, and N. Sarvetnick. 2004. Homeostatic expansion of T cells during immune insufficiency generates autoimmunity. Cell 117: 265–277. 19. Vinuesa, C. G., M. C. Cook, C. Angelucci, V. Athanasopoulos, L. Rui, K. M. Hill, D. Yu, H. Domaschenz, B. Whittle, T. Lambe, et al. 2005. A RINGtype ubiquitin ligase family member required to repress follicular helper T cells and autoimmunity. Nature 435: 452– 458. 20. Eberl, M., H. Jomaa, and A. C. Hayday. 2004. Integrated immune responses to infection— cross-talk between human ␥␦ T cells and dendritic cells. Immunology 112: 364 –368. 21. Zhang, Y., Y. Song, F. Yin, E. Broderick, K. Siegel, A. Goddard, E. Nieves, L. Pasa-Tolic, Y. Tanaka, H. Wang, et al. 2006. Structural studies of V␥2V␦2 T cell phosphoantigens. Chem. Biol. 13: 985–992. 22. Eberl, M., R. Engel, S. Aberle, P. Fisch, H. Jomaa, and H. Pircher. 2005. Human V␥9/V␦2 effector memory T cells express the killer cell lectin-like receptor G1 (KLRG1). J. Leukocyte Biol. 77: 67–70. 23. Brandes, M., K. Willimann, A. B. Lang, K. H. Nam, C. Jin, M. B. Brenner, C. T. Morita, and B. Moser. 2003. Flexible migration program regulates ␥␦ T-cell involvement in humoral immunity. Blood 102: 3693–3701. 24. Favier, B., E. Espinosa, J. Tabiasco, C. dos Santos, M. Bonneville, S. Valitutti, and J. J. Fournié. 2003. Uncoupling between immunological synapse formation and functional outcome in human ␥␦ T lymphocytes. J. Immunol. 171: 5027–5033. 25. Eberl, M., B. Altincicek, A. K. Kollas, S. Sanderbrand, U. Bahr, A. Reichenberg, E. Beck, D. Foster, J. Wiesner, M. Hintz, and H. Jomaa. 2002. Accumulation of a potent ␥␦ T-cell stimulator after deletion of the lytB gene in Escherichia coli. Immunology 106: 200 –211. 26. Hedges, J. F., K. J. Lubick, and M. A. Jutila. 2005. ␥␦ T cells respond directly to pathogen-associated molecular patterns. J. Immunol. 174: 6045– 6053. 27. Chen, L., M. T. Cencioni, D. F. Angelini, G. Borsellino, L. Battistini, and C. F. Brosnan. 2005. Transcriptional profiling of ␥␦ T cells identifies a role for vitamin D in the immunoregulation of the V␥9V␦2 response to phosphate-containing ligands. J. Immunol. 174: 6144 – 6152. 28. Rogge, L., E. Bianchi, M. Biffi, E. Bono, S. Y. Chang, H. Alexander, C. Santini, G. Ferrari, L. Sinigaglia, M. Seiler, et al. 2000. Transcript imaging of the devel- 4314 61. Toellner, K. M., D. Scheel-Toellner, R. Sprenger, M. Duchrow, L. H. Trumper, M. Ernst, H. D. Flad, and J. Gerdes. 1995. The human germinal centre cells, follicular dendritic cells and germinal centre T cells produce B cell-stimulating cytokines. Cytokine 7: 344 –354. 62. Brackenbury, L. S., B. V. Carr, Z. Stamataki, H. Prentice, E. A. Lefevre, C. J. Howard, and B. Charleston. 2005. Identification of a cell population that produces ␣/ interferon in vitro and in vivo in response to noncytopathic bovine viral diarrhea virus. J. Virol. 79: 7738 –7744. 63. Strengell, M., I. Julkunen, and S. Matikainen. 2004. IFN-␣ regulates IL-21 and IL-21R expression in human NK and T cells. J. Leukocyte Biol. 76: 416 – 422. 