Download Cytokine and Chemokine Gene Expression after Primary and

1780
Cytokine and Chemokine Gene Expression after Primary and Secondary
Respiratory Syncytial Virus Infection in Cotton Rats
Jorge C. G. Blanco,1 Joann Y. Richardson,2
Miriam E. R. Darnell,1,3 Anne Rowzee,1
Lioubov Pletneva,1 David D. Porter,4
and Gregory A. Prince1
1
Virion Systems, Rockville, and 2Department of Pediatrics, Uniformed
Services University of the Health Sciences, Bethesda, Maryland;
3
Graduate Program in Genetics, George Washington University,
Washington, DC; 4Department of Pathology and Laboratory
Medicine, University of California, Los Angeles,
School of Medicine, Los Angeles
The induction of pro- and anti-inflammatory cytokines and chemokines was studied in the
lungs of cotton rats after primary or secondary infection with respiratory syncytial virus (RSV).
Increases in messenger RNA (mRNA) levels of all genes analyzed were observed during the
course of primary infection. In general, mRNA expression peaked between postinfection days
1 and 4 and returned to near-normal levels by day 10. During secondary infection, the expression of some genes (i.e., interferon [IFN]– g and interleukin [IL]– 10) began earlier, some (i.e.,
IL-1b and macrophage inflammatory protein– 1b) began later, and some (i.e., IL-1b, IL-10,
growth-regulated protein, and tumor necrosis factor– a) showed prolonged expression, whereas
2 genes (i.e., IFN-a and IL-6) were not expressed. This study presents evidence of different kinetics of expression of inflammatory mediators during primary and secondary infection that
likely coincide with innate and adaptive immune response and complement previous observations that emphasize the role of inflammation in the pathogenesis of RSV disease.
Respiratory syncytial virus (RSV) is the primary cause of
viral bronchiolitis and pneumonia in infants [1]. Primary infection with RSV occurs in most infants during the first year of life,
often compromising the lower respiratory tract [2]. During primary RSV disease, lung epithelium and alveolar macrophages
are the first cells to be infected, triggering the production of a
wide range of proinflammatory cytokines and chemokines. In
cell culture studies, RSV infection caused enhanced expression
of the cytokines interleukin (IL)–1, IL-6, IL-10, and tumor necrosis factor (TNF)– a and the chemokines growth-regulated
protein (GRO), IL-8, interferon (IFN)– inducible protein (IP)–
10, macrophage inflammatory protein (MIP)–1b, and RANTES
[3–9]. Clinical studies have also detected IFN-g, IL-1, IL-6, IL8, IL-10, RANTES, and TNF-a in nasopharyngeal secretions in
children with lower respiratory tract infections [10–13].
This complex milieu of inflammatory mediators directs the
expression of cellular adhesion molecules, recruitment and trafficking of cellular components in the lung, enhancement of antigen presentation, cell activation, and differentiation and antibody
production. Together, these processes result in viral clearance
Received 7 November 2001; revised 12 February 2002; electronically published 31 May 2002.
Presented in part: RSV after 45 Years, from Bedside to Bench, Segovia, Spain,
1–3 October 2001 (abstract in session 3).
All animal experimentation procedures followed National Institutes of Health
and US Department of Agriculture guidelines.
Financial support: National Institutes of Health (RR-13161).
Reprints or correspondence: Dr. Jorge C. G. Blanco, Virion Systems, 9610
Medical Center Dr., Ste. 100, Rockville, MD 20850 ([email protected]).
The Journal of Infectious Diseases
2002;185:1780–5
q 2002 by the Infectious Diseases Society of America. All rights reserved.
0022-1899/2002/18512-0013$02.00
and, at the same time, elicit several histologic changes in the lung,
including lymphocytic peribronchiolitis, lymphocytic perivasculitis, and neutrophilic bronchitis.
