Download Plasma is the main regulator of Staphylococcus epidermidis biofilms

FEMS Pathogens and Disease, 74, 2016, ftv125
doi: 10.1093/femspd/ftv125
Advance Access Publication Date: 27 December 2015
Short Communication
SHORT COMMUNICATION
Plasma is the main regulator of Staphylococcus
epidermidis biofilms virulence genes transcription
in human blood
Angela França and Nuno Cerca∗
CEB – Centre of Biological Engineering, LIBRO – Laboratory of Research in Biofilms Rosário Oliveira, University
of Minho, Campus de Gualtar, 4710-057 Braga, Portugal
∗
Corresponding author: Centro de Engenharia Biológica, Universidade do Minho, Campus de Gualtar, 4710-057 Braga, Portugal. Tel: +351-253-60443;
Fax: +351-253-678-986; E-mail: [email protected]
One sentence summary: Plasma is the component of human blood that regulates the transcription of several genes involved in Staphylococcus epidermidis
biofilms virulence.
Editor: Thomas Bjarnsholt
ABSTRACT
Staphylococcus epidermidis is frequently associated with the emergence of medical-device-associated bloodstream infections,
due to its ability to form biofilms on the surface of vascular catheters. Although these biofilms may be in continuous
contact with human blood, how S. epidermidis biofilm cells interact with blood and its cellular and soluble components is
poorly understood. Herein, we evaluated biofilm structure, biofilm cells culturability and viability, and the transcription
of a panel of genes associated with S. epidermidis biofilms virulence, upon interaction with whole human blood or plasma.
Our results showed that although whole human blood caused significant alterations in biofilm structure and in the number
of culturable and viable cells, plasma was the main regulator of the transcription of genes with central role in biofilm
formation, maturation and immune evasion. These findings highlight the urgent need to intensify studies aiming to
evaluate the impact of host soluble factors on S. epidermidis biofilms fitness and persistence.
Keywords: Staphylococcus epidermidis; biofilms; human blood; plasma; virulence genes; gene expression
INTRODUCTION
Biofilms present a significant challenge to current clinical practice due to their increased tolerance to antibiotics and host
immune response being, consequently, commonly associated
with the development of chronic and recalcitrant infections
(Costerton, Stewart and Greenberg 1999). Staphylococcus epidermidis, a skin- and mucosae-colonizing bacterium, has a remarkable ability to form biofilms on the surface of indwelling medical devices (Vadyvaloo and Otto 2005), particularly on peripheral
and central vascular catheters. In fact, it was reported that 22%
of bloodstream infections diagnosed among patients in intensive care units, in the USA, are due to S. epidermidis biofilm for-
mation on these catheters (Otto 2009). Nevertheless, although
medical-device-related bloodstream infections are one of the
most frequent infections caused by S. epidermidis biofilms, the
interaction between biofilm cells and human blood is not well
understood. Recently, we have shown that the incubation with
human blood led to an extensive reprogramming of S. epidermidis biofilm cells transcriptome (Franca et al. 2014). Nevertheless, since human blood is a complex mixture of cells and soluble
molecules, both involved in bacteria targeting, it was not possible to identify which of these fractions were causing the transcriptional alterations observed in that study. Therefore, we became interested in differentiating the response of S. epidermidis
Received: 23 September 2015; Accepted: 22 December 2015
C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected]
1
2
FEMS Pathogens and Disease, 2016, Vol. 74, No. 2
biofilms to blood circulating cells versus soluble factors. Hence,
herein, S. epidermidis biofilms were incubated, respectively, with
whole human blood or human plasma and the abundance of
transcripts encoding S. epidermidis biofilm virulence factors was
assessed. In addition, biofilm structure and biofilm cells culturability and viability were also evaluated.
R lithium
Human blood was collected, into BD Vacutainer
heparin tubes (NJ, USA), from healthy adults volunteers and under a protocol approved by the Institutional Review Board of
the University of Minho (SECVS 002/2014), which is in strict accordance with the Declaration of Helsinki and Oviedo Convention. Informed written consent was signed by all volunteers.