64. Wood, N., K. Bourque, D. D. Donaldson, M. Collins, D. Vercelli, S. J. Goldman, and M. T. Kasaian. 2004. IL-21 effects on human IgE production in response to IL-4 or IL-13. Cell. Immunol. 231: 133–145. 65. Brandes, M., K. Willimann, and B. Moser. 2005. Professional antigen-presentation function by human ␥␦ T cells. Science 309: 264 –268. 66. Dieli, F., N. Gebbia, F. Poccia, N. Caccamo, C. Montesano, F. Fulfaro, C. Arcara, M. R. Valerio, S. Meraviglia, C. di Sano, et al. 2003. Induction of ␥␦ T-lymphocyte effector functions by bisphosphonate zoledronic acid in cancer patients in vivo. Blood 102: 2310 –2311. 67. Girardi, M., E. Glusac, R. B. Filler, S. J. Roberts, I. Propperova, J. Lewis, R. E. Tigelaar, and A. C. Hayday. 2003. The distinct contributions of murine T cell receptor (TCR)␥␦⫹ and TCR␣⫹ T cells to different stages of chemically induced skin cancer. J. Exp. Med. 198: 747–755. 68. Curti, B. D. 2006. Immunomodulatory and antitumor effects of interleukin-21 in patients with renal cell carcinoma. Expert Rev. Anticancer Ther. 6: 905–909. Downloaded from http://www.jimmunol.org/ by guest on June 18, 2017 53. Wen, L., W. Pao, F. S. Wong, Q. Peng, J. Craft, B. Zheng, G. Kelsoe, L. Dianda, M. J. Owen, and A. C. Hayday. 1996. Germinal center formation, immunoglobulin class switching, and autoantibody production driven by “non ␣/” T cells. J. Exp. Med. 183: 2271–2282. 54. Pao, W., L. Wen, A. L. Smith, A. Gulbranson-Judge, B. Zheng, G. Kelsoe, I. C. MacLennan, M. J. Owen, and A. C. Hayday. 1996. ␥␦ T cell help of B cells is induced by repeated parasitic infection, in the absence of other T cells. Curr. Biol. 6: 1317–1325. 55. Rajagopalan, S., T. Zordan, G. C. Tsokos, and S. K. Datta. 1990. Pathogenic anti-DNA autoantibody-inducing T helper cell lines from patients with active lupus nephritis: isolation of CD4⫺8⫺ T helper cell lines that express the ␥␦ T-cell antigen receptor. Proc. Natl. Acad. Sci. USA 87: 7020 –7024. 56. Wen, L., S. J. Roberts, J. L. Viney, F. S. Wong, C. Mallick, R. C. Findly, Q. Peng, J. E. Craft, M. J. Owen, and A. C. Hayday. 1994. Immunoglobulin synthesis and generalized autoimmunity in mice congenitally deficient in ␣⫹ T cells. Nature 369: 654 – 658. 57. Hintzen, R. Q., S. M. Lens, G. Koopman, S. T. Pals, H. Spits, and R. A. van Lier. 1994. CD70 represents the human ligand for CD27. Int. Immunol. 6: 477– 480. 58. Xiao, Y., J. Hendriks, P. Langerak, H. Jacobs, and J. Borst. 2004. CD27 is acquired by primed B cells at the centroblast stage and promotes germinal center formation. J. Immunol. 172: 7432–7441. 59. Caccamo, N., L. Battistini, M. Bonneville, F. Poccia, J. J. Fournié, S. Meraviglia, G. Borsellino, R. A. Kroczek, C. La Mendola, E. Scotet, et al. 2006. CXCR5 identifies a subset of V␥9V␦2 T cells which secrete IL-4 and IL-10 and help B cells for antibody production. J. Immunol. 177: 5290 –5295. 60. Ebert, L. M., P. Schaerli, and B. Moser. 2005. Chemokine-mediated control of T cell traffic in lymphoid and peripheral tissues. Mol. Immunol. 42: 799 – 809. FUNCTIONAL PLEIOTROPY OF HUMAN V␥9/V␦2 T CELLS