Immunity to RSV is not durable. Repeated infections are common, sometimes occurring within months after primary infection. Although, in most cases, secondary infection develops
as a mild cold, it can evolve into tracheobronchitis, recurrent
wheezing, or even pneumonia [14]. The development of disease
in the presence of an existing immune response that appears to attenuate viral replication suggests that the immune response to
RSV results in the pathologic changes observed during secondary infection. This is also suggested by studies that compared viral
replication and histopathologic changes of lungs of cotton rats
during primary and secondary infection [15]. No infectious virus
could be detected in the lungs of secondarily infected animals
(assay sensitivity, >102 pfu/g), whereas the level observed during
primary infection was >1000-fold higher (105 pfu/g). Nonetheless, histopathologic changes in secondarily infected animals
occurred earlier and were accentuated over those in primarily
infected animals. This suggests a role for the memory immune
response in disease caused by secondary infection with RSV.
The characterization of RSV-induced profiles of cytokines and
chemokines during primary and secondary infection in the lungs
of cotton rats form the basis of the present report.
Materials and Methods
Animals. Inbred cotton rats (Sigmodon hispidus) were obtained
from a colony maintained at Virion Systems (Rockville, MD).
The cotton rats were housed in large polycarbonate rat cages with
a bedding of paper mill by-products (Care Fresh; Absorption) and
JID 2002;185 (15 June)
Cytokines, Chemokines, and RSV
fed a diet of rodent chow and water. The cotton rat colony was monitored for antibodies to paramyxoviruses, RSV, and rodent viruses,
and no such antibodies were found. The animals were, on average, 5
weeks old and weighed 60 g at the time of use.
Virus. The Long strain (group A) of RSV was obtained from the
American Type Culture Collection. Virus stock was prepared in
HEp-2 cells and contained 106 pfu/mL. Virus titers in the stocks
and in the organ homogenates were determined by plaque assay
on HEp-2 cells [16].
Experimental design. We inoculated cotton rats intranasally
under isoflurane anesthesia with 100 mL of RSV suspension containing 105 pfu. Uninfected rats and rats inoculated with uninfected
tissue culture supernatant (mock) were used as controls for our experiments. Rats were killed by CO2 inhalation at intervals thereafter
(1, 2, 3, 4, 5, 6, 7, 10, 14, and 21 days after primary infection; 1, 2, 3,
4, 5, 6, 7, 10, and 14 days after secondary infection). Lungs were
dissected and snap frozen at 270 C.
Reverse-transcriptase (RT) polymerase chain reaction (PCR)
analysis. Lung tissue was homogenized, and total RNA was isolated by use of an RNeasy purification kit (QIAGEN), according to
the manufacturer’s instructions. Relative quantities of mRNA for
each gene of interest were determined by semiquantitative RT-PCR,
as described elsewhere [17]. In brief, total RNA (1 mg) from each
sample was used for the preparation of cDNA by using oligo dT primers and Super Script II RT (Invitrogen). Primers used for this study
(forward and reverse) are summarized in table 1. The optimum number of cycles for each gene in lung tissue was determined empirically.
In brief, pilot PCRs were performed by using positive lung cDNA
control samples for each gene, and the number of cycles needed to
achieve the strongest unsaturated signal was used in subsequent experiments. The number of cycles used for each gene was as follows:
TNF-a, 24; IL-1b, 20; IL-6, 24; IL-10, 26; IFN-a, 28; IFN-g, 28;
RANTES, 25; IP-10, 23; MIP-1b, 23; and GRO, 26. b-Actin ( 22
cycles) was included as a housekeeping gene to control for differences in cDNA for each treatment during the amplification reaction.
Detection and quantification of PCR products. Amplified products were electrophoresed and transferred to nylon Hybond N+ memTable 1.
1781
branes (Amersham Pharmacia Biotech) in 10£ standard saline citrate
by a standard Southern blot technique. DNA was cross-linked by exposure to UV light and hybridized to an internal oligonucleotide
probe (table 1). Labeling of the probe and subsequent detection of
bound probe were carried out with an enhanced chemiluminescence
system (AlkPhos Direct; Amersham Pharmacia Biotech) after
exposure to X-OMAT AR autoradiography film (Kodak). Resulting
signals were quantified with a scanner (Cannon N650U) with National
Institutes of Health image software. The signal obtained for each
analyzed gene was normalized to the level of b-actin expressed in
the organ. Each point represents > 5 animals.