Plasma was obtained by centrifugation of whole blood at 300 g,
for 20 minutes, at 4◦ C. Biofilms of S. epidermidis strain RP62A
(ATCC 35984) were formed, in 24-well plates (Orange Scientific,
Braine-l’Alleud, Belgium), by adding 1.6 μL of overnight culture
into 1 mL of tryptic soy broth (Liofilchem, Teramo, Italy) supplemented with 1% glucose (v/v) and by incubating at 37◦ C in
an orbital shaker at 120 rpm. Twenty-four hours-old biofilms
were incubated for 2 hours, under static conditions, at 37◦ C and
5% CO2 with either 1 mL of whole blood or plasma. Biofilms
were then washed twice with 0.9% of NaCl and immediately
suspended in 1 mL of the same solution, for the evaluation
of biofilms biomass and biofilm cells culturability and viability, or in 1 mL RNA Protect bacteria reagent (QIAGEN, Hilden,
Germany), for the quantification of gene expression levels.
Biofilms biomass was determined by optical density (OD) (Freitas et al. 2014) at 640 nm, the number of culturable cells by the
standard CFU counting method, and the number of viable cells
by flow cytometry (EC800 flow cytometer, Sony, CA, USA) using
SYBR Green and propidium iodide staining as described before
(Cerca et al. 2011b). All the quantification analyses were performed using blood/plasma of four different donors (two males
and two females), with triplicates for each condition. For confocal laser scanning microscopy (CLSM), 24 hours-old biofilms
were formed on Nunc Thermanox coverslips (Thermo Scientific,
MA, USA), which were placed inside the wells of the 24-well
plates used. After incubation with blood or plasma, the biofilms
formed on the coverslips were washed twice with ultrapure
water, the coverslips removed from the well and placed onto
a glass slide. Then, polysaccharides were stained with Wheat
Germ Agglutinin (WGA) Oregon Green 488 (Life Technologies,
CA, USA) and nucleic acids with DAPI (Sigma, MO, USA), as detailed elsewhere (Cerca et al. 2012). Biofilm images were acquired
using an Olympus FluoView FV1000 (Lisboa, Portugal) microscope. Biofilms were observed using a ×60 water-immersion objective (60 ×/ 1.2 W). Images were taken, with 1024 × 1024 resolution, in at least four different regions of each of the surfaces
analyzed. This experiment was performed using blood/plasma
of three different donors (two males and one female), with duplicates for each condition. For the quantification of gene expression, the abundance of target transcripts was determined as
optimized before (Franca et al. 2014). In brief, total RNA was isolated from biofilms incubated with blood/plasma of five different
donors (three males and two females) by combining silica beads
lysis with RNeasy mini kit (QIAGEN purification column system.
Genomic DNA was degraded by DNase I (Thermo Scientific) and
complementary (c) DNA synthesized, from 300 ng of total RNA,
by RevertAid H minus Reverse Transcriptase enzyme (Thermo
Scientific) in the presence of random primers (NZYTech, Lisboa,
Portugal), and in a 10 μL reaction volume. Finally, qPCR run was
performed by mixing 2 μL of 1:400 diluted cDNA with 5 μL of Q
R
Green Supermix (Bio-Rad, CA, USA), 0.5 μL of each forSYBR
ward and reverse primers at 10 μM and 2 μL of nuclease-free
water. The run was completed in a CFX96TM (Bio-Rad) thermal
cycler with the following parameters: 94◦ C 10 minutes and 35
cycles of 94◦ C 15 seconds, 20 seconds at 58◦ C and 72◦ C for 25 seconds. The abundance of transcripts was determined by applying
the Pfaffl equation (Pfaffl 2004) using 16 rRNA as reference gene.
The sequence of the primers used can be found in previous publications (Franca et al. 2012; Sousa, Franca and Cerca 2014), with
the exception of the primers used to detect sepA (FW: TCTTAAGGCATCTCCGCCTA and RV: GTCTGGTGCGAATGATGTTG, 194 bp
amplicon) and capA (FW: TGATTATGCGAACCTTTCCAG and RV:
TAGCGAATGCTGGTGCAG, 175 bp amplicon) transcripts. The sequences of target genes were downloaded, for primer design,
using GeneBank accession number NC 002976. The heat map
of relative transcription was created using matrix2png interface
(Pavlidis and Noble 2003). Statistical analysis was carried out using GraphPad Prism (CA, USA). Kruskal–Wallis and Dunn’s multiple comparison tests were applied. Accordingly, data are depicted in median with range. Differences among groups were
considered significant when P was less than 0.05.
