Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
9/22/11 Do Now: Silently copy the following DNA sequence in the notes sec;on of your binder: A T C G A T C G A T A G C 1. Write the sequence of the complementary DNA strand 2. Write the sequence of the complementary RNA strand 3. What is the name of the process that uses DNA as a template to make RNA? 4. Where does that process occur? Learning to play the uke • I went to guitar center to get some music that I could play on my uke. I didn’t have any money so I couldn’t buy the music. Also, I don’t know how to read music so I knew I would need help with it. I just copied down the whole thing onto a blank sheet of paper so I could take the info out of the store. Learning to play the uke • Now I had the whole thing wriQen down, but I don’t know how to read sheet music. My friend Ryan Bo (we all call him Ry) also wanted to learn the song and since I already did the work of going to the store and copying down the song, it was up to him to figure out how to play it. He went online and opened up a different website to explain each note. That way, he would see a note on the sheet music and could just look to the right web page and transfer the tab informa;on onto a new piece of paper. 1 9/22/11 Learning to play the uke • Now that we had the tabs all wriQen down in the correct order, we knew which notes to play when! Do you remember the story? 1. How did I get the informa;on on the sheet music out of the store? 2. Who did I give it to so the sheet music could be translated into tabs? 3. What was used to translate the music into tabs? FOCUS LESSON • SWBATs: – 4A.1) SWBAT define mRNA, tRNA, and ribosome and describe with their respec;ve func;ons – 4A.2) SWBAT explain how tRNA mediates correct transla;on of the mRNA code into amino acid sequence • Analogy: – Transla;on is just like having my friend Ryan Bo use different websites to explain each note of music. • I know I will have accomplished this skill when I can confidently complete today’s SWBAT! 2 9/22/11 mRNA review How many strands does RNA have? What is RNA made of? What does the “m” in mRNA stand for? What 4 nucleo;des (what leQers) comprise mRNA? • What is the name of the process in which DNA is used to create RNA? • In the story, what was the DNA and what was the mRNA? • • • • Transcrip;on • The informa;on in DNA is copied into RNA. – The informa;on is copied perfectly because of base-‐pairing! DNA RNA A U T A C G G C But I thought DNA had 2 strands… • On the last slide, I showed how a single line of nucleo;des in DNA is turned into a single line of nucleo;des in RNA. • DNA does have two strands – There are two strings of nucleo;des aQached to eachother 3 9/22/11 You have to separate the two sides of DNA; only one side is used to make RNA Now we have the message copied… • Where does this copying step happen in the cell? • What is the scien;fic name for making this copy (what do we call this process?) • What is the blueprint? • What is the copy? – Name 3 major differences between the blueprint and the copy The message leaves the nucleus • Remember; – in eukaryotes, RNA must be spliced before it is fully mature mRNA and can leave the nucleus – In prokaryotes, RNA is not spliced • Now the message moves to the workers of the cell – the ribosomes! 4 9/22/11 Ribosome review • Where are ribosomes found in the cell? ribosome AUCGCUAGCGAGCAUCGCUAGCGAGCAUCGCUAGCGAGCAUCGCUAGCGAGCAUCGCUAGCGA mRNA Transla;on: from mRNA to protein • In the story, my hand-‐wriQen music was the mRNA. What was the protein in the story? • Who did the transla;on in the story? • What did he use to translate my hand-‐wriQen music? • In the cell, why is the step of making proteins using mRNA called transla;on? • What are proteins made of? Ribosomes translate mRNA into protein • Ry Bo (ribosome) used a different website for each note. • Ribosomes use a different tRNA for each amino acid – mRNA tells the ribosome the order of the amino acids 5 9/22/11 tRNA The “t” in tRNA stands for transfer On one end, it carries an amino acid On the other end, it has 3 exposed nucleo0des Why does tRNA need exposed nucleo;des? • These 3 nucleo;des match up with 3 nucleo;des on the mRNA using the base pairing rules we learned – A <-‐> U – G <-‐> C • This is how the nucleo;de code is translated into amino acids! You might even say that every three nucleo;des CODES for one amino acid • A set of 3 nucleo;des is called a… CODON 6 9/22/11 Transla;on Video Transla;on • What carries amino acids to the ribosomes? • What is a set of three nucleo;des on mRNA called? • How does the order of nucelo;des on the mRNA control the order of amino acids in the protein? The Central Dogma: Let’s Bring it All Together • 1. Info in DNA is transcribed to mRNA – Base-‐pairing makes sure that the copy is perfect • Eukaryotes splice the RNA, prokaryotes do not • 2. Ribosomes translate the mRNA into protein – Ribosomes hold the mRNA so that the correct tRNA can match its nucleo;des to the mRNA The boQom line: the order of nucleo;des in DNA controls the order of the amino acids in protein 7 9/22/11 Exit Slip 1. What is the name of the step that copies the informa;on in DNA into RNA? 2. What is the name of the step that uses mRNA to make protein? 3. What in the cell holds the mRNA for protein to be made? 4. What carries each amino acid? 5. How does the order of the nucleo;des in the mRNA determine the order of the amino acids in the protein? 8