Results
We examined host gene expression during the course of RSV
primary infection for 21 days and secondary infection for 14 days.
Our prior study [15] demonstrated that viral replication during
primary infection peaked during days 3–5, with viral clearance
by day 10, whereas secondary infection resulted in no detectable
infectious virus at any time. In general, the genes that we analyzed
were not expressed at detectable levels in lungs of uninfected or
mock-treated cotton rats (figure 1A). Only IL-1b and RANTES
showed low levels of constitutive mRNA expression in these
animals.
During the first day of primary infection (figure 1), all the cytokines and chemokines that we assayed, with the exception of
IL-10, showed an increase in the steady-state level of mRNA
expression, with the latter increasing by day 2. Peak expression
levels were detected on day 1 for IL-6, TNF-a, and IFN-a; day
2 for IL-1b, GRO, RANTES, and IP-10; day 3 for IL-10 and
MIP-1b; and day 4 for IFN-g.
Even though secondary infection resulted in no detectable
viral replication, all but 2 of the 10 genes we examined were expressed. However, the patterns of expression generally differed
Primers and probes used for the amplification and detection of the indicated cotton rat genes.
Gene
GenBank
accession no.
TNF-b
IL-1b
Forward primera
Reverse primera
Probeb
AF421388
AF421387
AGGTCATCTTCTCAAAATTTGAG
GGACCTTCCAGGATGAGGACCTGAG
AAAGTAGACCTGCCCGGATTCTGCG
GGAAGGCATTAGAACCGCTCCAGCC
IL-6
IL-10
AF421389
AF398550
GGCACACTTAGGCACAGCATACTCG
CATCCTGCTAAGTGACTCCTTACT
IFN-a
IFN-g
RANTES
IP-10
MIP-1b
GRO
b-Actin
AF421386
AF167349
AF421391
AF421394
AF421392
AF421393
AF421789
GCTCAAGCCATCCTTGTCTC
CTTCTCACAGGCTCTTTTAG
AGCAGCAAATGCTCCAACTT
AACCAGAGAGAAGCCGATCA
CAGTCACCTCAGCACCAAGA
GCAGGGGTTCACTTCAAGAAC
GGCCAACCGTGAAAAGATGACTC
CACAACTCCATCTGCCCTCCAGGA
CATTCATGGCCTTGTAGAACACCTTTCTC
TTCAGCAACATCCAGTCAGG
TTAGATGACAGCGGTGCATC
CCAGGCTCTGAAGAGGACAC
GGCCGATAGTAAGCCATGAA
TGACCCCTATCCACACCAGT
GGTGTTTCAGAAGCCAGCATC
GTCCGCCTAGAAGCATTTGCG
TGTAGCCCACGTTGTAGCAAACCAG
GCTGGAGAGTGTGGATCCCAAGCAATACCCAAA
GCCTACTGAAAATCACCTCTGGTC
ACCTGGTAGAAGTGATGCCCCAGG
GCTGGGGACTGTGAGGCAGTACTTC
ACTTCACAGTCATTGAAGAAATAG
ATTTACCTGCCATTGCTTGC
GGTGTCCCTGGTTCTTCTGAAAG
AGGGCTCAGGAGTCCTTTTC
GGAAGCTTGCCTTAACCCTGAAGCC
CACAGAGTACTTGCGCTCAGGAGG
NOTE. GRO, growth-regulated protein; IFN, interferon; IL, interleukin; IP-10, IFN-inducible protein–10; MIP-1b, macrophage inflammatory protein–1b;
TNF-b, tumor necrosis factor–b.
a
Primers located in the 50 and 30 positions, respectively, of the indicated gene and used as pair for polymerase chain reaction (PCR) amplification.
b
Primers used for labeling and detecting PCR products after Southern blot hybridization.
1782
Blanco et al.