As expected, biofilms biomass (Fig. 1A) and biofilm cells culturability (Fig. 1B) and viability (Fig. 1C) were significantly reduced in the presence of whole human blood. A more pronounced reduction, however, was observed in the culturability
of biofilm cells rather than in viability. This difference was not
surprising since biofilms are highly heterogeneous communities
comprising cells in different metabolic states including, among
others, dormant cells (Stewart and Franklin 2008). In addition
to the intrinsic biofilm heterogeneity, the high concentration of
glucose (1%) used for the growth of these biofilms is known to
further stimulate dormancy within S. epidermidis biofilms (Cerca
et al. 2011a). By comparing the number of CFU and the number
of viable cells obtained, it was possible to determine the proportion of dormant cells in each condition. Interestingly, although
control biofilms already presented 0.5 Log10 of dormant cells, the
incubation with either blood or plasma led, respectively, to an increase of 2-fold (1 Log10 ) and 1.5-fold (0.75 Log10 ) in the proportion of dormant cells. This phenomenon may contribute to the
persistence of biofilm cells in the host as it was recently shown
that S. epidermidis biofilms with higher proportion of dormant
cells have lower inflammatory profile (Cerca et al. 2014).
To further characterize the influence of human blood and
plasma on S. epidermidis biofilms, its structure was analyzed
by CSLM upon interaction with whole human blood or plasma.
In agreement with the previous results obtained, the incubation with whole human blood resulted in a significant reduction
(P ≤ 0.001) of the maximum biofilm thickness, from 35.6 ± 13.3
μm (control) (Fig. 1D) to 8.2 ± 4.3 μm (blood-exposed biofilms)
(Fig. 1E). Human plasma-exposed biofilms did not present any
significant alteration in either biofilm structure or thickness
(22.1 ± 4.5 μm), when compared with the control (Fig. 1F).
Finally, to investigate which of blood components, cells or
soluble factors, were in fact influencing S. epidermidis biofilms
gene expression profile, the transcription levels of genes with
a central role in biofilm development/maturation such as aap
(Hussain et al. 1997; Rohde et al. 2005), bhp (Tormo et al. 2005),
icaA (Mack et al. 1996) and lrgB (Bayles 2007) and in immune evasion such as icaA (Cerca et al. 2006; Kristian et al. 2008), capA
(Kocianova et al. 2005), mprF/fmtC (Gill et al. 2005; Richards et al.
2015) and sepA (Lai et al. 2007) were measured. Despite the characteristic variability inherent to each donor, the transcription of
these genes was significantly increased, when compared with
biofilm cells harvested before any manipulation, in biofilms exposed to either whole human blood or plasma (Fig. 1G). However, when comparing the abundance of transcripts between
França and Cerca
3
Figure 1. The influence of whole human blood and plasma on S. epidermidis biofilms. (A) Biofilms biomass, (B) number of CFU or (C) viable cells after incubation with
whole human blood or plasma. The bars represent the median with range of four independent assays. (D, E, F) Representative images of the three-dimensional structure
of control biofilms (D), biofilms exposed to blood (E) or plasma (F). DAPI, which stains nucleic acids, is represented in red, and WGA, which stains polysaccharides,
is represented in green. (G) Heat map of the relative transcription levels (comparing to T0h) of the selected virulence genes upon 2 hours of interaction with whole
human blood or plasma. (H) Relative transcription levels of the selected virulence genes in whole human blood (comparing to plasma). The vertical bars represent the
median of 5 independent assays. Log2 fold change equal to 0 indicates no alteration in the transcription, Log2 fold change below 0 indicates increase in transcription in
plasma-exposed biofilms and Log2 fold change above 0 indicates increase in transcription in blood-exposed biofilms. Each symbol represents a single donor. Statistical
significance among groups was determined using Kruskal–Wallis and Dunn’s multiple comparison tests. ∗∗ P ≤ 0.01, ∗∗∗ P ≤ 0.001.
blood- and plasma-exposed biofilms, no meaningful differences
were observed with the exception of sepA and aap transcripts,
which were found in higher amount within biofilm cells incubated with human plasma (Fig. 1H). SepA is a protease that
is involved in bacterial immune evasion through the degradation of antimicrobial peptides produced by the host (Lai et al.
