* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Name: Date: ______ Pd:_____ Modeling Protein Synthesis : Your
Complement component 4 wikipedia , lookup
Blood donation wikipedia , lookup
Autotransfusion wikipedia , lookup
Jehovah's Witnesses and blood transfusions wikipedia , lookup
Plateletpheresis wikipedia , lookup
Men who have sex with men blood donor controversy wikipedia , lookup
Hemorheology wikipedia , lookup
Name:_______________________________ Date: _______ Pd:_____ Modeling Protein Synthesis : Your task: create a model of the synthesis of the one of following proteins Eumelanin (black brown) o ATGAAAAACAAGGTACACATCTAG Pheomelanin (responsible for red hair) o ATGAAAAACAATTGCACGTAG A blood (A antigen only) o ATGTAAACCACTACATAG B blood (B antigen only) o ATGAGAAGTAGGAGAAGCATAATCTAG A B blood (red blood cells contain A antigens and B antigens on its cell surface) o ATGTAAACCACTACATAG -(A antigen) o ATGAGAAGTAGGAGAAGCATAATCTAG -(B antigen) A and Rh+ blood (red blood cells contain A antigens and Rh+ antigens on its cell surface) o ATGTAAACCACTACATAG -(A antigen) o ATGATTCAACACATCCAGCCACATTAG-(Rh factor) B and Rh+ blood (red blood cells contain A antigens and Rh+ antigens on its cell surface o ATGAGAAGTAGGAGAAGCATAATCTAG -(B antigen) o ATGATTCAACACATCCAGCCACATTAG-(Rh factor) Challenge Sequence: AB and Rh+ blood (red blood cells contain A antigens and Rh+ antigens on its cell surface) Model requirements: You may make your model out of any materials that you choose. The model must contain the following: _____/50 _____/50 _____/5 _____/5 Transcription of your specific DNA sequence into mRNA (labeled and correct) Translation of your mRNA into your protein (labeled and correct) 3-D visual of the polypeptide (each amino acid should be labeled and correct) 3-D visual of the folded polypeptide (amino acids do NOT need to be labeled and correct) _____ /10 3-D visual of the finished protein in/on where it resides in the body (melanin in the skin, antigens on the surface of a red blood cells) _____/10 neatness and creativity _____/30 ½ page typed response to the following prompt attached to your model: Melanin and blood antigens are both manifestations of protein synthesis, discuss why one played a role in the segregation of peoples while the other did not.