JID 2002;185 (15 June)
Figure 1. Cytokine and chemokine gene expression in cotton rat lungs during respiratory syncytial virus infection. A, Representative reversetranscriptase polymerase chain reaction results from an experimental set. Each band represents the expression of the analyzed gene in lung samples
from each animal. B, Signals representing expression of steady-state levels of RNA for a particular gene were individually quantified by densitometry; mean and SD are shown. GRO, growth-regulated protein; IFN, interferon; IL, interleukin; IP-10, IFN-inducible protein– 10; MIP-1b,
macrophage inflammatory protein–1b; TNF-a, tumor necrosis factor– a.
from those of primary infection (figure 2A and 2B). Two genes
(IL-6 and IFN-a) were not expressed at any time after secondary infection. Two genes (IFN-g and IL-10) were expressed earlier in secondary infection than in primary infection, and 2 other
genes (IL-1b and MIP-1b) showed delayed expression. Four
genes (IL-1b, IL-10, TNF-a, and GRO) showed prolonged
expression in secondary infection, compared with primary infection. Finally, RANTES and IP-10 showed essentially the
JID 2002;185 (15 June)
Cytokines, Chemokines, and RSV
1783
Figure 2. Cytokine and chemokine gene expression in cotton rat lungs during secondary infection with respiratory syncytial virus (RSV). A,
Representative reverse-transcriptase polymerase chain reaction results from an experimental set. Rats were rechallenged 21 days after infection.
B, Signals representing expression of steady-state levels of RNA for a particular gene were individually quantified by densitometry; mean and
SD are shown. C, Comparison of cytokine and chemokine expression in lungs of rats challenged with mock preparation of virus or RSV and analyzed on day 5. GRO, growth-regulated protein; IFN, interferon; IL, interleukin; IP-10, IFN-inducible protein–10; MIP-1b, macrophage inflammatory protein– 1b; TNF-a, tumor necrosis factor– a.
same expression patterns in both modes of infection. Mock controls performed for secondary infection experiments did not
show significant differences with the results seen on day 0 of
secondary infection (figure 2A and 2C). However, mock profile
of cytokines and chemokines differed from that observed on
postchallenge day 5 (figure 2C).
Discussion
Our findings in the context of primary RSV infection are consistent with those of other studies that used tissue culture of both
mouse and human samples, yet they extend these reports in
terms of the breadth of examined genes, the number of observa-
1784
Blanco et al.
tions per time point, and the duration of study. With the exception
of IL-10, the expression of which did not begin until postinfection
day 2, all the remaining genes examined (GRO, IFN-a, IFN-g,
IL-1b, IL-6, IP-10, MIP-1b, RANTES, and TNF-a) showed increased expression within 24 h of infection. Such gene expression preceded the development of histopathologic lesions [15]
and undoubtedly contributed to the development of the lesions.
The down-regulation of these genes by day 10 generally coincided
with the disappearance of the lesions, although RANTES and
TNF-a continued to be expressed through day 21.
Unlike primary infection, we know of no prior publications
that describe the expression of host inflammatory genes during
secondary RSV infection. We reported that secondary infection
of cotton rats 7 weeks after primary infection did not result in infectious progeny virus, yet these animals developed significant
pulmonary histopathologic lesions more rapidly than those undergoing primary infection [15]. The present report parallels
our histologic findings, because some genes (IL-10 and IFNg) were expressed earlier in secondary than in primary infection. Secondary infection also differed from primary infection
in that some genes were not expressed at peak levels until later
(IL-1b and MIP-1b) and some were expressed longer (IL-10,
TNF-a, GRO, and IL-1b), but there appeared to be no substantial differences in the expression of RANTES and IP-10 during
the 2 modes of infection. It is likely that these differences are
also reflected in the different patterns of histopathologic changes.
Two genes induced during primary infection, IL-6 and IFNa, were not expressed at detectable levels during secondary infection. IL-6 is expressed by RSV-infected lung epithelial cells
[8] and monocytes [3, 5, 18], and its lack of expression in cotton
rat secondary infection appears to be linked to the abortive
cycle of viral replication. The induction of IFN-a expression
by RSV has been controversial, with low or undetectable levels
of IFN-a in nasal washes [19–21] or in peripheral blood monocytes and macrophages [22, 23]. The absence of IFN-a in some
human specimens during primary infection may be due to its
relatively brief expression, since most patients would not be examined until > 3 days after infection. Its absence in secondary
infection, however, like that of IL-6, suggests that a complete
cycle of viral replication is required for its expression.