2007). As it could be expected, as a defense mechanism, the
transcription of sepA would be increased in the presence of
either blood or plasma. However, the increased transcription
observed in plasma-exposed biofilms may be related to the
overrepresentation of host proteins and due to the absence of
leukocytes, which may interact with biofilm cells and selectively
4
FEMS Pathogens and Disease, 2016, Vol. 74, No. 2
trim the transcription of particular genes. Similarly, the higher
levels of aap transcripts detected in plasma-exposed biofilms
were probably due to the same reasons. Interestingly, it was
shown that host proteases are capable of activating Aap by proteolysis, which in turn will help to establish a more cohesive
biofilm with increased resistance to host factors (Rohde et al.
2005).
The ability of S. epidermidis biofilm cells to evade bacteriatargeting molecules present in human plasma provides an exceptional competence to survive in a wide variety of human fluids. Apart from constituting approximately 55% of whole human
blood, plasma is present, at varying concentrations, in several
other important body fluids such as lymphatic and synovial fluids, acute soft tissue wounds and burn wounds exudates (Cardile
et al. 2014), fluids where S. epidermidis biofilm infections may
have special incidence.
Overall these results indicate that, although plasma is less
capable of reducing the number of biofilm cells or biomass, is
the main regulator of the transcription of genes encoding key
biofilm virulence factors (Fig. 1G and H). In addition, this finding highlights the urgent need to study, in more detail, the interaction between the components of human plasma and S. epidermidis biofilms in order to better understand the capacity of
these bacterial cells to persist in the host. It is however important to highlight that the proteins that are secreted during bacterial infections (acute-phase proteins, such as C-reactive protein),
which may polarize biofilm response (Malachowa et al. 2011), are
not present in healthy individuals such the ones used for the experiments herein reported. Hence, in the future, to better comprehend the interplay between S. epidermidis biofilm cells and
human plasma components, it would be important to repeat
these experiments using plasma of infected patients. In addition, other S. epidermidis strains need to be tested since strainto-strain variability may occur, as we have previously shown
(Franca et al. 2013).
ACKNOWLEDGEMENTS
NC is an Investigador FCT. The authors would like to thank
Sandra Maia and Filomena Costa for human blood collection
procedure. The authors declare no conflict of interest.
FUNDING
This work was supported by European Union funds
(FEDER/COMPETE) and by national funds (FCT) under the project
with reference FCOMP-01-0124-FEDER-041246 (EXPL/BIAMIC/0101/2013). The authors thank the FCT Strategic Project
of UID/BIO/04469/2013 unit and the project FCOMP-01-0124FEDER-027462 (RECI/BBB-EBI/0179/2012). The funders had no
role in study design, data collection and analysis, decision to
publish, or preparation of the manuscript. AF acknowledges the
financial support of an individual grant SFRH/BPD/99961/2014.
Conflict of interest. None declared.
REFERENCES
Bayles KW. The biological role of death and lysis in biofilm development. Nat Rev Microbiol 2007;5:721–6.
Cardile AP, Sanchez CJ, Jr, Samberg ME et al. Human plasma enhances the expression of Staphylococcal microbial surface
components recognizing adhesive matrix molecules promoting biofilm formation and increases antimicrobial tolerance in vitro. BMC Res Notes 2014;7:457.
Cerca F, Andrade F, Franca A et al. Staphylococcus epidermidis
biofilms with higher proportions of dormant bacteria induce
a lower activation of murine macrophages. J Med Microbiol
2011a;60:1717–24.
Cerca F, Franca A, Perez-Cabezas B et al. Dormant bacteria
within Staphylococcus epidermidis biofilms have low inflammatory properties and maintain tolerance to vancomycin
and penicillin after entering planktonic growth. J Med Microbiol 2014;63:1274–83.
Cerca F, Trigo G, Correia A et al. SYBR green as a fluorescent
probe to evaluate the biofilm physiological state of Staphylococcus epidermidis, using flow cytometry. Can J Microbiol
2011b;57:850–6.
Cerca N, Gomes F, Pereira S et al. Confocal laser scanning microscopy analysis of S. epidermidis biofilms exposed to farnesol, vancomycin and rifampicin. BMC Res Notes 2012;5:244.
Cerca N, Jefferson KK, Oliveira R et al. Comparative antibodymediated phagocytosis of Staphylococcus epidermidis cells
grown in a biofilm or in the planktonic state. Infect Immun
2006;74:4849–55.
Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms:
a common cause of persistent infections. Science
1999;284:1318–22.
Franca A, Carvalhais V, Maira-Litran T et al. Alterations in the
Staphylococcus epidermidis biofilm transcriptome following interaction with whole human blood. Pathog Dis 2014;70:444–8.
Franca A, Freitas AI, Henriques AF et al. Optimizing a qPCR gene
expression quantification assay for S. epidermidis biofilms: a
comparison between commercial kits and a customized protocol. PLoS One 2012;7:e37480.
Franca A, Vilanova M, Cerca N et al. Monoclonal antibody raised
against PNAG has variable effects on static S. epidermidis
biofilm accumulation in vitro. Int J Biol Sci 2013;9:518–20.
Freitas AI, Vasconcelos C, Vilanova M et al. Optimization of
an automatic counting system for the quantification of
Staphylococcus epidermidis cells in biofilms. J Basic Microbiol
2014;54:750–7.
Gill SR, Fouts DE, Archer GL et al. Insights on evolution of virulence and resistance from the complete genome analysis
of an early methicillin-resistant Staphylococcus aureus strain
and a biofilm-producing methicillin-resistant Staphylococcus
epidermidis strain. J Bacteriol 2005;187:2426–38.
Hussain M, Herrmann M, von Eiff C et al. A 140-kilodalton
extracellular protein is essential for the accumulation of
Staphylococcus epidermidis strains on surfaces. Infect Immun
1997;65:519–24.
Kocianova S, Vuong C, Yao Y et al. Key role of poly-gamma-DLglutamic acid in immune evasion and virulence of Staphylococcus epidermidis. J Clin Invest 2005;115:688–94.
Kristian SA, Birkenstock TA, Sauder U et al. Biofilm formation
induces C3a release and protects Staphylococcus epidermidis
from IgG and complement deposition and from neutrophildependent killing. J Infect Dis 2008;197:1028–35.
Lai Y, Villaruz AE, Li M et al. The human anionic antimicrobial
peptide dermcidin induces proteolytic defence mechanisms
in staphylococci. Mol Microbiol 2007;63:497–506.
Mack D, Fischer W, Krokotshc A et al. The intercellular adhesin involved in biofilm accumulation of Staphylococcus
epidermidis is a liner beta-1.6-linked glucosaminoglycan:
purification and structural analysis. J Bacteriol 1996;178:
175–83.
França and Cerca
Malachowa N, Whitney AR, Kobayashi SD et al. Global changes in
Staphylococcus aureus gene expression in human blood. PLoS
One 2011;6:e18617.
Otto M. Staphylococcus epidermidis–the ‘accidental’ pathogen. Nat
Rev Microbiol 2009;7:555–67.
Pfaffl MW. Quantification strategies in real-time PCR. In: Bustin
SA (ed.). A-Z of quantitative PCR. La Jolla, CA, USA: International University Line, 2004, 87–112.
Pavlidis P, Noble WS. Matrix2png: a utility for visualizing matrix
data. Bioinformatics 2003;19:295–6.
Richards RL, Haigh RD, Pascoe B et al. Persistent Staphylococcus aureus Isolates from Two Independent Cases
of Bacteremia Display Increased Bacterial Fitness and
Novel Immune Evasion Phenotypes. Infect Immun 2015;83:
3311–24.
5
Rohde H, Burdelski C, Bartscht K et al. Induction of Staphylococcus epidermidis biofilm formation via proteolytic processing of
the accumulation-associated protein by staphylococcal and
host proteases. Mol Microbiol 2005;55:1883–95.
Sousa C, Franca A, Cerca N. Assessing and reducing sources
of gene expression variability in Staphylococcus epidermidis
biofilms. Biotechniques 2014;57:295–301.
Stewart PS, Franklin MJ. Physiological heterogeneity in biofilms.
Nat Rev Microbiol 2008;6:199–210.
Tormo MA, Knecht E, Gotz F et al. Bap-dependent biofilm formation by pathogenic species of Staphylococcus: evidence
of horizontal gene transfer? Microbiology 2005;151:2465–75.
Vadyvaloo V, Otto M. Molecular genetics of Staphylococcus epidermidis biofilms on indwelling medical devices. Int J Artif Organs
2005;28:1069–78.