IFN-g showed extended expression during postinfection days
1–7. This observation correlates well with human RSV disease,
because IFN-g is the most prevalent cytokine produced by RSVspecific T cells [24], and its presence in nasopharyngeal washes
of children with lower respiratory tract infection correlates with
the severity of the disease [12].
With both primary and secondary infection, we assessed the
expression of mRNA from 4 chemokines with different chemoattractant potentials: GRO is a functional homologue of IL-8
that works mostly in the recruitment of neutrophils, IP-10 is a
chemoattractant for T cells and NK cells, MIP-1b is a chemoattractant for monocytes and also functions in the recruitment
of CD4 cells with increased specificity for the Th1 subtype, and
JID 2002;185 (15 June)
RANTES mediates chemotaxis of T cells, eosinophils, basophils,
and monocytes [25]. All 4 of these genes were expressed during
primary and secondary infection, with some differences in kinetics, and their expression undoubtedly influenced the recruitment of lymphocytes and macrophages to the lungs. The
absence of significant numbers of neutrophils, eosinophils, and
basophils suggests a more complex mechanism for their
recruitment.
Observations from the present report reinforce our prior
observation that an effective treatment of RSV disease should
use both antiviral and anti-inflammatory medications [26]. The
breadth of inflammatory gene expression suggests that a broad
spectrum of anti-inflammatory agents is likely to be favored.
Acknowledgments
We thank Maryna Eichelberger, Martin Ottolini, Kevin Yim,
and Lorraine Ward, for helpful discussions, and Charles Smith and
Victor Tineo, for assistance with the animals.
References
1. Collins PL, McIntosh K, Chanock RM. Respiratory syncytial virus. In:
Fields B, Knipe DM, Howley PM, et al., eds. Field virology. 3d ed. Philadelphia: Lippincott-Raven, 1996:1313– 51.
2. Holberg CJ, Wright AL, Martinez FD, Ray CG, Taussig LM, Lebowitz
MD. Risk factors for respiratory syncytial virus– associated lower respiratory illnesses in the first year of life. Am J Epidemiol 1991; 133:
1135–51.
3. Arnold R, Konig B, Galatti H, Werchau H, Konig W. Cytokine (IL-8, IL6, TNF-alpha) and soluble TNF receptor–I release from human peripheral blood mononuclear cells after respiratory syncytial virus infection.
Immunology 1995; 85:364–72.
4. Panuska JR, Merolla R, Rebert NA, et al. Respiratory syncytial virus induces interleukin-10 by human alveolar macrophages: suppression of
early cytokine production and implications for incomplete immunity.
J Clin Invest 1995; 96:2445–53.
5. Tsutsumi H, Matsuda K, Sone S, Takeuchi R, Chiba S. Respiratory syncytial virus– induced cytokine production by neonatal macrophages. Clin
Exp Immunol 1996; 106:442– 6.
6. Patel JA, Jiang Z, Nakajima N, Kunimoto M. Autocrine regulation of interleukin-8 by interleukin-1a in respiratory syncytial virus– infected
pulmonary epithelial cells in vitro. Immunology 1998; 95:501– 6.
7. Takeuchi R, Tsutsumi H, Osaki M, Sone S, Imai S, Chiba S. Respiratory
syncytial virus infection of neonatal monocytes stimulates synthesis of
interferon regulatory factor 1 and interleukin-1b (IL-1b)– converting
enzyme and secretion of IL-1b. J Virol 1998; 72:837–40.
8. Jiang Z, Kunimoto M, Patel JA. Autocrine regulation and experimental
modulation of interleukin-6 expression by human pulmonary epithelial
cells infected with respiratory syncytial virus. J Virol 1998; 72:2496– 9.
9. Zhang Y, Luxon BA, Casola A, Garofalo RP, Jamaluddin M, Brasier AR.
Expression of respiratory syncytial virus–induced chemokine gene networks in lower airway epithelial cells revealed by cDNA microarrays.
J Virol 2001; 75:9044–58.
10. Hornsleth A, Loland L, Larsen LB. Cytokines and chemokines in respiratory secretion and severity of disease in infants with respiratory syncytial
virus (RSV) infection. J Clin Virol 2001; 21:163–70.
11. Sheeran P, Jafri H, Carubelli C, et al. Elevated cytokine concentrations in
JID 2002;185 (15 June)
12.
13.
14.
15.
16.
17.
18.
Cytokines, Chemokines, and RSV
the nasopharyngeal and tracheal secretions of children with respiratory
syncytial virus disease. Pediatr Infect Dis J 1999; 18:115–22.
Bont L, Heijnen CJ, Kavelaars A, et al. Local interferon-g levels during
respiratory syncytial virus lower respiratory tract infection are associated with disease severity. J Infect Dis 2001; 184:355– 8.
Bont L, Heijnen CJ, Kavelaars A, et al. Monocyte IL-10 production during
respiratory syncytial virus bronchiolitis is associated with recurrent
wheezing in a one-year follow-up study. Am J Respir Crit Care Med
2000; 161:1518–23.
Henderson FW, Clyde WA Jr, Collier AM, et al. The etiologic and epidemiologic spectrum of bronchiolitis in pediatric practice. J Pediatr
1979; 95:183–90.
Prince GA, Prieels JP, Slaoui M, Porter DD. Pulmonary lesions in primary
respiratory syncytial virus infection, reinfection, and vaccine-enhanced disease in the cotton rat (Sigmodon hispidus). Lab Invest 1999; 79:1385– 92.
Prince GA, Jenson AB, Horswood RL, Camargo E, Chanock RM. The
pathogenesis of respiratory syncytial virus infection in cotton rats. Am
J Pathol 1978; 93:771– 91.
Salkowski CA, Detore G, Franks A, Falk MC, Vogel SN. Pulmonary and
hepatic gene expression following cecal ligation and puncture: monophosphoryl lipid A prophylaxis attenuates sepsis-induced cytokine and
chemokine expression and neutrophil infiltration. Infect Immun 1998;
66:3569–78.
Matsuda K, Tsutsumi H, Sone S, et al. Characteristics of IL-6 and TNFalpha production by respiratory syncytial virus– infected macrophages
in the neonate. J Med Virol 1996; 48:199–203.
1785
19. Moehring JM, Forsyth BR. The role of the interferon system in respiratory
syncytial virus infections. Proc Soc Exp Biol Med 1971; 138:1009–14.
20. Hall CB, Douglas RG Jr, Simons RL, Geiman JM. Interferon production
in children with respiratory syncytial, influenza, and parainfluenza
virus infections. J Pediatr 1978; 93:28– 32.
21. McIntosh K. Interferon in nasal secretions from infants with viral respiratory tract infections. J Pediatr 1978; 93:33–6.
22. Krilov LR, Hendry RM, Godfrey E, McIntosh K. Respiratory virus infection of peripheral blood monocytes: correlation with ageing of cells and
interferon production in vitro. J Gen Virol 1987; 68:1749–53.
23. Roberts NJ Jr, Hiscott J, Signs DJ. The limited role of the human interferon system response to respiratory syncytial virus challenge: analysis and
comparison to influenza virus challenge. Microb Pathog 1992; 12:
409– 14.
24. Brandenburg AH, Kleinjan A, van Het Land B, et al. Type 1– like immune
response is found in children with respiratory syncytial virus infection
regardless of clinical severity. J Med Virol 2000; 62:267–77.
25. Oppenheim JJ, Howard OM, Goetzl E. Chemotactic factors, neuropeptides, and other ligands for seven transmembrane receptors. In: Oppenheim JJ, Feldman M, eds. Cytokine reference: a compendium of cytokines and other mediators of host defense. San Diego: Academic
Press, 2000:985–1021.
26. Prince GA, Mathews A, Curtis SJ, Porter DD. Treatment of respiratory
syncytial virus bronchiolitis and pneumonia in a cotton rat model with
systemically administered monoclonal antibody (Palivizumab) and glucocorticosteroid. J Infect Dis 2000; 182:1326–30.